A method of analysing stream channel response to environmental change: gauge data for the Tully River

Gauging data are available from numerous streams throughout Australia, and these data provide a basis for historical analysis of geomorphic change in stream channels in response to both natural phenomena and human activities. We present a simple method for analysis of these data, and a briefcase study of an application to channel change in the Tully River, in the humid tropics of north Queensland. The analysis suggests that this channel has narrowed and deepened, rather than aggraded: channel aggradation was expected, given the intensification of land use in the catchment, upstream of the gauging station. Limitations of the method relate to the time periods over which stream gauging occurred; the spatial patterns of stream gauging sites; the quality and consistency of data collection; and the availability of concurrent land-use histories on which to base the interpretation of the channel changes.

HPV6b virus like particles are potent immunogens without adjuvant in man

Subjects with genital warts were immunized three times or more with HPV6b VLPs without adjuvant. All immunized subjects had DTH to HPV6b L1 protein. Of 32 subjects, nine had HPV6b specific antibody prior to immunization and 22 acquired antibody with immunization. VLP specific antibody increased following a single immunization in 6 of 8 subjects with low level antibody at recruitment. Complete regression of genital warts was observed in 25 of 33 evaluable subjects over the 20-week observation period. We conclude that immunization with HPV6b L1 VLPs without adjuvant induces immunity to the L1 protein epitopes recognised during natural infection, and may accelerate regression of warts. (C) 2000 Elsevier Science Ltd. All rights reserved.

Effect of additives on gelatinization, rheological properties and biodegradability of thermoplastic starch

Effect of additives on the starch gelatinization was governed by the processing conditions. The order-disorder transition of starch in water can occur in more than one way and the effect of polar additives on gelatinization can also be in more than one way. The additives appear to be plasticising thermoplastic starches, resulting in improving rheological properties. The thermoplastic starches with the additives are all biodegradable although the rates of biodegradability are slightly different.

Empirical catchment-wide rainfall erosivity models for two rivers in the humid tropics of Australia

The concept of rainfall erosivity is extended to the estimation of catchment sediment yield and its variation over time. Five different formulations of rainfall erosivity indices, using annual, monthly and daily rainfall data, are proposed and tested on two catchments in the humid tropics of Australia. Rainfall erosivity indices, using simple power functions of annual and daily rainfall amounts, were found to be adequate in describing the interannual and seasonal variation of catchment sediment yield. The parameter values of these rainfall erosivity indices for catchment sediment yield are broadly similar to those for rainfall erosivity models in relation to the R-factor in the Universal Soil Loss Equation.

Methods for prediction of peptide binding to MHC molecules: A comparative study

Background: A variety of methods for prediction of peptide binding to major histocompatibility complex (MHC) have been proposed. These methods are based on binding motifs, binding matrices, hidden Markov models (HMM), or artificial neural networks (ANN). There has been little prior work on the comparative analysis of these methods. Materials and Methods: We performed a comparison of the performance of six methods applied to the prediction of two human MHC class I molecules, including binding matrices and motifs, ANNs, and HMMs. Results: The selection of the optimal prediction method depends on the amount of available data (the number of peptides of known binding affinity to the MHC molecule of interest), the biases in the data set and the intended purpose of the prediction (screening of a single protein versus mass screening). When little or no peptide data are available, binding motifs are the most useful alternative to random guessing or use of a complete overlapping set of peptides for selection of candidate binders. As the number of known peptide binders increases, binding matrices and HMM become more useful predictors. ANN and HMM are the predictive methods of choice for MHC alleles with more than 100 known binding peptides. Conclusion: The ability of bioinformatic methods to reliably predict MHC binding peptides, and thereby potential T-cell epitopes, has major implications for clinical immunology, particularly in the area of vaccine design.

Development Resource Planning: Complexity of Product Development and the Capacity to Launch New Products

Overcommitment of development capacity or development resource deficiencies are important problems in new product development (NPD). Existing approaches to development resource planning have largely neglected the issue of resource magnitude required for NPD. This research aims to fill the void by developing a simple higher-level aggregate model based on an intuitive idea: The number of new product families that a firm can effectively undertake is bound by the complexity of its products or systems and the total amount of resources allocated to NPD. This study examines three manufacturing companies to verify the proposed model. The empirical results confirm the study`s initial hypothesis: The more complex the product family, the smaller the number of product families that are launched per unit of revenue. Several suggestions and implications for managing NPD resources are discussed, such as how this study`s model can establish an upper limit for the capacity to develop and launch new product families.

