The role of terminal tyrosine residues in the formation of tripeptide nanotubes: a crystallographic insight

Terminally protected acyclic tripeptides containing tyrosine residues at both termini self-assemble into nanotubes in crystals through various non-covalent interactions including intermolecular hydrogen bonds. The nanotube has an average internal diameter of 5 angstrom (0.5 nm) and the tubular ensemble is developed through the hydrogen-bonded phenolic-OH side chains of tyrosine (Tyr) residues [Org. Lett. 2004, 6, 4463]. We have synthesized and studied several tripeptides 3-6 to probe the role of tyrosine residues in nanotube structure formation. These peptides either have only one Tyr residue at N- or C-termini or they have one or two terminally located phenylalanine (Phe) residues. These tripeptides failed to form any kind of nanotubular structure in the solid state. Single crystal X-ray diffraction studies of these peptides 3-6 clearly demonstrate that substitution of any one of the terminal Tyr residues in the Boc-Tyr-X-Tyr-OMe (X=VaI or Ile) sequence disrupts the formation of the nanotubular structure indicating that the presence of two terminally located Tyr residues is vital for nanotube formation. (c) 2006 Elsevier Ltd. All rights reserved.

Anion-templated assembly of pseudorotaxanes: importance of anion template, strength of ion-pair thread association, and macrocycle ring size

A wide range of pseuclorotaxane assemblies containing positively charged pyridinium, pyridinium nicotinamide, imidazolium, benzimidazolium and guanidinium threading components, and macrocyclic isophthalamide polyether ligands have been prepared using a general anion templation procedure. In noncompetitive solvent media, coupling halide anion recognition by a macrocyclic ligand with ion-pairing between the halide anion and a strongly associated cation provides the driving force for interpenetration. Extensive solution H-1 NMR binding studies, thermodynamic investigations, and single-crystal X-ray structure determinations reveal that the nature of the halide anion template, strength of the ion-pairing between the anion template and the cationic threading component, and to a lesser extent favorable second sphere pi-pi aromatic stacking interactions between the positively charged threading component and macrocyclic ligand, together with macrocyclic ring size, affect the efficacy of pseudorotaxane formation.

Nitrogen donor ligands bearing N-H groups: Effect on catalytic and cytotoxic activity of molybdenum eta(3)-allyldicarbonyl complexes

Reactions of [Mo(eta(3)-C3H5)Br(CO)(2)(NCMe)(2)] with the bidentate nitrogen ligands 2-(2'-pyridyl)imidazole (L1), 2-(2'-pyridyl)benzimidazole (L2), N,N'-bis(2'-pyridinecarboxamido)-1,2-ethane (L3), and 2,2'-bisimidazole (L4) led to the new complexes [Mo(eta(3)-C3H5)Br(CO)(2)(L)] (L = L1, 1; L2, 2; L4, 4) and [{Mo(eta(3)-C3H5) Br(CO)(2)}(2)(mu-L-3)] (3). The reaction of complexes 2 and 3 with Tl[CF3SO3] afforded [Mo(eta(3)-C3H5)(CF3SO3)(CO)(2)(L2)] (2T) and [{Mo(eta(3)-C3H5)(CF3SO3)(CO)(2)}(2)(mu-L-3)] (3T). Complexes 3 and 2T were structurally characterized by single crystal X-ray diffraction, showing the facial allyl/carbonyls arrangement and the formation of the axial isomer. In 2T, two molecules are assembled in a hydrogen bond dimer. The four complexes 1-4 were tested as precursors in the catalytic epoxidation of cyclooctene and styrene, in the presence of t-butylhydroperoxide (TBHP), with moderate conversions and turnover frequencies for complexes 1-3 and very low ones for 4. The increasing number of N-H groups in the complexes seems to be responsible for the loss of catalytic activity, compared with other related systems. The cytotoxic activities of all the complexes were evaluated against HeLa cells. The results showed that compounds 1,2,4, and 2T exhibited significant activity, complexes 2 and 2T being particularly promising. (C) 2008 Elsevier B.V. All rights reserved.

