961 resultados para ANGLE NEUTRON-SCATTERING


Relevância:

30.00% 30.00%

Publicador:

Resumo:

We have resolved the solid-liquid phase transition of carbon at pressures around 150GPa. High-pressure samples of different temperatures were created by laser-driven shock compression of graphite and varying the initial density from 1.30g/cm3 to 2.25g/cm3. In this way, temperatures from 5700K to 14,500K could be achieved for relatively constant pressure according to hydrodynamic simulations. From measuring the elastic X-ray scattering intensity of vanadium K-alpha radiation at 4.95keVat a scattering angle of 126°, which is very sensitive to the solid-liquid transition, we can determine whether the sample had transitioned to the fluid phase. We find that samples of initial density 1.3g/cm3 and 1.85g/cm3 are liquid in the compressed states, whereas samples close to the ideal graphite crystal density of 2.25g/cm3 remain solid, probably in a diamond-like state.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Highly anisotropic, beam-like neutron emission with peak flux of the order of 10^9 n/sr was obtained from light nuclei reactions in a pitcher–catcher scenario, by employing MeV ions driven by subpetawatt laser. The spatial profile of the neutron beam, fully captured for the first time by employing a CR39 nuclear track detector, shows a FWHMdivergence angle of ~70 deg, with a peak flux nearly an order of magnitude higher than the isotropic component elsewhere. The observed beamed flux of neutrons is highly favourable for a wide range of applications, and indeed for further transport and moderation to thermal energies. A systematic study employing various combinations of pitcher–catcher materials indicates the dominant reactions being d(p, n+p)1Hand d(d,n)3He. Albeit insufficient cross-section data are available for modelling, the observed anisotropy in the neutrons’ spatial and spectral profiles are most likely related to the directionality and high energy of the projectile ions.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

New mathematical methods to analytically investigate linear acoustic radiation and scattering from cylindrical bodies and transducer arrays are presented. Three problems of interest involving cylinders in an infinite fluid are studied. In all the three problems, the Helmholtz equation is used to model propagation through the fluid and the beam patterns of arrays of transducers are studied. In the first problem, a method is presented to determine the omni-directional and directional far-field pressures radiated by a cylindrical transducer array in an infinite rigid cylindrical baffle. The solution to the Helmholtz equation and the displacement continuity condition at the interface between the array and the surrounding water are used to determine the pressure. The displacement of the surface of each transducer is in the direction of the normal to the array and is assumed to be uniform. Expressions are derived for the pressure radiated by a sector of the array vibrating in-phase, the entire array vibrating in-phase, and a sector of the array phase-shaded to simulate radiation from a rectangular piston. It is shown that the uniform displacement required for generating a source level of 220 dB ref. μPa @ 1m that is omni directional in the azimuthal plane is in the order of 1 micron for typical arrays. Numerical results are presented to show that there is only a small difference between the on-axis pressures radiated by phased cylindrical arrays and planar arrays. The problem is of interest because cylindrical arrays of projectors are often used to search for underwater objects. In the second problem, the errors, when using data-independent, classical, energy and split beam correlation methods, in finding the direction of arrival (DOA) of a plane acoustic wave, caused by the presence of a solid circular elastic cylindrical stiffener near a linear array of hydrophones, are investigated. Scattering from the effectively infinite cylinder is modeled using the exact axisymmetric equations of motion and the total pressures at the hydrophone locations are computed. The effect of the radius of the cylinder, a, the distance between the cylinder and the array, b, the number of hydrophones in the array, 2H, and the angle of incidence of the wave, α, on the error in finding the DOA are illustrated using numerical results. For an array that is about 30 times the wavelength and for small angles of incidence (α<10), the error in finding the DOA using the energy method is less than that using the split beam correlation method with beam steered to α; and in some cases, the error increases when b increases; and the errors in finding the DOA using the energy method and the split beam correlation method with beam steered to α vary approximately as a7 / 4 . The problem is of interest because elastic stiffeners – in nearly acoustically transparent sonar domes that are used to protect arrays of transducers – scatter waves that are incident on it and cause an error in the estimated direction of arrival of the wave. In the third problem, a high-frequency ray-acoustics method is presented and used to determine the interior pressure field when a plane wave is normally incident on a fluid cylinder embedded in another infinite fluid. The pressure field is determined by using geometrical and physical acoustics. The interior pressure is expressed as the sum of the pressures due to all rays that pass through a point. Numerical results are presented for ka = 20 to 100 where k is the acoustic wavenumber of the exterior fluid and a is the radius of the cylinder. The results are in good agreement with those obtained using field theory. The directional responses, to the plane wave, of sectors of a circular array of uniformly distributed hydrophones in the embedded cylinder are then computed. The sectors are used to simulate linear arrays with uniformly distributed normals by using delays. The directional responses are compared with the output from an array in an infinite homogenous fluid. These outputs are of interest as they are used to determine the direction of arrival of the plane wave. Numerical results are presented for a circular array with 32 hydrophones and 12 hydrophones in each sector. The problem is of interest because arrays of hydrophones are housed inside sonar domes and acoustic plane waves from distant sources are scattered by the dome filled with fresh water and cause deterioration in the performance of the array.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

