Structure, Dynamics, and RNA Interaction Analysis of the Human SBDS Protein

Shwachman-Bodian-Diamond syndrome is an autosomal recessive genetic syndrome with pleiotropic phenotypes, including pancreatic deficiencies, bone marrow dysfunctions with increased risk of myelodysplasia or leukemia, and skeletal abnormalities. This syndrome has been associated with mutations in the SBDS gene, which encodes a conserved protein showing orthologs in Archaea and eukaryotes. The Shwachman-Bodian-Diamond syndrome pleiotropic phenotypes may be an indication of different cell type requirements for a fully functional SBDS protein. RNA-binding activity has been predicted for archaeal and yeast SBDS orthologs, with the latter also being implicated in ribosome biogenesis. However, full-length SBDS orthologs function in a species-specific manner, indicating that the knowledge obtained from model systems may be of limited use in understanding major unresolved issues regarding SBDS function, namely, the effect of mutations in human SBDS on its biochemical function and the specificity of RNA interaction. We determined the solution structure and backbone dynamics of the human SBDS protein and describe its RNA binding site using NMR spectroscopy. Similarly to the crystal structures of Archaea, the overall structure of human SBDS comprises three well-folded domains. However, significant conformational exchange was observed in NMR dynamics experiments for the flexible linker between the N-terminal domain and the central domain, and these experiments also reflect the relative motions of the domains. RNA titrations monitored by heteronuclear correlation experiments and chemical shift mapping analysis identified a classic RNA binding site at the N-terminal FYSH (fungal, Yhr087wp, Shwachman) domain that concentrates most of the mutations described for the human SBDS. (C) 2010 Elsevier Ltd. All rights reserved.

Sdo1p, the yeast orthologue of Shwachman-Bodian-Diamond syndrome protein, binds RNA and interacts with nuclear rRNA-processing factors

The Shwachman-Bodian-Diamond syndrome protein (SBDS) is a member of a highly conserved protein family of not well understood function, with putative orthologues found in different organisms ranging from Archaea, yeast and plants to vertebrate animals. The yeast orthologue of SBDS, Sdo1p, has been previously identified in association with the 60S ribosomal subunit and is proposed to participate in ribosomal recycling. Here we show that Sdo1p interacts with nucleolar rRNA processing factors and ribosomal proteins, indicating that it might bind the pre-60S complex and remain associated with it during processing and transport to the cytoplasm. Corroborating the protein interaction data, Sdo1p localizes to the nucleus and cytoplasm and co-immunoprecipitates precursors of 60S and 40S subunits, as well as the mature rRNAs. Sdo1p binds RNA directly, suggesting that it may associate with the ribosomal subunits also through RNA interaction. Copyright (C) 2009 John Wiley & Sons, Ltd.

Conserved tissue expression signatures of intronic noncoding RNAs transcribed from human and mouse loci

It has been postulated that noncoding RNAs (ncRNAs) are involved in the posttranscriptional control of gene expression, and may have contributed to the emergence of the complex attributes observed in mammalians. We show here that the complement of ncRNAs expressed from intronic regions of the human and mouse genomes comprises at least 78,147 and 39,660 transcriptional units, respectively. To identify conserved intronic sequences expressed in both humans and mice, we used custom-designed human cDNA microarrays to separately interrogate RNA from mouse and human liver, kidney, and prostate tissues. An overlapping tissue expression signature was detected for both species, comprising 198 transcripts; among these, 22 RNAs map to intronic regions with evidence of evolutionary conservation in humans and mice. Transcription of selected human-mouse intronic ncRNAs was confirmed using strand-specific RT-PCR. Altogether, these results support an evolutionarily conserved role of intronic ncRNAs in human and mouse, which are likely to be involved in the fine tuning of gene expression regulation in different mammalian tissues. (C) 2008 Elsevier Inc. All rights reserved.

Characterization of the 4.5S RNA molecule in Escherichia coli

The 4.5S RNA molecule of Escherichia coli is essential to cell viability. It has been shown that depletion of this molecule inhibits protein synthesis, induces the heat shock response, and generally slows cell growth. The molecule has also been implicated in protein secretion, as in cells depleted of 4.5S RNA, an unsecreted precursor to ?-lactamase accumulates (pre-?-lactamase). A role in protein secretion is further supported by structural similarities with the 7S RNA molecule of eukaryotic SRP, specific binding to SRP54, and its homolog in E. coli, P48, and the ability of 7S RNA from certain archaebacteria to suppress 4.5S RNA depletion. In this study I have utilized strains with mutant forms of the 4.5S RNA genes in order to study the effect of altered 4.5S RNA on cell physiology. These strains have their mutant 4.55 RNA under the control of the tryptophan synthetic operon. Decreased growth rates, inhibited cell division, and altered protein synthesis all result from these mutations.

