Effect of fatty acids on leukocyte function

Fatty acids have various effects on immune and inflammatory responses, acting as intracellular and intercellular mediators. Polyunsaturated fatty acids (PUFAs) of the omega-3 family have overall suppressive effects, inhibiting lymphocyte proliferation, antibody and cytokine production, adhesion molecule expression, natural killer cell activity and triggering cell death. The omega-6 PUFAs have both inhibitory and stimulatory effects. The most studied of these is arachidonic acid that can be oxidized to eicosanoids, such as prostaglandins, leukotrienes and thromboxanes, all of which are potent mediators of inflammation. Nevertheless, it has been found that many of the effects of PUFA on immune and inflammatory responses are not dependent on eicosanoid generation. Fatty acids have also been found to modulate phagocytosis, reactive oxygen species production, cytokine production and leukocyte migration, also interfering with antigen presentation by macrophages. The importance of fatty acids in immune function has been corroborated by many clinical trials in which patients show improvement when submitted to fatty acid supplementation. Several mechanisms have been proposed to explain fatty acid modulation of immune response, such as changes in membrane fluidity and signal transduction pathways, regulation of gene transcription, protein acylation, and calcium release. In this review, evidence is presented to support the proposition that changes in cell metabolism also play an important role in the effect of fatty acids on leukocyte functioning, as fatty acids regulate glucose and glutamine metabolism and mitochondrial depolarization.

Cloning and characterization of Echinococcus granulosus (Cestode) EgactI and EgactII actin gene promoters and their functional analysis in the NIH3T3 mouse cell line

We report here for the first time the structure and function of a promoter from a cestode. The ability of DNA fragments respectively encompassing the 935-bp and 524-bp regions upstream from the ATG codon from the EgactI and EgactII actin genes of Echinococcus granulosus to promote transcription was studied in the NIH3T3 mouse cell line. The results of transfection assays showed that both regions have strong promoter activity in these cells. The fragments were tested in both orientations and the 524-bp fragment of EgactII presented a bidirectional promoter activity. Deletion analysis of EgactI and EgactII promoters indicated the presence of regulatory regions containing putative silencer elements. These results indicate that both EgactI and EgactII promoters are functional and that the preliminary functional evaluation of E. granulosus and possibly of other cestode promoters can be performed in heterologous cell lines.

Insights into the physiological function of cellular prion protein

Prions have been extensively studied since they represent a new class of infectious agents in which a protein, PrPsc (prion scrapie), appears to be the sole component of the infectious particle. They are responsible for transmissible spongiform encephalopathies, which affect both humans and animals. The mechanism of disease propagation is well understood and involves the interaction of PrPsc with its cellular isoform (PrPc) and subsequently abnormal structural conversion of the latter. PrPc is a glycoprotein anchored on the cell surface by a glycosylphosphatidylinositol moiety and expressed in most cell types but mainly in neurons. Prion diseases have been associated with the accumulation of the abnormally folded protein and its neurotoxic effects; however, it is not known if PrPc loss of function is an important component. New efforts are addressing this question and trying to characterize the physiological function of PrPc. At least four different mouse strains in which the PrP gene was ablated were generated and the results regarding their phenotype are controversial. Localization of PrPc on the cell membrane makes it a potential candidate for a ligand uptake, cell adhesion and recognition molecule or a membrane signaling molecule. Recent data have shown a potential role for PrPc in the metabolism of copper and moreover that this metal stimulates PrPc endocytosis. Our group has recently demonstrated that PrPc is a high affinity laminin ligand and that this interaction mediates neuronal cell adhesion and neurite extension and maintenance. Moreover, PrPc-caveolin-1 dependent coupling seems to trigger the tyrosine kinase Fyn activation. These data provide the first evidence for PrPc involvement in signal transduction.