We study the properties of the 1S0 pairing gap in low-density neutron matter. Different corrections to the lowest-order scattering length approximation are explored, resulting in a strong suppression with respect to the BCS result.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Within the quasimolecular (MO) kinematic dipole model we predict a strong dependence of the anisotropy of the MO radiation on the orientation of the heavy ion scattering plane relative to the direction of the photon detection plane.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

The crystallization of well-defined poly(L-lactide)-b-poly(epsilon-caprolactone) diblock copolymers, PLLA-b-PCL, was investigated by time-resolved X-ray techniques, polarized optical microscopy (POM), and differential scanning calorimetry (DSC). Two compositions were studied that contained 44 and 60 wt % poly(L-lactide), PLLA (they are referred to as (L44C5614)-C-11 and (L60C409)-C-12, respectively, with the molecular weight of each block in kg/mol as superscript). The copolymers were found to be initially miscible in the melt according to small-angle X-ray scattering measurements (SAXS). Their thermal behavior was also indicative of samples whose crystallization proceeds from a mixed melt. Sequential isothermal crystallization from the melt at 100 degreesC (for 30 min) and then at 30 degreesC (for 15 min) was measured. At 100 degreesC only the PLLA block is capable of crystallization, and its crystallization kinetics was followed by both WAXS and DSC; comparable results were obtained that indicated an instantaneous nucleation with three-dimensional superstructures (Avrami index of approximately 3). The spherulitic nature of the superstructure was confirmed by POM. When the temperature was decreased to 30 degreesC, the PCL block was able to crystallize within the PLLA negative spherulites (with an Avrami index of 2, as opposed to 3 in homo-PCL), and its crystallization rate was much slower than an equivalent homo-PCL. Time-resolved SAXS experiments in (L60C409)-C-12 revealed an initial melt mixed morphology at 165 degreesC that upon cooling transformed into a transient microphase-separated lamellar structure prior to crystallization at 100 degreesC.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