Novel supramolecular network in tri- and mono-nuclear oxovanadium(V)-salicyl-hydroximate: Synthesis, structure and catalytic oxidation of hydrocarbons using H2O2 as terminal oxidant

oxovanadium(V) salicylhydroximate complexes, [VO(SHA)(H2O)]center dot 1.58H(2)O (1) and [V3O3(CSHA)(3) (H2O)(3)]center dot 3CH(3)COCH(3) (2) have been synthesized by reaction of VO43- with N-salicyl hydroxamic acid (SHAHS) and N-(5-chlorosalicyl) hydroxamic acid (CSHAH(3)), respectively, in methanol medium. Compound 1 on reaction with pyridine 2,6-dicarboxylic acid (PyDCH2) yields mononuclear complex [VO(SHAH(2))(PyDC)] (3). Treatment of compound 3 with hydrogen peroxide at low pH (2-3) and low temperature (0-5 degrees C) yields a stable oxoperoxovanadium(V) complex H[VO(O-2)(PyDC)(H2O)]center dot 2.5H(2)O (4). All four complexes (1-4) have been characterized by spectroscopic (IR, UV-Vis, V-51 NMR) and single crystal X-ray analyses. Intermolecular hydrogen bonds link complex 1 into hexanuclear clusters consisting of six {VNO5} octahedra surrounded by twelve {VNO5} octahedra to form an annular ring. While the molecular packing in 2 generates a two-dimensional framework hydrogen bonds involving the solvent acetone molecules, the mononuclear complexes 3 and 4 exhibit three-dimensional supramolecular architecture. The compounds 1 and 2 behave as good catalysts for oxygenation of benzylic, aromatic, carbocyclic and aliphatic hydrocarbons to their corresponding hydroxylated and oxygenated products using H2O2 as terminal oxidant; the process affords very good yield and turnover number. The catalysis work shows that cyclohexane is a very easily oxidizable substrate giving the highest turnover number (TON) while n-hexane and n-heptane show limited yield, longer time involvement and lesser TON than other hydrocarbons. (C) 2008 Elsevier Ltd. All rights reserved.

Effect of Stretching on the Structure of Cylinder- and Sphere-Forming Styrene-Isoprene-Styrene Block Copolymers

Two styrene-isoprene-styrene block copolymers Vector 4111 and 4113, exhibiting cylindrical (18 wt % PS) and spherical (16 wt % PS) morphology, respectively, have been examined under uniaxial elongation up to 200% strain. On the basis of stress-strain data, mechanical properties are compared for isotropic and oriented polystyrene domains. The structure at various stages of deformation has been determined from SAXS patterns in three planes and two principal deformation directions with respect to orientation. Samples showed a very high degree of hexagonal packing, resulting in an X-ray pattern taken parallel to the cylinder alignment approaching single crystal ordering. Cylinders were aligned with the closest packed planes parallel to film surface. Particular attention has been paid to a lattice deformation process occurring during the first stretching and relaxation cycle. For a copolymer with oriented cylindrical morphology the deformation was affine up to 120% strain. The microdomain spacing was calculated parallel and perpendicular to the stretching direction. The cylindrical microstructure orientation, quantified by Hermans' orientation factor reduced during elongation of oriented polymer, while the elongation of isotropic sample caused an increase of orientation. Deformation of all studied morphologies was reversible.

Solid phases of cyclopentane: combined experimental and simulation study

The phase diagram of cyclopentane has been studied by powder neutron diffraction, providing diffraction patterns for phases I, II, and III, over a range of temperatures and pressures. The putative phase IV was not observed. The structure of the ordered phase III has been solved by single-crystal diffraction. Computational modeling reveals that there are many equienergetic ordered structures for cyclopentane within a small energy range. Molecular dynamics simulations reproduce the structures and diffraction patterns for phases I and III and also show an intermediate disordered phase, which is used to interpret phase II.

