Extra-pair paternity and mate-guarding behaviour in the brown thornbill

We used multilocus DNA fingerprinting to assess parentage in the brown thornbill, Acanthiza pusilla, a socially monogamous Australian passerine. Extra-pair paternity was uncommon (6.2% of 178 offspring; 11.9% of 67 broods) and there was no evidence of intra-specific brood parasitism. Extra-pair paternity was limited because pairs spent more time together when females were fertile and males were able to evict intruding males before they could approach the female. Males were responsible for the close proximity of partners during the fertile period. Mate guarding therefore appears to be a male tactic aimed at preventing female infidelity rather than a cooperative behaviour of the pair aimed at preventing extra-pair copulations and/or female harassment. Females did not attempt to escape male guarding and were rarely observed to solicit copulations from intruding males. Nevertheless, females paired to smaller and younger males were more likely to cuckold their mates than females paired to larger and older males. This suggests that females may be more likely to seek or accept extra-pair matings when paired to small, young males or that old, large males are better at preventing their mates from engaging in extra-pair copulations. We found that male age but not male size influences mate-guarding behaviour. Older males tended to respond more aggressively to intruders. We therefore speculate that the relationship between male size/age and extra-pair paternity in brown thornbills may arise because female thornbills prefer large males as mates but are unable to express this preference as easily when paired to older males.

