985 resultados para trinucleotide repeat expansions


Relevância:

80.00% 80.00%

Publicador:

Resumo:

Huntington's disease is an incurable neurodegenerative disease caused by inheritance of an expanded cytosine-adenine-guanine (CAG) trinucleotide repeat within the Huntingtin gene. Extensive volume loss and altered diffusion metrics in the basal ganglia, cortex and white matter are seen when patients with Huntington's disease (HD) undergo structural imaging, suggesting that changes in basal ganglia-cortical structural connectivity occur. The aims of this study were to characterise altered patterns of basal ganglia-cortical structural connectivity with high anatomical precision in premanifest and early manifest HD, and to identify associations between structural connectivity and genetic or clinical markers of HD. 3-Tesla diffusion tensor magnetic resonance images were acquired from 14 early manifest HD subjects, 17 premanifest HD subjects and 18 controls. Voxel-based analyses of probabilistic tractography were used to quantify basal ganglia-cortical structural connections. Canonical variate analysis was used to demonstrate disease-associated patterns of altered connectivity and to test for associations between connectivity and genetic and clinical markers of HD; this is the first study in which such analyses have been used. Widespread changes were seen in basal ganglia-cortical structural connectivity in early manifest HD subjects; this has relevance for development of therapies targeting the striatum. Premanifest HD subjects had a pattern of connectivity more similar to that of controls, suggesting progressive change in connections over time. Associations between structural connectivity patterns and motor and cognitive markers of disease severity were present in early manifest subjects. Our data suggest the clinical phenotype in manifest HD may be at least partly a result of altered connectivity. Hum Brain Mapp 36:1728-1740, 2015. © 2015 Wiley Periodicals, Inc.

Relevância:

80.00% 80.00%

Publicador:

Resumo:

Myotonic dystrophy 1 (DM1) is caused by a CTG expansion in the 3′-unstranslated region of the DMPK gene, which encodes a serine/threonine protein kinase. One of the common clinical features of DM1 patients is insulin resistance, which has been associated with a pathogenic effect of the repeat expansions. Here we show that DMPK itself is a positive modulator of insulin action. DMPK-deficient (dmpk−/−) mice exhibit impaired insulin signaling in muscle tissues but not in adipocytes and liver, tissues in which DMPK is not expressed. Dmpk−/− mice display metabolic derangements such as abnormal glucose tolerance, reduced glucose uptake and impaired insulin-dependent GLUT4 trafficking in muscle. Using DMPK mutants, we show that DMPK is required for a correct intracellular trafficking of insulin and IGF-1 receptors, providing a mechanism to explain the molecular and metabolic phenotype of dmpk−/− mice. Taken together, these findings indicate that reduced DMPK expression may directly influence the onset of insulin-resistance in DM1 patients and point to dmpk as a new candidate gene for susceptibility to type 2-diabetes.

Relevância:

80.00% 80.00%

Publicador:

Resumo:

Myotonic dystrophy 1 (DM1) is caused by a CTG expansion in the 3′-unstranslated region of the DMPK gene, which encodes a serine/threonine protein kinase. One of the common clinical features of DM1 patients is insulin resistance, which has been associated with a pathogenic effect of the repeat expansions. Here we show that DMPK itself is a positive modulator of insulin action. DMPK-deficient (dmpk−/−) mice exhibit impaired insulin signaling in muscle tissues but not in adipocytes and liver, tissues in which DMPK is not expressed. Dmpk−/− mice display metabolic derangements such as abnormal glucose tolerance, reduced glucose uptake and impaired insulin-dependent GLUT4 trafficking in muscle. Using DMPK mutants, we show that DMPK is required for a correct intracellular trafficking of insulin and IGF-1 receptors, providing a mechanism to explain the molecular and metabolic phenotype of dmpk−/− mice. Taken together, these findings indicate that reduced DMPK expression may directly influence the onset of insulin-resistance in DM1 patients and point to dmpk as a new candidate gene for susceptibility to type 2-diabetes.