Hemochromatosis (HFE) gene mutations in Brazilian chronic hemodialysis patients

Patients with chronic renal insufficiency (CRI) have reduced hemoglobin levels, mostly as a result of decreased kidney production of erythropoietin, but the relation between renal insufficiency and the magnitude of hemoglobin reduction has not been well defined. Hereditary hemochromatosis is an inherited disorder of iron metabolism. The importance of the association of hemochromatosis with treatment for anemia among patients with CRI has not been well described. We analyzed the frequency of the C282Y and H63D mutations in the HFE gene in 201 Brazilian individuals with CRI undergoing hemodialysis. The analysis of the effects of HFE mutations on iron metabolism and anemia with biochemical parameters was possible in 118 patients of this study (hemoglobin, hematocrit, ferritin levels, transferrin saturation, and serum iron). A C282Y heterozygous mutation was found in 7/201 (3.4%) and H63D homozygous and heterozygous mutation were found in 2/201 (1.0%) and 46/201 (22.9%), respectively. The allelic frequencies of the HFE mutations (0.017 for C282Y mutation and 0.124 for H63D mutation) did not differ between patients with CRI and healthy controls. Regarding the biochemical parameters, no differences were observed between HFE heterozygous and mutation-negative patients, although ferritin levels were not higher among patients with the H63D mutation (P = 0.08). From what we observed in our study, C282Y/H63D HFE gene mutations are not related to degrees of anemia or iron stores in CRI patients receiving intravenous iron supplementation (P > 0.10). Nevertheless, the present data suggest that the H63D mutation may have an important function as a modulating factor of iron overload in these patients.

Combating oncogene activation associated with retrovirus-mediated gene therapy of X-linked severe combined immunodeficiency

A successful gene therapy clinical trial that also encountered serious adverse effects has sparked extensive study and debate about the future directions for retrovirus-mediated interventions. Treatment of X-linked severe combined immunodeficiency with an oncoretrovirus harboring a normal copy of the gc gene was applied in two clinical trials, essentially curing 13 of 16 infants, restoring a normal immune system without the need for additional immune-related therapies. Approximately 3 years after their gene therapy, tragically, 3 of these children, all from the same trial, developed leukemia as a result of this experimental treatment. The current understanding of the mechanism behind this leukemogenesis involves three critical and cooperating factors, i.e., viral integration, oncogene activation, and the function of the therapeutic gene. In this review, we will explore the causes of this unwanted event and some of the possibilities for reducing the risk of its reoccurrence.

Is there an association between T102C polymorphism of the serotonin receptor 2A gene and urinary incontinence?

The regulation of bladder function is influenced by central serotonergic modulation. Several genetic polymorphisms related to serotonin control have been described in the literature. T102C polymorphism of the serotonin receptor 2A gene (5-HT2A) has been shown to be associated with certain diseases such as non-fatal acute myocardial infarction, essential hypertension, and alcoholism. In the present study, we examined the association between 5-HT2A gene polymorphism and urinary incontinence in the elderly. A case-control study was performed in 298 elderly community dwellers enrolled in the Gravataí-GENESIS Project, Brazil, which studies gene-environmental interactions in aging and age-related diseases. Clinical, physical, biochemical, and molecular analyses were performed on volunteers. 5-HT2A genotyping was determined by PCR-RFLP techniques using the HpaII restriction enzyme. The subjects had a mean age of 68.05 ± 6.35 years (60-100 years), with 16.9% males and 83.1% females. The C allele frequency was 0.494 and the T allele frequency was 0.506. The CC genotype frequency was 21.78%, the CT genotype frequency was 55.24% and the TT genotype frequency was 22.98%. We found an independent significant association between the TT genotype (35.7%) and urinary incontinence (OR = 2.06, 95%CI = 1.16-3.65). Additionally, urinary incontinence was associated with functional dependence and systolic hypertension. The results suggest a possible genetic influence on urinary incontinence involving the serotonergic pathway. Further investigations including urodynamic evaluation will be performed to better explain our findings.