Identification of a bisegmented double-stranded RNA virus (picobirnavirus) in calf faeces

To determine the incidence of rotavirus infection among dairy herds in the State of Sdo Paulo, Brazil, 576 faecal samples obtained from calves aged 1-45 days with and without diarrhoea, reared on 63 dairy cattle farms, were analyzed. Polyacrylamide gel electrophoresis (PAGE) identified 28 samples positive for group A rotavirus, while four samples, two diarrhoeic and two non-diarrhoeic, showed a bisegmented genome with a typical picobirnavirus pattern. Electron microscopy revealed spherical virus particles with a diameter of 37 nm and without a defined surface structure. The present study is the first report of a bisegmented virus identified in cattle in Brazil. (C) 2003 Elsevier B.V. Ltd. All rights reserved.

Padronização da metodologia do RT-PCR utilizado para identificação do mRNA da alfa-amilase em sementes de milho

Durante a germinação das sementes, os carboidratos de reserva são degradados pela atividade de a-amilase. A identificação de mRNA é uma ferramenta fundamental para a definição da cinética de síntese de alfa-amilase. Objetivou-se padronizar a metodologia do RT-PCR para identificar o mRNA do gene de a-amilase em sementes de milho. Após três dias de germinação das cultivares Saracura-BRS 4154 e CATI-AL34, extraiu-se o RNA total pelo método do tiocianato de guanidina-fenol-clorofórmio, com algumas modificações. A partir do RNA total extraído foi obtido cDNA com utilização de random primers. A amplificação por PCR de uma porção do gene da alfa-amilase foi realizada com os primers: sense - CGACATCGACCACCTCAAC; antisense - TTGACCAGCTCCTGCCTGTC; gelatina; DMSO e 1,25 unidades de Taq DNA polimerase por reação e completados com água tratada com DEPC. Os ciclos para a amplificação foram 94ºC durante 4 minutos, seguidos por 34 ciclos de 94ºC durante 1 minuto, 42ºC durante 1 minuto e 72ºC durante 1,5 minutos e, finalmente, 72ºC por 5 minutos. O produto do RT-PCR apresentou uma banda de 249 pares de base (pb) bem definida, para as duas cultivares estudadas, não ocorrendo bandas inespecíficas. A técnica do RT-PCR mostrou ser uma metodologia eficiente para a identificação da expressão de alfa-amilase durante a germinação das sementes e pode ser usado para estudo qualitativo e quantitativo da cinética de síntese dessa enzima em experimentos de germinação.

Splice variants of the human ZC3H14 gene generate multiple isoforms of a zinc finger polyadenosine RNA binding protein

The human ZC3H14 gene encodes an evolutionarily conserved Cys(3)His zinc finger protein that binds specifically to polyadenosine RNA and is thus postulated to modulate post-transcriptional gene expression. Expressed sequence tag (EST) data predicts multiple splice variants of both human and mouse ZC3H14. Analysis of ZC3H14 expression in both human cell lines and mouse tissues confirms the presence of multiple alternatively spliced transcripts. Although all of these transcripts encode protein isoforms that contain the conserved C-terminal zinc finger domain, suggesting that they could all bind to polyadenosine RNA, they differ in other functionally important domains. Most of the alternative transcripts encode closely related proteins (termed isoforms 1, 2. 3, and 3short) that differ primarily in the inclusion of three small exons, 9, 10, and 11, resulting in predicted protein isoforms ranging from 82 to 64 kDa. Each of these closely related isoforms contains predicted classical nuclear localization signals (cNLS) within exons 7 and 11. Consistent with the presence of these putative nuclear targeting signals, these ZC3H14 isoforms are all localized to the nucleus. In contrast, an additional transcript encodes a smaller protein (34 kDa) with an alternative first exon (isoform, 4). Consistent with the absence of the predicted cNLS motifs located in exons 7 and 11, ZC3H14 isoform 4 is localized to the cytoplasm. Both EST data and experimental data suggest that this variant is enriched in testes and brain. Using an antibody that detects endogenous ZC3H14 isoforms 1-3 reveals localization of these isoforms to nuclear speckles. These speckles co-localize with the splicing factor, SC35, suggesting a role for nuclear ZC3H14 in mRNA processing. Taken together, these results demonstrate that multiple transcripts encoding several ZC3H14 isoforms exist in vivo. Both nuclear and cytoplasmic ZC3H14 isoforms could have distinct effects on gene expression mediated by the common Cys(3)His zinc finger polyadenosine RNA binding domain. (C) 2009 Elsevier B.V. All rights reserved.