Highly integrated and automated high-speed grinding system for printer heads constructed by combination materials

The fabrication of heavy-duty printer heads involves a great deal of grinding work. Previously in the printer manufacturing industry, four grinding procedures were manually conducted in four grinding machines, respectively. The productivity of the whole grinding process was low due to the long loading time. Also, the machine floor space occupation was large because of the four separate grinding machines. The manual operation also caused inconsistent quality. This paper reports the system and process development of a highly integrated and automated high-speed grinding system for printer heads. The developed system, which is believed to be the first of its kind, not only produces printer heads of consistently good quality, but also significantly reduces the cycle time and machine floor space occupation.

Degradation of phenanthrene and pyrene in soil slurry reactors with immobilized bacteria Zoogloea sp.

The environmental fate of polycyclic aromatic hydrocarbons (PAHs) in soils is motivated by their wide distribution, high persistence, and potentially deleterious effect on human health. Polycyclic aromatic hydrocarbons constitute the largest group of environmental contaminants released in the environment. Therefore, the potential biodegradation of these compounds is of vital importance. A biocarrier suitable for the colonization by micro-organisms for the purpose of purifying soil contaminated by polycyclic aromatic hydrocarbons was developed. The optimized composition of the biocarrier was polyvinyl alcohol (PVA) 10%, sodium alginate (SA) 0.5%, and powdered activated carbon (PAC) 5%. There was no observable cytotoxicity of biocarriers on immobilized cells and a viable cell population of 1.86 x 10(10) g(-1) was maintained for immobilized bacterium. Biocarriers made from chemical methods had a higher biodegradation but lower mechanical strengths. Immobilized bacterium Zoogloea sp. had an ideal capability of biodegradation for phenanthrene and pyrene over a relative wide concentration range. The study results showed that the biodegradation of phenanthrene and pyrene reached 87.0 and 75.4%, respectively, by using the optimal immobilized method of Zoogloea sp. cultivated in a sterilized soil. Immobilized Zoogloea sp. was found to be effective for biodegrading the soil contaminated with phenanthrene and pyrene. Even in natural (unsterilized) soil, the biodegradation of phenanthrene and pyrene using immobilized Zoogloea sp. reached 85.0 and 67.1%, respectively, after 168 h of cultivation, more than twice that achieved if the cells were not immobilized on the biocarrier. Therefore, the immobilization technology enhanced the competitive ability of introduced micro-organisms and represents an effective method for the biotreatment of soil contaminated with phenanthrene and pyrene.

Interfacial interactions and structure of organic-inorganic nanohybrids

Understanding the interfacial interactions and structure is important to better design and application of organic-inorganic nanohybrids. This paper presents our recent molecular dynamic studies on organoclays and polymer nanocomposites, including the layering behavior of organoclays, structural and dynamic properties of dioctadecyldimethyl ammoniums in organoclays, and interfacial interactions and structure of polyurethane nanocomposites. The results demonstrate that the layering behaviors of organoclays are closely related to the chain length of quaternary alkyl ammoniums and cation exchangeable capacity of clays. In addition to typical layered structures such as monolayer, bilayer and pseudo-trilayer, a pseudo-quadrilayer structure was also observed in organoclays modified with dioctadecyldimethyl ammoniums (DODDMA). In such a structure, alkyl chains do not lie flat within a single layer but interlace, and also jump to the next layer or even the next nearest layer. Moreover, the diffusion constants of nitrogen and methylene atoms increase with the temperature and methelene towards the tail groups. For polyurethane nanocomposite, the van der Waals interaction between apolar alkyl chains and soft segments of polyurethane predominates the interactions between organoclay and polyurethane. Different from most bulk polyurethane systems, there is no distinct phase-separated structure for the polyurethane.