Effect of immobilization stress on gene expression of catecholamine biosynthetic enzymes in heart auricles of socially isolated rats

Chronic stress is associated with the development of cardiovascular diseases. The sympathoneural system plays an important role in the regulation of cardiac function both in health and disease. In the present study, the changes in gene expression of the catecholamine biosynthetic enzymes tyrosine hydroxylase (TH), dopamine-β-hydroxylase (DBH) and phenylethanolamine N-methyltransferase (PNMT) and protein levels in the right and left heart auricles of naive control and long-term (12 weeks) socially isolated rats were investigated by Taqman RT-PCR and Western blot analysis. The response of these animals to additional immobilization stress (2 h) was also examined. Long-term social isolation produced a decrease in TH mRNA level in left auricles (about 70%) compared to the corresponding control. Expression of the DBH gene was markedly decreased both in the right (about 62%) and left (about 81%) auricles compared to the corresponding control, group-maintained rats, whereas PNMT mRNA levels remained unchanged. Exposure of group-housed rats to acute immobilization for 2 h led to a significant increase of mRNA levels of TH (about 267%), DBH (about 37%) and PNMT (about 60%) only in the right auricles. Additional 2-h immobilization of individually housed rats did not affect gene expression of these enzymes in either the right or left auricle. Protein levels of TH, DBH and PNMT in left and right heart auricles were unchanged either in both individually housed and immobilized rats. The unchanged mRNA levels of the enzymes examined after short-term immobilization suggest that the catecholaminergic system of the heart auricles of animals previously exposed to chronic psychosocial stress was adapted to maintain appropriate cardiovascular homeostasis.

The novel p.E89K mutation in the SRY gene inhibits DNA binding and causes the 46,XY disorder of sex development

Male sex determination in humans is controlled by the SRY gene, which encodes a transcriptional regulator containing a conserved high mobility group box domain (HMG-box) required for DNA binding. Mutations in the SRY HMG-box affect protein function, causing sex reversal phenotypes. In the present study, we describe a 19-year-old female presenting 46,XY karyotype with hypogonadism and primary amenorrhea that led to the diagnosis of 46,XY complete gonadal dysgenesis. The novel p.E89K missense mutation in the SRY HMG-box was identified as a de novo mutation. Electrophoretic mobility shift assays showed that p.E89K almost completely abolished SRY DNA-binding activity, suggesting that it is the cause of SRY function impairment. In addition, we report the occurrence of the p.G95R mutation in a 46,XY female with complete gonadal dysgenesis. According to the three-dimensional structure of the human SRY HMG-box, the substitution of the conserved glutamic acid residue by the basic lysine at position 89 introduces an extra positive charge adjacent to and between the positively charged residues R86 and K92, important for stabilizing the HMG-box helix 2 with DNA. Thus, we propose that an electrostatic repulsion caused by the proximity of these positive charges could destabilize the tip of helix 2, abrogating DNA interaction.

RNAi-mediated knockdown of pituitary tumor- transforming gene-1 (PTTG1) suppresses the proliferation and invasive potential of PC3 human prostate cancer cells

Pituitary tumor-transforming gene-1 (PTTG1) is a proto-oncogene that promotes tumorigenesis and metastasis in numerous cell types and is overexpressed in a variety of human tumors. We have demonstrated that PTTG1 expression was up-regulated in both human prostate cancer specimens and prostate cancer cell lines. For a more direct assessment of the function of PTTG1 in prostate tumorigenesis, RNAi-mediated knockdown was used to selectively decrease PTTG1 expression in PC3 human prostate tumor cells. After three weeks of selection, colonies stably transfected with PTTG1-targeted RNAi (the knockdown PC3 cell line) or empty vector (the control PC3 cell line) were selected and expanded to investigate the role of PTTG1 expression in PC3 cell growth and invasion. Cell proliferation rate was significantly slower (28%) in the PTTG1 knockdown line after 6 days of growth as indicated by an MTT cell viability assay (P < 0.05). Similarly, a soft agar colony formation assay revealed significantly fewer (66.7%) PTTG1 knockdown PC3 cell colonies than control colonies after three weeks of growth. In addition, PTTG1 knockdown resulted in cell cycle arrest at G1 as indicated by fluorescence-activated cell sorting. The PTTG1 knockdown PC3 cell line also exhibited significantly reduced migration through Matrigel in a transwell assay of invasive potential, and down-regulation of PTTG1 could lead to increased sensitivity of these prostate cancer cells to a commonly used anticancer drug, taxol. Thus, PTTG1 expression is crucial for PC3 cell proliferation and invasion, and could be a promising new target for prostate cancer therapy.