Templated synthesis of the novel layered silver-antimony Sulfides [H3NCH2CH2NH2][Ag2SbS3] and [H3NCH2CH2NH2](2)[Ag5Sb3S8]

Two new silver-antimony sulfides, [C2H9N2][Ag2SbS3] (1) and [C2H9N2](2)[Ag5Sb3S8] (2), have been prepared solvothermally in the presence of ethylenediamine and characterized by single-crystal X-ray diffraction, thermogravimetry, and elemental analysis. Compound 1 crystallizes in the space group Pn (a = 6.1781(1) Angstrom, b =11.9491(3) Angstrom, c = 6.9239(2) Angstrom, =111.164(1)degrees) and 2 in the space group Pm (a = 6.2215(2) Angstrom, b = 15.7707(7) Angstrom, c = 11.6478(5) Angstrom, beta = 92.645(2)degrees). The structure of 1 consists of chains of fused five-membered Ag2SbS2 rings linked to form layers, between which the template molecules reside. Compound 2 contains honeycomb-like sheets of fused silver-antimony-sulfide six-membered rings linked to form double layers. The idealized structure can be considered to be an ordered defect derivative of that of lithium bismuthide, Li3Bi, and represents a new solid-state structure type.

[Cr(C6H18N4)(SbS3)], a chromium complex containing an unusual bidentate SbS33- ligand

A new chromium-antimony-sulfide, [Cr(C6H18N4)(SbS3)], has been synthesised under solvothermal conditions from CrCl3. 6H(2)O, Sb2S3 and S in the presence of triethylenetetramine at 433 K and characterised by single-crystal X-ray diffraction, thermogravimetry, elemental analysis and SQUID magnetometry. The structure of [Cr(C6H18N4)(SbS3)] consists of neutral mononuclear chromium-centred complexes, in which the Cr3+ is chelated by one tetradentate triethylenetetramine molecule and a bidentate SbS33- ligand, yielding distorted octahedral coordination. Intermolecular hydrogen bonds link individual molecules into layers within the ac plane. Within a layer, molecules occur in pairs with each member related by a centre of inversion. The Cr...Cr separation within a pair is approximately 6.5 Angstrom. Magnetic susceptibility data reveal Curie-Weiss behaviour with mu(eff) = 3.819(3)/mu(B) and a negligible Weiss constant, indicative of non-interacting Cr3+ ions. (C) 2003 Elsevier Science Ltd. All rights reserved.

Solvothermal synthesis of novel antimony sulphides containing [Sb4S7](2-) units

Two new antimony sulphides have been prepared solvothermally and characterised by single-crystal X-ray diffraction. [Co(en)(3)][Sb4S7] (1) was prepared at 140 degreesC from COS, Sb2S3 and S in the presence of ethylenediamine, whilst heating a mixture of Sb2S3, Co and S in tris(2aminoethyl)amine, N(CH2CH2NH2)(3), at 180 degreesC fegults in the formation of [C6H20N4][Sb4S7] (2). Both materials contain [Sb4S7](2-) chains formed from linkage of cyclic Sb3S63- units by SbS33- pyramids. In (1), the [Sb4S7] chains are linked by secondary Sb-S interactions to form sheets, between which the. charge balancing [Co(en)(3)](2+) cations reside. The structure of (2) involves interconnection of pairs of [Sb4S7](2-) chains through Sb2S2 rings to form isolated [Sb4S7](2-) double chains which are interleaved by protonated template molecules. (C) 2004 Elsevier B.V. All rights resereved.

Consequences of N,C,N '- and C,N,N '-coordination modes on electronic and photophysical properties of cyclometalated aryl ruthenium(II) complexes

The effects of isoelectronic replacement of a neutral nitrogen donor atom by an anionic carbon atom in terpyridine ruthenium(II) complexes on the electronic and photophysical properties of the resulting N,C,N'- and C,N,N'-cyclometalated aryl ruthenium(II) complexes were investigated. To this end, a series of complexes was prepared either with ligands containing exclusively nitrogen donor atoms, that is, [Ru(R-1-tpy)(R-2-tpy)](2+) (R-1, R-2 = H, CO2Et), or bearing either one N,C,N'- or C,N,N'-cyclometalated ligand and one tpy ligand, that is, [Ru(R-1-(NCN)-C-Lambda-N-Lambda)(R-2-tpy)](+) and [Ru(R-1-(CNN)-N-Lambda-N-Lambda)(R-2-tpy)](+), respectively. Single-crystal X-ray structure determinations showed that cyclometalation does not significantly alter the overall geometry of the complexes but does change the bond lengths around the ruthenium(II) center, especially the nitrogen-to-ruthenium bond length trans to the carbanion. Substitution of either of the ligands with electron-withdrawing ester functionalities fine-tuned the electronic properties and resulted in the presence of an IR probe. Using trends obtained from redox potentials, emission energies, IR spectroelectrochemical responses, and the character of the lowest unoccupied molecular orbitals from DFT studies, it is shown that the first reduction process and luminescence are associated with the ester-substituted C,N,N'-cyclometalated ligand in [Ru(EtO2C-(CNN)-N-Lambda-N-Lambda)(tpy)](+). Cyclometalation in an N,C,N'-bonding motif changed the energetic order of the ruthenium d(zx), d(yz), and d(xy) orbitals. The red-shifted absorption in the N,C,N'-cyclometalated complexes is assigned to MLCT transitions to the tpy ligand. The red shift observed upon introduction of the ester moiety is associated with an increase in intensity of low-energy transitions, rather than a red shift of the main transition. Cyclometalation in the C,N,N'-binding motif also red-shifts the absorption, but the corresponding transition is associated with both ligand types. Luminescence of the cyclometalated complexes is relatively independent of the mode of cyclometalation, obeying the energy gap law within each individual series.