Urine Volume in Acute Kidney Injury: How Much Is Enough?

Eight hundred and seventy-nine patients with acute kidney injury were retrospectively studied over year and eleven months for evaluation of urine volume as a risk factor for death. They were divided into five groups, according to the 24 h urine volume (UV): anuric (UV <= 50 mL/24 h, group 1), oliguric (UV > 50 mL/24 h and < 400 mL/24 h, group 2), and non-oliguric (UV >= 400 mL/24 h). Nonoliguric group was subdivided in three subgroups: UV > 400 mL/24 h and <= 1000 mL/24 h (group 3, reference group), UV > 1000 mL/24 h and <= 2000 mL/24 h (group 4), and UV > 2000 mL/24 h (group 5). Linear tendency test (Mantel extension) pointed out a significant increase in mortality with UV decrease (p < 0.001), confirmed by multivariate analysis. Anuric and oliguric patients had increased risk of respectively 95% and 76% times for death compared to controls (p < 0.05). Patients from groups 4 and 5 presented a reduced risk for death of 50% and 70%, respectively, p = 0.004 and p = 0.001. In conclusion, urine volume was a strong independent factor for mortality in this cohort of AKI patients.

Impact of mild acute kidney injury (AKI) on outcome after open repair of aortic aneurysms

Recently, mild AKI has been considered as a risk factor for mortality in different scenarios. We conducted a retrospective analysis of the risk factors for two distinct definitions of AKI after elective repair of aortic aneurysms. Logistic regression was carried out to identify independent risk factors for AKI ( defined as >= 25% or >= 50% increase in baseline SCr within 48 h after surgery, AKI 25% and AKI 50%, respectively) and for mortality. Of 77 patients studied ( mean age 68 +/- 10, 83% male), 57% developed AKI 25% and 33.7% AKI 50%. There were no differences between AKI and control groups regarding comorbidities and diameter of aneurysms. However, AKI patients needed a supra-renal aortic cross-clamping more frequently and were more severely ill. Overall in-hospital mortality was 27.3%, which was markedly higher in those requiring a supra-renal aortic cross-clamping. The risk factors for AKI 25% were suprarenal aortic cross-clamping ( odds ratio 5.51, 95% CI 1.05-36.12, p = 0.04) and duration of operation for AKI 25% ( OR 6.67, 95% CI 2.23-19.9, p < 0.001). For AKI 50%, in addition to those factors, post-operative use of vasoactive drugs remained as an independent factor ( OR 6.13, 95% CI 1.64-22.8, p = 0.005). The risk factors associated with mortality were need of supra-renal aortic cross-clamping ( OR 9.6, 95% CI 1.37-67.88, p = 0.02), development of AKI 50% ( OR 8.84, 95% CI 1.31-59.39, p = 0.02), baseline GFR lower than 49 mL/min ( OR 17.07, 95% CI 2.00 145.23, p = 0.009), and serum glucose > 118 mg/dL in the post-operative period ( OR 19.99, 95% CI 2.32-172.28, p = 0.006). An increase of at least 50% in baseline SCr is a common event after surgical repair of aortic aneurysms, particularly when a supra-renal aortic cross-clamping is needed. Along with baseline moderate chronic renal failure, AKI is an independent factor contributing to the high mortality found in this scenario.

Human chromosomal fragile site FRA16B is an amplified AT-rich minisatellite repeat

Fragile sites are nonstaining gaps in chromosomes induced by specific tissue culture conditions. They vary both in population frequency and in the culture conditions required for induction. Folate-sensitive fragile sites are due to expansion of p(CCG)(n) trinucleotide repeats; however, the relationship between sequence composition and the chemistry of induction of fragile sites is unclear. To clarify this relationship, the distamycin A-sensitive fragile site FRA16B was isolated by positional cloning and found to be an expanded 33 bp AT-rich minisatellite repeat, p(ATATATTATATATTATATCTAATAATATAT(C)/(A)TA)(n) (consistent with DNA sequence binding preferences of chemicals that induce its cytogenetic expression). Therefore the mutation mechanism associated with trinucleotide repeats is also a property of minisatellite repeats (variable number tandem repeats).