Relevância:

80.00% 80.00%

Publicador:

Resumo:

Le syndrome du X fragile (SXF) est la première cause héréditaire de déficience intellectuelle et également la première cause monogénique d’autisme. Le SXF est causé par l'expansion de la répétition du nucléotide CGG sur le gène FMR1, ce qui empêche l’expression de la protéine FMRP. L’absence du FMRP mène à une altération du développement structurel et fonctionnel de la synapse, ce qui empêche la maturation des synapses induite par l’activité et l’élagage synaptique, qui sont essentiels pour le développement cérébral et cognitif. Nous avons investigué les potentiels reliés aux événements (PRE) évoqués par des stimulations fondamentales auditives et visuelles dans douze adolescents et jeunes adultes (10-22) atteints du SXF, ainsi que des participants contrôles appariés en âge chronologique et développemental. Les résultats indiquent un profil des PRE altéré, notamment l’augmentation de l’amplitude de N1 auditive, par rapport aux deux groupes contrôle, ainsi que l’augmentation des amplitudes de P2 et N2 auditifs et de la latence de N2 auditif. Chez les patients SXF, le traitement sensoriel semble être davantage perturbé qu’immature. En outre, la modalité auditive semble être plus perturbée que la modalité visuelle. En combinaison avec des résultats anatomique du cerveau, des mécanismes biochimiques et du comportement, nos résultats suggèrent une hyperexcitabilité du système nerveux dans le SXF.

Relevância:

80.00% 80.00%

Publicador:

Resumo:

Background: The leaf-cutter ant Atta laevigata (Formicidae: Attini) is an agricultural pest largely distributed in the Neotropics and a model organism for studies of evolution, speciation and population genetics. Microsatellites are a very powerful tool for these kind of studies, but such markers are not available for studies on A. laevigata. In the present report, we describe the isolation and characterization of nine microsatellite loci in A. laevigata and the testing of these markers across other species of leaf-cutter ants. Findings. Nine microsatellite loci, consisting of six dinucloeotide, one trinucleotide, one tetranucleotide, and one di/trinucleotide repeat motifs, were isolated and characterized. Primers and protocols were successfully designed to selectively amplify these markers. To test effectiveness of these markers for detailed population genetic studies, we genotyped female workers collected from 36 monogynic nests of A. laevigata and found that eight loci were within Hardy-Weinberg expectations, while the remaining locus had a deficiency of heterozygotes. Micro-Checker analysis of individuals from 55 monogynic nests indicated that loci Alae11, Alae24, Alae18 showed signs of null alleles. For the remaining six loci, the number of alleles per locus ranged between 2 and 11, with expected heterozygosity ranging between 0.07 and 0.88. All of these loci cross-amplified in other species of Atta. Conclusions: These six polymorphic microsatellite loci should prove useful for future genetic investigations of the pest species Atta laevigata, as well as studies of other species of leaf-cutter ants in the genus Atta. © 2013 Kakazu et al.; licensee BioMed Central Ltd.

Relevância:

80.00% 80.00%

Publicador:

Resumo:

Prostate cancer (PC) is a significant economic and health burden in the U.S. and Europe but its causes are largely unknown. The most significant risk factors (after gender) are age and family history of the disease. A gene with high penetrance but low frequency on chromosome 1q, HPC 1, has been suggested to cause a proportion of the familial aggregation of PC but other more common genes, conferring less risk, are also thought to contribute to disease predisposition. We have pursued a strategy to study both types of genetic risk in PC. To identify high penetrance genes, affected men from thirteen families have been genotyped for genetic linkage analysis at six microsatellite markers spanning 45 cM of 1q24-25. Both LOD score and non-parametric statistics provide no significant support for HPC1 in this genomic region, although 3 of the families did combine to produce a LOD score of 0.9. These families will be included in a genome wide search for other PC predisposition genes as part of a multinational collaboration.^ For study of common genetic factors in PC development, leukocyte DNA samples from an unselected series of 55 patients and 67 controls have been examined for genetic differences in two other candidate genes, the androgen receptor gene, hAR, at Xq11-12, and the vitamin D receptor gene, hVDR, at 12q12-14. hAR was typed for two trinucleotide repeat length polymorphisms, (CAG)$\rm\sb{n}$ and (GGC)$\rm\sb{n},$ encoding polyglutamine and polyglycine tracts, respectively, which have been implicated in PC susceptibility. These data, combined with similarly processed patients and controls from the U.K. show no consistent association of allele length with PC risk. A novel finding, however, has been a significant association between the number of GGC repeats and the length of time between diagnosis and relapse in stage T1-T4 Caucasian patients irrespective of therapy and age of the patient. Of 49 patients who relapsed out of 108 entering the study, those with 16 or fewer GGC repeats had an average relapse-free-period of 101 (+/$-$7.7) months while for those with more than 16 repeats the period averaged 48 (+/$-$2.9) months, a difference of 2.1 fold or 4.4 years.^ The second gene, hVDR, was genotyped at two polymorphisms, a synonymous C/T substitution in exon 9 identified by differential TaqI enzymatic digestion and a variable length polyA tract in the 3$\sp\prime$ UTR. Although these polymorphisms are in strong linkage disequilibrium only the polyA region showed a possible association with PC risk. Men homozygous for alleles with fewer than 18 A's had an increased risk (OR = 3.0, p = 0.0578) compared to controls. This result is opposite to the findings of others and may either indicate off-setting random errors which together balance out to no significant overall effect or reflect more complex genetic and/or environmental associations.^ Overall, this research suggests that single gene familial predisposition may be less prominent in PC than in other cancers and that the characteristics of PC pathology may be useful in identifying the effects of common genetic factors. ^

Relevância:

80.00% 80.00%

Publicador:

Resumo:

Hexanucleotide repeat expansions in the C9ORF72 gene are causally associated with frontotemporal lobar dementia (FTLD) and/or amyotrophic lateral sclerosis (ALS). The physiological function of the normal C9ORF72 protein remains unclear. In this study, we characterized the subcellular localization of C9ORF72 to processing bodies (P-bodies) and its recruitment to stress granules (SGs) upon stress-related stimuli. Gain of function and loss of function experiments revealed that the long isoform of C9ORF72 protein regulates SG assembly. CRISPR/Cas9-mediated knockdown of C9ORF72 completely abolished SG formation, negatively impacted the expression of SG-associated proteins such as TIA-1 and HuR, and accelerated cell death. Loss of C9ORF72 expression further compromised cellular recovery responses after the removal of stress. Additionally, mimicking the pathogenic condition via the expression of hexanucleotide expansion upstream of C9ORF72 impaired the expression of the C9ORF72 protein, caused an abnormal accumulation of RNA foci, and led to the spontaneous formation of SGs. Our study identifies a novel function for normal C9ORF72 in SG assembly and sheds light into how the mutant expansions might impair SG formation and cellular-stress-related adaptive responses.

Relevância:

80.00% 80.00%

Publicador:

Resumo:

Myotonic dystrophy (DM) is caused by the expansion of a trinucleotide repeat, CTG, in the 3′ untranslated region of a protein kinase gene, DMPK. We set out to determine what effect this expanded repeat has on RNA processing. The subcellular fractionation of RNA and the separate analysis of DMPK transcripts from each allele reveals that transcripts from expanded DMPK alleles are retained within the nucleus and are absent from the cytoplasm of DM cell lines. The nuclear retention of DMPK transcripts occurs above a critical threshold between 80 and 400 CTGs. Further analysis of the nuclear RNA reveals an apparent reduction in the proportion of expansion-derived DMPK transcripts after poly(A)+ selection. Quantitative analysis of RNA also indicates that although the level of cytoplasmic DMPK transcript is altered in DM patients, the levels of transcripts from 59 and DMAHP, two genes that immediately flank DMPK, are unaffected in DM cell lines.