Social evolution in the sweat bee Halictus scabiosae

The evolution of eusociality is one of the major evolutionary transitions of life on earth. For investigating the conditions and processes that are central to the origin of such integrated social organization, it is best to study organisms in which individuals have retained some flexibility in their reproductive strategies. Halictid bees are especially well suited as model organisms, because they show huge variation in social systems, both within and between species. In this thesis, I investigated female reproductive strategies in the primitively eusocial bee Halictus scabiosae, with a focus on the role of helpers, in order to get insight into the mechanisms governing the evolution and maintenance of eusociality. This species produces two broods per year. The females from the first brood can stay in the natal nest to help raise a second brood of males and gynes that become the next-generation foundresses in spring. We first compared the morphology of females from the two broods, as well as the nutrition they receive as larvae. Then we conducted a helper- removal experiment in the field to quantify the effects of the presence of helpers on colony survival and productivity. Finally, we reconstructed pedigree relationships of individuals using microsatellite markers in order to detect who reproduces in the nest and how much individuals drift between nests. We found that first brood females had a uniformly small size and low fat reserves, which may be caused by the restricted pollen and nectar provisions on which they develop. Colony survival and productivity was increased by the presence of a single helper, but the effect was small and mostly limited to small colonies. By inferring parentage within and across colonies, we could determine that females from the first brood rarely reproduce in their natal nests. However, foundresses are frequently replaced, and foundresses and females from the first brood occasionally move to and reproduce in foreign colonies. As a result, colonies often contain offspring from unrelated individuals, and the relatedness of females to the brood they rear is low. Overall, this thesis shows that the reproductive system of H. scabiosae is highly flexible. The production of helpers in the first brood is important for colony success and productivity, but there is a high colony failure rate and part of the first brood females drift and reproduce in foreign nests. Both foundresses and helpers appear to be constrained by harsh environmental conditions or social factors limiting reproduction and independent colony founding. - L'origine des insectes sociaux est un domaine fascinant pour la recherche. Pour comprendre les mécanismes et les conditions qui sont nécessaires pour l'évolution et le maintien de la vie en société, il est judicieux d'étudier des sociétés primitives d'insectes, où toutes les femelles ont conservé la capacité de se reproduire, même si leur rôle comportemental dans la colonie est d'aider sans se reproduire. Une des familles d'abeilles, les halictes, est idéale pour cette sorte de recherche, en raison de la grande variabilité dans leur comportement social. Dans cette thèse, j'ai étudié les stratégies reproductives des femelles de Halictus scabiosae pour mieux comprendre les mécanismes qui influencent l'évolution de la vie en société. Cette espèce produit deux cohortes de couvain par année. Les femelles du premier couvain restent souvent dans leur nid natal pour aider à élever le deuxième couvain, tandis que les femelles du deuxième couvain s'accouplent et hibernent pour devenir les nouvelles fondatrices au printemps suivant. Nous avons d'abord comparé la morphologie des femelles issues des deux couvains ainsi que leur nutrition au stade de larve. Puis, dans une expérience sur le terrain, nous avons quantifié l'apport d'une ouvrière pour la survie et la productivité de la colonie. Finalement, nous avons reconstruit des pedigrees en utilisant des marqueurs génétiques, pour savoir qui se reproduit dans la colonie et combien d'individus migrent entre colonies. Les résultats montrent que les femelles du premier couvain sont uniformément plus petites et plus maigres, ce qui indique que les fondatrices réduisent les provisions de nourriture pour leur premier couvain afin de les inciter à aider dans le nid au lieu de se reproduire indépendamment. Dans l'expérience sur le terrain, la survie et la productivité de la colonie augmentaient avec la présence d'une ouvrière additionnelle, mais l'effet était petit et limité aux petites colonies. Par la reconstruction de pedigrees, nous pouvions constater que les femelles du premier couvain pondent rarement dans leurs nids natals. Les fondatrices cependant sont souvent remplacées en cours de saison, et migrent fréquemment entre nids, tandis que les femelles du premier couvain pondent parfois des oeufs dans des nids étrangers. De ce fait, les colonies contiennent souvent des descendants d'individus étrangers, et la parenté génétique entre les femelles et le deuxième couvain est basse. Cette thèse démontre que le système reproductif de H. scabiosae est très flexible. La production d'ouvrières est importante pour la survie de la colonie et sa productivité, mais le taux d'échec est élevé et une partie des femelles du premier couvain migrent et pondent dans une colonie étrangère. Autant les fondatrices que les ouvrières semblent être contraintes par des conditions environnementales ou sociales qui limitent la reproduction et les nouvelles fondations de colonie. - Die Entstehung von sozialen Lebensformen ist eines der wichtigsten Entwicklungen in der Geschichte des Lebens. Um die Bedingungen oder Prozesse zu verstehen, welche bei der Entstehung und dem Erhalt von sozialen Merkmalen wichtig sind, sollte man Lebewesen untersuchen, welche je nach Umwelteinflüßen ihr soziales Verhalten flexibel ändern können. Furchenbienen (Halictidae) gehören dazu. Diese weisen nämlich ein breites Spektrum verschiedener sozialer Organisationsformen auf, oftmals sogar innerhalb der einzelnen Arten. In meiner Doktorarbeit befasste ich mich mit den Fortpflanzungsstrategien der Weibchen der Skabiosen-Furchenbiene Halictus scabiosae. Diese Art produziert zwei Brüten pro Jahr. Die Weibchen der ersten Brut bleiben dabei meist als Arbeiterinnen in ihrem Geburtsnest, wohingegen die Weibchen der zweiten Brut nach der Paarung überwintern, um im nächsten Frühling neue Kolonien zu gründen. In einem ersten Schritt verglichen wir die beiden Brüten bezüglich der Grösse und der Fettreserven der Weibchen sowie der Pollen-Nektar-Vorräte für die Larven. Dann bestimmten wir in einem Feldexperiment, wieviel eine zusätzliche Arbeiterin zum Überleben und zur Produktiviät der Kolonie beiträgt. Schliesslich ermittelten wir durch genetische Tests die Verwandtschaftsbeziehungen zwischen den Bienen, um herauszufinden, wer in den Kolonien tatsächlich die Eier legt und ob und wieviel die Bienen zwischen verschiedenen Nestern wandern. Wir stellten fest, dass die Weibchen von der ersten Brut einheitlich kleiner sind und weniger Fettreserven besitzen. Das weist daraufhin, dass die Nestgründerin die erste Brut unterernährt, um die Wahrscheinlichkeit zu erhöhen, dass diese Weibchen als Arbeiterinnen im Nest bleiben anstatt sich unabhängig fortzupflanzen. Schon eine einzelne zusätzliche Arbeiterin verbesserte die Überlebenschancen und Produktivität der Kolonie, der Effekt war allerdings klein und auf kleine Kolonien beschränkt. Die Verwandtschaftsanalysen zeigten, dass die Arbeiterinnen nur sehr selten ein Ei in ihr Geburtsnest legen. Erstaunlicherweise wanderten die Nestgründerinnen oft zwischen verschiedenen Nestern. Einige Weibchen der ersten Brut wanderten auch in ein fremdes Nest und produzierten dort Nachkommen. Diese Doktorarbeit zeigt, dass die Fortpflanzungsstrategien der Skabiosen-Furchenbiene tatsächlich sehr flexibel sind. Die Anwesenheit von Arbeiterinnen ist wichtig für das Überleben und die Produktivität der Kolonie. Die Misserfolgsraten bleiben jedoch hoch, und ein Teil der Weibchen der ersten Brut pflanzt sich in fremden Nestern fort. Sowohl die Nestgründerinnen als auch die Weibchen der ersten Brut scheinen durch Umweltsbedingungen oder durch soziale Faktoren in der Wahl ihrer Fortpflanzungs¬strategie eingeschränkt zu sein.