We have investigated the effect of sample hydration on the wide-angle X-ray scattering patterns of amyloid fibrils from two different sources, hen egg white lysozyme (HEWL) and an 11-residue peptide taken from the sequence of transthyretin (TTR105-115). Both samples show an inter-strand reflection at 4.7 Å and an inter-sheet reflection which occurs at 8.8 and 10 Å for TTR105-115 and HEWL fibrils, respectively. The positions, widths, and relative intensities of these reflections are conserved in patterns obtained from dried stalks and hydrated samples over a range of fibril concentrations. In 2D scattering patterns obtained from flow-aligned hydrated samples, the inter-strand and inter-sheet reflections showed, respectively, axial and equatorial alignment relative to the fibril axis, characteristic of the cross-β structure. Our results show that the cross-β structure of the fibrils is not a product of the dehydrating conditions typically employed to produce aligned samples, but is conserved in individual fibrils in hydrated samples under dilute conditions comparable to those associated with other biophysical and spectroscopic techniques. This suggests a structure consisting of a stack of two or more sheets whose interfaces are inaccessible to bulk water.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Recent developments in instrumentation and facilities for sample preparation have resulted in sharply increased interest in the application of neutron diffraction. Of particular interest are combined approaches in which neutron methods are used in parallel with X-ray techniques. Two distinct examples are given. The first is a single-crystal study of an A-DNA structure formed by the oligonucleotide d(AGGGGCCCCT)2, showing evidence of unusual base protonation that is not visible by X-ray crystallography. The second is a solution scattering study of the interaction of a bisacridine derivative with the human telomeric sequence d(AGGGTTAGGGTTAGGGTTAGGG) and illustrates the differing effects of NaCl and KCl on this interaction.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Molecular orientation parameters have been measured for the non-crystalline component of crosslinked natural rubber samples deformed in uniaxial tension as a function of the extension ratio and of temperature. The orientation parapeters 〈P2(cosα)〉 and 〈P4(cosα)〉 were obtained by an analysis of the anisotropy of the wide-angle X-ray scattering functions. For the measurements made at high temperatures the level of crystallinity detected was negligible and the orientation-strain behaviour could be compared directly with the predictions of molecular models of rubber elasticity. The molecular orientation behaviour with strain was found to be at variance with the estimates of the affine model particularly at low and moderate strains. Extension of the crosslinked rubber at room temperature led to strain-crystallization and measurements of both the molecular orientation of the non-crystalline chains and the degree of crystallinity during extension and relaxation enabled the role of the crystallites in the deformation process to be considered in detail. The intrinsic birefringence of the non-crystalline component was estimated, through the use of the 〈P2(cosα)〉 values obtained from X-ray scattering measurements, to be 0.20±0.02.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

An experimental method is described which enables the inelastically scattered X-ray component to be removed from diffractometer data prior to radial density function analysis. At each scattering angle an energy spectrum is generated from a Si(Li) detector combined with a multi-channel analyser from which the coherently scattered component is separated. The data obtained from organic polymers has an improved signal/noise ratio at high values of scattering angle, and a commensurate enhancement of resolution of the RDF at low r is demonstrated for the case of PMMA (ICI `Perspex'). The method obviates the need for the complicated correction for multiple scattering.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

A procedure is presented for obtaining full molecular orientation information from wide angle X-ray scattering patterns of deformed non-crystalline polymers. The method is based on the analysis of experimental and calculated scattering patterns into their spherical harmonics. The results obtained for PMMA are compared with values predicted by the pseudo affine and affine deformation schemes.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

A two-dimensional X-ray scattering system developed around a CCD-based area detector is presented, both in terms of hardware employed and software designed and developed. An essential feature is the integration of hardware and software, detection and sample environment control which enables time-resolving in-situ wide-angle X-ray scattering measurements of global structural and orientational parameters of polymeric systems subjected to a variety of controlled external fields. The development and operation of a number of rheometers purpose-built for the application of such fields are described. Examples of the use of this system in monitoring degrees of shear-induced orientation in liquid-crystalline systems and crystallization of linear polymers subsequent to shear flow are presented.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

The probability of a quantum particle being detected in a given solid angle is determined by the S-matrix. The explanation of this fact in time-dependent scattering theory is often linked to the quantum flux, since the quantum flux integrated against a (detector-) surface and over a time interval can be viewed as the probability that the particle crosses this surface within the given time interval. Regarding many particle scattering, however, this argument is no longer valid, as each particle arrives at the detector at its own random time. While various treatments of this problem can be envisaged, here we present a straightforward Bohmian analysis of many particle potential scattering from which the S-matrix probability emerges in the limit of large distances.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

The angular distributions for elastic scattering and breakup of halo nuclei are analysed using a near-side/far-side decomposition within the framework of the dynamical eikonal approximation. This analysis is performed for (11)Be impinging on Pb at 69 MeV/nucleon. These distributions exhibit very similar features. In particular they are both near-side dominated, as expected from Coulomb-dominated reactions. The general shape of these distributions is sensitive mostly to the projectile-target interactions, but is also affected by the extension of the halo. This suggests the elastic scattering not to be affected by a loss of flux towards the breakup channel. (C) 2010 Elsevier B.V. All rights reserved.