Relevância:

80.00% 80.00%

Publicador:

Resumo:

The Huntington disease (HD) phenotype is associated with expansion of a trinucleotide repeat in the IT15 gene, which is predicted to encode a 348-kDa protein named huntington. We used polyclonal and monoclonal anti-fusion protein antibodies to identify native huntingtin in rat, monkey, and human. Western blots revealed a protein with the expected molecular weight which is present in the soluble fraction of rat and monkey brain tissues and lymphoblastoid cells from control cases. In lymphoblastoid cell lines from juvenile-onset heterozygote HD cases, both normal and mutant huntingtin are expressed, and increasing repeat expansion leads to lower levels of the mutant protein. Immunocytochemistry indicates that huntingtin is located in neurons throughout the brain, with the highest levels evident in larger neurons. In the human striatum, huntingtin is enriched in a patch-like distribution, potentially corresponding to the first areas affected in HD. Subcellular localization of huntingtin is consistent with a cytosolic protein primarily found in somatodendritic regions. Huntingtin appears to particularly associate with microtubules, although some is also associated with synaptic vesicles. On the basis of the localization of huntingtin in association with microtubules, we speculate that the mutation impairs the cytoskeletal anchoring or transport of mitochondria, vesicles, or other organelles or molecules.

Relevância:

80.00% 80.00%

Publicador:

Resumo:

Huntington's disease (HD) is a neurodegenerative disorder caused by an expanded CAG trinucleotide repeat encoding an extended polyglutamine tract in the huntingtin protein. Affected individuals display progressive motor, cognitive and psychiatric symptoms (including depression), leading to terminal decline. Given that transgenic HD mice have decreased hippocampal cell proliferation and that a deficit in neurogenesis has been postulated as an underlying cause of depression, we hypothesized that decreased hippocampal neurogenesis contributes to depressive symptoms and cognitive decline in HD. Fluoxetine, a serotonin-reuptake inhibitor commonly prescribed for the treatment of depression, is known to increase neurogenesis in the dentate gyrus of wild-type mouse hippocampus. Here we show that hippocampal-dependent cognitive and depressive-like behavioural symptoms occur in HD mice, and that the administration of fluoxetine produces a marked improvement in these deficits. Furthermore, fluoxetine was found to rescue deficits of neurogenesis and volume loss in the dentate gyrus of HD mice.

Relevância:

80.00% 80.00%

Publicador:

Resumo:

Friedreich's ataxia (FRDA) is the most common autosomal recessive hereditary ataxia in Caucasians. Neurological symptoms dominate the clinical picture. The underlying neuropathology affects the dorsal root ganglia, the spinal cord, and the deep cerebellar nuclei. In addition, most cases present a hypertrophic cardiomyopathy that may cause premature death. Other problems include a high risk of diabetes, skeletal abnormalities such as kyphoscoliosis, and pes cavus. Most patients carry a homozygous expansion of GAA trinucleotide repeat within the first intron of the FXN gene, leading to repressed transcription through epigenetic mechanisms. The encoded protein, frataxin, is localized in mitochondria and participates in the biogenesis of iron-sulfur clusters. Frataxin deficiency leads to mitochondrial dysfunction, altered iron metabolism, and oxidative damage. Thanks to progress in understanding pathogenesis and to the development of animal and cellular models, therapies targeted to correct frataxin deficiency or its downstream consequences are being developed and tested in clinical trials.

Relevância:

50.00% 50.00%

Publicador:

Resumo:

A quantitative and selective genetic assay was developed to monitor expansions of trinucleotide repeats (TNRs) in yeast. A promoter containing 25 repeats allows expression of a URA3 reporter gene and yields sensitivity to the drug 5-fluoroorotic acid. Expansion of the TNR to 30 or more repeats turns off URA3 and provides drug resistance. When integrated at either of two chromosomal loci, expansion rates were 1 × 10−5 to 4 × 10−5 per generation if CTG repeats were replicated on the lagging daughter strand. PCR analysis indicated that 5–28 additional repeats were present in 95% of the expanded alleles. No significant changes in CTG expansion rates occurred in strains deficient in the mismatch repair gene MSH2 or the recombination gene RAD52. The frequent nature of CTG expansions suggests that the threshold number for this repeat is below 25 in this system. In contrast, expansions of the complementary repeat CAG occurred at 500- to 1,000-fold lower rates, similar to a randomized (C,A,G) control sequence. When the reporter plasmid was inverted within the chromosome, switching the leading and lagging strands of replication, frequent expansions were observed only when CTG repeats resided on the lagging daughter strand. Among the rare CAG expansions, the largest gain in tract size was 38 repeats. The control repeats CTA and TAG showed no detectable rate of expansions. The orientation-dependence and sequence-specificity data support the model that expansions of CTG and CAG tracts result from aberrant DNA replication via hairpin-containing Okazaki fragments.