Formation of crystalline macrocyclic phases during electrophilic precipitation-polycondensation syntheses of poly(arylene ether ketone)s

Elongated crystalline particles formed as by-products during poly(arylene ether ketone) synthesis by electrophilic precipitation-polycondensation of 4,4'-diphenoxybenzophenone with terephthaloyl chloride or isophthaloyl chloride, thought previously to be polymer-whiskers, have now been identified as macrocyclic phases. Single crystal X-ray analysis of the needle-like particles formed in the reaction with terephthaloyl chloride, using the microdiffraction technique with synchrotron radiation, revealed that they consist of a macrocylic compound containing ten phenylene units, i.e. the [2 + 2] cyclic dimer. An analogous structure has also been demonstrated for the corresponding macrocycle derived from the reaction of 4,4-diphenoxybenzophenone with isophthaloyl chloride. Chloroform extraction of the products of the two polycondensations dissolved the macrocyclic material (but not the linear polymer), and analysis of the extracts by MALDI-TOF mass spectrometry demonstrated the presence in both cases of homologous families of macrocyclic products. Higher yields of macrocycles were obtained under pseudo-high dilution conditions, enabling the [2 + 2] cyclodimers from reactions of 4,4'-diphenoxybenzophenone with both terephthaloyl and isophthaloyl chloride to be isolated as pure compounds and fully characterised. (C) 2003 Published by Elsevier Ltd.

Cyclam derivatives containing three acetate pendant arms: synthesis, acid-base, metal complexation and structural studies

The ligands 1,4,8,11-tetraazacyclotetradecane-1,4,8-triacetic-11-methylphosphonic acid (H(5)te3a1p) and 1,4,8,11-tetraazacyclotetradecane-1,4,8-triacetic acid (H(3)te3a) were synthesized, the former one for the first time. The syntheses of these ligands were achieved from reactions on 1,4,8,11-tetraazacyclotetradecane-1,4,8-tris( carbamoylmethyl) hydroiodide (te3am center dot HI), and compounds (Hte3am)(+), 1, and (H(7)te3a1p)(2+), 4, were characterized by X-ray diffraction. Structures of two other compounds resulting from side-reactions, (H(2)te2lac)(2+), 2, and (H(4)te2a2p(OEt2))(2+), 3, were also determined by X-ray diffraction. Potentiometric titrations of H(5)te3a1p and H(3)te3a were performed at 298.2 K and ionic strength 0.10 mol dm(-3) in NMe4NO3 to determine their protonation constants. H-1 and P-31 NMR titrations of H(5)te3a1p were carried out in order to determine the very high first protonation constant of this ligand and to elucidate the sequence of protonation. Potentiometric studies of the two ligands with Ca2+, Mn2+, Co2+, Ni2+, Cu2+, Zn2+, Cd2+ and Pb2+ metal ions performed in the same experimental conditions showed that the complexes of H5te3a1p present very high thermodynamic stability while complexes of H(3)te3a, particularly Co2+ and Zn2+, are even more stable. P-31 NMR spectra of the cadmium(II) complex of H(5)te3a1p showed that the phosphonate moiety was coordinated to the metal ion. The UV-vis-NIR spectroscopic data and magnetic moment values of Co2+ and Ni2+ complexes of H(5)te3a1p and H(3)te3a together with the EPR of the corresponding Cu2+ complexes indicated that all these complexes adopt distorted octahedral coordination geometries in solution. This was confirmed by the single crystal structure of [Cu-2(Hte3a)(H2O)(3)Cl]Cl-0.5(ClO4)(0.5) center dot 2H(2)O that showed two distorted octahedral copper centres bridged by a N-acetate pendant arm with a Cu center dot center dot center dot Cu distance of 4.890(1) angstrom. The first one is encapsulated into the macrocyclic cavity surrounded by four nitrogen and two oxygen donors from the macrocycle, whereas the second one is on the periphery of the macrocycle and is coordinated to two oxygen atoms of one acetate pendant arm in chelating fashion, one chloride and three water molecules.