Genetic analysis of the ELOVL6 gene polymorphism associated with type 2 diabetes mellitus

Recent animal studies have indicated that overexpression of the elongation of long-chain fatty acids family member 6 (Elovl6) gene can cause insulin resistance and β-cell dysfunction. These are the major factors involved in the development of type 2 diabetes mellitus (T2DM). To identify the relationship between single nucleotide polymorphisms (SNP) ofELOVL6 and T2DM pathogenesis, we conducted a case-control study of 610 Han Chinese individuals (328 newly diagnosed T2DM and 282 healthy subjects). Insulin resistance and islet first-phase secretion function were evaluated by assessment of insulin resistance in a homeostasis model (HOMA-IR) and an arginine stimulation test. Three SNPs of the ELOVL6 gene were genotyped with polymerase chain reaction-restriction fragment length polymorphism, with DNA sequencing used to confirm the results. Only genotypes TT and CT of the ELOVL6 SNP rs12504538 were detected in the samples. Genotype CC was not observed. The T2DM group had a higher frequency of the C allele and the CT genotype than the control group. Subjects with the CT genotype had higher HOMA-IR values than those with the TT genotype. In addition, no statistical significance was observed between the genotype and allele frequencies of the control and T2DM groups for SNPs rs17041272 and rs6824447. The study indicated that the ELOVL6 gene polymorphism rs12504538 is associated with an increased risk of T2DM, because it causes an increase in insulin resistance.

Overexpression of hsa-miR-125b during osteoblastic differentiation does not influence levels of Runx2, osteopontin, and ALPL gene expression

Multipotent mesenchymal stromal cells (MSCs) were first isolated from bone marrow and then from various adult tissues including placenta, cord blood, deciduous teeth, and amniotic fluid. MSCs are defined or characterized by their ability to adhere to plastic, to express specific surface antigens, and to differentiate into osteogenic, chondrogenic, adipogenic, and myogenic lineages. Although the molecular mechanisms that control MSC proliferation and differentiation are not well understood, the involvement of microRNAs has been reported. In the present study, we investigated the role of miR-125b during osteoblastic differentiation in humans. We found that miR-125b increased during osteoblastic differentiation, as well as Runx2 and ALPL genes. To study whether the gain or loss of miR-125b function influenced osteoblastic differentiation, we transfected MSCs with pre-miR-125b or anti-miR-125b and cultured the transfected cells in an osteoblastic differentiation medium. After transfection, no change was observed in osteoblastic differentiation, and Runx2, OPN, and ALPL gene expression were not changed. These results suggest that the gain or loss of miR-125b function does not influence levels of Runx2, OPN, and ALPL during osteoblastic differentiation.

Filaggrin silencing by shRNA directly impairs the skin barrier function of normal human epidermal keratinocytes and then induces an immune response

The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.

Significance of DNA base excision repair in the maintenance of mitochondrial function in Saccharomyces cerevisiae /

Mitochondria have an important role in cell metabolism, being the major site of ATP production via oxidative phosphorylation (OXPHOS). Accumulation of mtDNA mutations have been linked to the development of respiratory dysfunction, apoptosis, and aging. Base excision repair (BER) is the major and the only certain repair pathway existing in mitochondria that is in responsible for removing and repairing various base modifications as well as abasic sites (AP sites). In this research, Saccharomyces cerevisiae (S. cerevisiae) BER gene knockout strains, including 3 single DNA glycosylase gene knockout strains and Ap endonuclease (Apn 1 p) knockout strain were used to examine the importance of this DNA repair pathway to the maintenance of respiratory function. Here, I show that individual DNA glycosylases are nonessential in maintenance of normal function in yeast mitochondria, corroborating with previous research in mammalian experimental models. The yeast strain lacking Apn 1 p activity exhibits respiratory deficits, including inefficient and significantly low intracellular ATP level, which maybe due to partial uncoupling of OXPHOS. Growth of this yeast strain on respiratory medium is inhibited, but no evidence was found for increased ROS level in Apn 1 p mitochondria. This strain also shows an increased cell size, and this observation combined with an uncoupled OXPHOS may indicate a premature aging in the Apnlp knockout strain, but more evidence is needed to support this hypothesis. However, the BER is necessary for maintenance of mitochondrial function in respiring S.cerevisiae.