An interaction between two RNA binding proteins, Nab2 and Pub1, links mRNA Processing/Export and mRNA stability

mRNA stability is modulated by elements in the mRNA transcript and their cognate RNA binding proteins. Poly(U) binding protein 1 (Pub1) is a cytoplasmic Saccharomyces cerevisiae mRNA binding protein that stabilizes transcripts containing AU-rich elements (AREs) or stabilizer elements (STEs). In a yeast two-hybrid screen, we identified nuclear poly(A) binding protein 2 (Nab2) as being a Pub1-interacting protein. Nab2 is an essential nucleocytoplasmic shuttling mRNA binding protein that regulates poly(A) tail length and mRNA export. The interaction between Pub1 and Nab2 was confirmed by copurification and in vitro binding assays. The interaction is mediated by the Nab2 zinc finger domain. Analysis of the functional link between these proteins reveals that Nab2, like Pub1, can modulate the stability of specific mRNA transcripts. The half-life of the RPS16B transcript, an ARE-like sequence-containing Pub1 target, is decreased in both nab2-1 and nab2-67 mutants. In contrast, GCN4, an STE-containing Pub1 target, is not affected. Similar results were obtained for other ARE- and STE-containing Pub1 target transcripts. Further analysis reveals that the ARE-like sequence is necessary for Nab2-mediated transcript stabilization. These results suggest that Nab2 functions together with Pub1 to modulate mRNA stability and strengthen a model where nuclear events are coupled to the control of mRNA turnover in the cytoplasm.

Trypanosoma cruzi: establishment of permeable cells for RNA processing analysis with drugs

Pre-mRNA maturation in trypanosomatids occurs through a process called trans-splicing which involves excision of introns and union of exons in two independent transcripts. For the first time, we present the standardization of Trypanosoma cruzi permeable cells (Y strain) as a model for trans-splicing study of mRNAs in trypanosomes, following by RNase protection reaction, which localizes the SL exon and intron. This trans-splicing reaction in vitro was also used to analyze the influence of NFOH-121, a nitrofurazone-derivative, on this mechanism. The results suggested that the prodrug affects the RNA processing in these parasites, but the trans-splicing reaction still occurred.

Interleukin 18 messenger RNA and proIL-18 protein expression in chorioamniotic membranes from pregnant women with preterm prelabor rupture of membranes

Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)

Efeito do estresse térmico agudo sobre os níveis da proteína e RNA mensageiro da Hsp70, em fígado e cérebro de pintos de corte de diferentes linhagens

Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)

Visual detection of turkey coronavirus RNA in tissues and feces by reverse-transcription loop-mediated isothermal amplification (RT-LAMP) with hydroxynaphthol blue dye

Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)

Lipopolysaccharide-induced Stem Cell Factor Messenger RNA Expression and Production in Odontoblast-like Cells

Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)

Implication of RNA-Binding Protein La in Proliferation, Migration and Invasion of Lymph Node-Metastasized Hypopharyngeal SCC Cells

The 5-year survival rate for oral cavity cancer is poorer than for breast, colon or prostate cancer, and has improved only slightly in the last three decades. Hence, new therapeutic strategies are urgently needed. Here we demonstrate by tissue micro array analysis for the first time that RNA-binding protein La is significantly overexpressed in oral squamous cell carcinoma (SCC). Within this study we therefore addressed the question whether siRNA-mediated depletion of the La protein may interfere with known tumor-promoting characteristics of head and neck SCC cells. Our studies demonstrate that the La protein promotes cell proliferation, migration and invasion of lymph node-metastasized hypopharyngeal SCC cells. We also reveal that La is required for the expression of beta-catenin as well as matrix metalloproteinase type 2 (MMP-2) within these cells. Taken together these data suggest a so far unknown function of the RNA-binding protein La in promoting tumor progression of head and neck SCC.