Relevância:

40.00% 40.00%

Publicador:

Resumo:

Evidence for an RNA gain-of-function toxicity has now been provided for an increasing number of human pathologies. Myotonic dystrophies (DM) belong to a class of RNA-dominant diseases that result from RNA repeat expansion toxicity. Specifically, DM of type 1 (DM1), is caused by an expansion of CUG repeats in the 3'UTR of the DMPK protein kinase mRNA, while DM of type 2 (DM2) is linked to an expansion of CCUG repeats in an intron of the ZNF9 transcript (ZNF9 encodes a zinc finger protein). In both pathologies the mutant RNA forms nuclear foci. The mechanisms that underlie the RNA pathogenicity seem to be rather complex and not yet completely understood. Here, we describe Drosophila models that might help unravelling the molecular mechanisms of DM1-associated CUG expansion toxicity. We generated transgenic flies that express inducible repeats of different type (CUG or CAG) and length (16, 240, 480 repeats) and then analyzed transgene localization, RNA expression and toxicity as assessed by induced lethality and eye neurodegeneration. The only line that expressed a toxic RNA has a (CTG)(240) insertion. Moreover our analysis shows that its level of expression cannot account for its toxicity. In this line, (CTG)(240.4), the expansion inserted in the first intron of CG9650, a zinc finger protein encoding gene. Interestingly, CG9650 and (CUG)(240.4) expansion RNAs were found in the same nuclear foci. In conclusion, we suggest that the insertion context is the primary determinant for expansion toxicity in Drosophila models. This finding should contribute to the still open debate on the role of the expansions per se in Drosophila and in human pathogenesis of RNA-dominant diseases.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

A common mechanism for chromosomal fragile site genesis is not yet apparent. Folate-sensitive fragile sites are expanded p(CCG)n repeats that arise from longer normal alleles. Distamycin A or bromodeoxyuridine-inducible fragile site FRA16B is an expanded AT-rich similar to 33 bp repeat; however, the relationship between normal and fragile site alleles is not known. Here, we report that bromodeoxyuridine-inducible, distamycin A-insensitive fragile site FRA10B is composed of expanded similar to 42 bp repeats. Differences in repeat motif length or composition between different FRA10B families indicate multiple independent expansion events. Some FRA10B alleles comprise a mixture of different expanded repeat motifs. FRA10B fragile site and long normal alleles share flanking polymorphisms. Somatic and intergenerational FRA10B repeat instability analogous to that found in expanded trinucleotide repeats supports dynamic mutation as a common mechanism for repeat expansion.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Fragile sites are nonstaining gaps in chromosomes induced by specific tissue culture conditions. They vary both in population frequency and in the culture conditions required for induction. Folate-sensitive fragile sites are due to expansion of p(CCG)(n) trinucleotide repeats; however, the relationship between sequence composition and the chemistry of induction of fragile sites is unclear. To clarify this relationship, the distamycin A-sensitive fragile site FRA16B was isolated by positional cloning and found to be an expanded 33 bp AT-rich minisatellite repeat, p(ATATATTATATATTATATCTAATAATATAT(C)/(A)TA)(n) (consistent with DNA sequence binding preferences of chemicals that induce its cytogenetic expression). Therefore the mutation mechanism associated with trinucleotide repeats is also a property of minisatellite repeats (variable number tandem repeats).