Combined neutron and X-ray diffraction studies of DNA in crystals and solutions

Recent developments in instrumentation and facilities for sample preparation have resulted in sharply increased interest in the application of neutron diffraction. Of particular interest are combined approaches in which neutron methods are used in parallel with X-ray techniques. Two distinct examples are given. The first is a single-crystal study of an A-DNA structure formed by the oligonucleotide d(AGGGGCCCCT)2, showing evidence of unusual base protonation that is not visible by X-ray crystallography. The second is a solution scattering study of the interaction of a bisacridine derivative with the human telomeric sequence d(AGGGTTAGGGTTAGGGTTAGGG) and illustrates the differing effects of NaCl and KCl on this interaction.

Structures and negative thermal expansion properties of the one-dimensional cyanides, CuCN, AgCN and AuCN

The behaviour of the lattice parameters of HTCuCN (high-temperature form), AgCN and AuCN have been investigated as a function of temperature over the temperature range 90–490 K. All materials show one-dimensional negative thermal expansion (NTE) along the ––(M––CN)–– chain direction c (ac(HT-CuCN) ¼32.1 10–6 K1, ac(AgCN)¼23.910–6 K1 and ac(AuCN) ¼9.3106 K1 over the temperature range 90–490 K). The origin of this behaviour has been studied using RMC modelling of Bragg and total neutron diffraction data from AgCN and AuCN at 10 and 300 K. These analyses yield details of the local motions within the chains responsible for NTE. The low-temperature form of CuCN, LT-CuCN, has been studied using single-crystal X-ray diffraction. In this form of CuCN, wavelike distortions of the ––(Cu––CN)–– chains occur in the static structure, which are reminiscent of the motions seen in the RMC modelling of AgCN and AuCN, which are responsible for the NTE behaviour.

Induced-fit binding of π-electron donor substrates to macrocyclic aromatic ether-imide-sulfones: a versatile approach to molecular assembly

Novel macrocyclic receptors which bind electron-donor aromatic substrates via π-stacking donor- acceptor interactions are obtained by cyclo-imidization of an amine-functionalized arylether-sulfone with pyromellitic- and 1,4,5,8-naphthalene-tetracarboxylic dianhydrides. These macrocycles complex with a wide variety of π-donor substrates including tetrathiafulvalene, naphthalene, anthracene, pyrene, perylene, and functional derivatives of these polycyclic hydrocarbons. The resulting supramolecular assemblies range from simple 1:1 complexes, to [2]- and [3]-pseudorotaxanes, and even (as a result of crystallographic disorder) an apparent polyrotaxane. Direct, five-component self-assembly of a metal-centred [3]pseudorotaxane is also observed, on complexation of a macrocyclic ether-imide with 8-hydroxyquinoline in the presence of palladium(II) ions. Binding studies in solution were carried out by 1H NMR and UV-visible spectroscopy, and the stoichiometries of binding were confirmed by Job plots based on charge-transfer absorption bands. The highest association constants are found for strong π-donor guests with large surface-areas, notably perylene and 1-hydroxypyrene, for which Ka values of 1.4 x 103 and 2.3 x 103 M-1 respectively are found. Single crystal X-ray analyses of the receptors and their derived complexes reveal large, induced-fit distortions of the macrocyclic frameworks as a result of complexation. These structures provide compelling evidence for the existence of strong, attractive forces between the electronically-complementary aromatic π-systems of host and guest.