Primary structure and expression studies of the dihydrofolate reductase gene (DFRI) of Saccharomyces cerevisiae

The nucleotide sequence of a genomic DNA fragment thought previously to contain the dihydrofolate reductase gene (DFR1) of Saccharomyces cerevisiae by genetic criteria was determined. This DNA fragment of 1784' basepairs contains a large open reading frame from position 800 to 1432, which encodes a enzyme with a predicted molecular weight of 24,229.8 Daltons. Analysis of the amino acid sequence of this protein revealed that the yeast polypep·tide contained 211 amino acids, compared to the 186 residues commonly found in the polypeptides of other eukaryotes. The difference in size of the gene product can be attributed mainly to an insert in the yeast gene. Within this region, several consensus sequences required for processing of yeast nuclear and class II mitochondrial introns were identified, but appear not sufficient for the RNA splicing. The primary structure of the yeast DHFR protein has considerable sequence homology with analogous polypeptides from other organisms, especially in the consensus residues involved in cofactor and/or inhibitor binding. Analysis of the nucleotide sequence also revealed the presence of a number of canonical sequences identified in yeast as having some function in the regulation of gene expression. These include UAS elements (TGACTC) required for tIle amino acid general control response, and "TATA H boxes as well as several consensus sequences thought to be required for transcriptional termination and polyadenylation. Analysis of the codon usage of the yeast DFRl coding region revealed a codon bias index of 0.0083. this valve very close to zero suggestes 3 that the gene is expressed at a relatively low level under normal physiological conditions. The information concerning the organization of the DFRl were used to construct a variety of fusions of its 5' regulatory region with the coding region of the lacZ gene of E. coli. Some of such fused genes encoded a fusion product that expressed in E.coli and/or in yeast under the control of the 5' regulatory elements of the DFR1. Further studies with these fusion constructions revealed that the beta-galactosidase activity encoded on multicopy plasmids was stimulated transiently by prior exposure of yeast host cells to UV light. This suggests that the yeast PFRl gene is indu.ced by UV light and nlay in1ply a novel function of DHFR protein in the cellular responses to DNA damage. Another novel f~ature of yeast DHFR was revealed during preliminary studies of a diploid strain containing a heterozygous DFRl null allele. The strain was constructed by insertion of a URA3 gene within the coding region of DFR1. Sporulation of this diploid revealed that meiotic products segregated 2:0 for uracil prototrophy when spore clones were germinated on medium supplemented with 5-formyltetrahydrofolate (folinic acid). This finding suggests that, in addition to its catalytic activity, the DFRl gene product nlay play some role in the anabolisln of folinic acid. Alternatively, this result may indicate that Ura+ haploid segregants were inviable and suggest that the enzyme has an essential cellular function in this species.

Transfection of newt blastema mesenchyme using the techniques of lipofection and direct gene transfer

The regenerating amphibian limb provides a useful system for studying genes involved in the establishment of positional information. While a number of candidate genes that may playa role in pattern formation have been identified, their function in vivo is unknown in this system. To better ascertain the role of these genes, it would be useful to be able to alter their normal patterns of expression in vivo and to assess the effects of this misexpression on limb pattern. In order to achieve this, a method of introducing a plasmid containing the eDNA of a gene of interest into a newt blastema (a growth zone of mesenchymal progenitor cells) is needed. Unfortunately, most commonly used transfection techniques cannot be used with newt blastema cells. In this study, I have used the techniques of lipofection and direct gene transfer to introduce plasmid DNA containing reporter genes into the cells of a regenerating newt limb. The technique of lipofection was most effective when the blastema cells were transfected in vitro. The optimal ratio for transfection was shown to be 1:3 DNA:Lipofectin (W/w) , and an increase in the amount of DNA present in the mixture (1:3 ratio maintained) resulted in a corresponding increase in gene expression. The technique of direct gene transfer was used to transfect newt blastema cells with and without prior complex formation with Lipofectin. Injection of plasmid DNA alone provided the most 3 promising results. It was possible to introduce plasmid DNA containing the reporter gene ~-galactosidase and achieve significant gene expression in cells associated with the injection site. In the future, it would be interesting to use this technique to inject plasmid DNA containing a gene which may have a role in pattern formation into specific areas of the newt blastema and to analyze the resulting limb pattern that emerges.