Sex-specific selective pressures on body mass in the greater white-toothed shrew, Crocidura russula.

The direction, intensity and shape of viability-, sexual- and fecundity selection on body mass were investigated in a natural population of the greater white-toothed shrew (Crocidura russula), combining parentage assignment through molecular techniques and mark-recapture data over several generations. A highly significant stabilizing viability selection was found in both sexes, presumably stemming from the constraints imposed by their insectivorous habits and high metabolic costs. Sexual selection, directional in both sexes, was twice as large in males than in females. Our results suggest that body mass matters in this context by facilitating the acquisition and defense of a breeding territory. No fecundity selection could be detected. The direction of sexual size dimorphism (SSD) was in agreement with the observed pattern of selective pressures: males were heavier than females, because of stronger sexual selection. SSD intensity, however, was low compared with other mammals, because of the low level of polygyny, the active role of females in territory defense and the intensity of stabilizing viability selection.

Bidirectional shifts in colony queen number in a socially polymorphic ant population.

The breeding system of social organisms affects many important aspects of social life. Some species vary greatly in the number of breeders per group, but the mechanisms and selective pressures contributing to the maintenance of this polymorphism in social structure remain poorly understood. Here, we take advantage of a genetic dataset that spans 15 years to investigate the dynamics of colony queen number within a socially polymorphic ant species. Our study population of Formica selysi has single- and multiple-queen colonies. We found that the social structure of this species is somewhat flexible: on average, each year 3.2% of the single-queen colonies became polygynous, and conversely 1.4% of the multiple-queen colonies became monogynous. The annualized queen replacement rates were 10.3% and 11.9% for single- and multiple-queen colonies, respectively. New queens were often but not always related to previous colony members. At the population level, the social polymorphism appeared stable. There was no genetic differentiation between single- and multiple-queen colonies at eight microsatellite loci, suggesting ongoing gene flow between social forms. Overall, the regular and bidirectional changes in queen number indicate that social structure is a labile trait in F. selysi, with neither form being favored within a time-frame of 15 years.

Inbreeding in the greater white-toothed shrew, Crocidura russula.

We combined mark-and-recapture studies with genetic techniques of parentage assignment to evaluate the interactions between mating, dispersal, and inbreeding, in a free-ranging population of Crocidura russula. We found a pattern of limited and female-biased dispersal, followed by random mating within individual neighborhoods. This results in significant inbreeding at the population level: mating among relatives occurs more often than random, and F(IT) analyses reveal significant deficits in heterozygotes. However, related mating partners were not less fecund, and inbred offspring had no lower lifetime reproductive output. Power analyses show these negative results to be quite robust. Absence of phenotypic evidence of inbreeding depression might result from a history of purging: local populations are small and undergo disequilibrium gene dynamics. Dispersal is likely caused by local saturation and (re)colonization of empty breeding sites, rather than inbreeding avoidance.

L'impact de l'accès à la parentalité sur l'évolution de l'identité conjugale

Cette recherche investigue l'impact de la transition à la parentalité sur l'identité conjugale. Afin de mettre en évidence les bouleversements induits par l'arrivée du premier enfant sur le système-couple, deux groupes de sujets ont constitué notre échantillon : des couples parents d'un premier enfant âgé de 9 à 12 mois et des couples sans enfant mais avec une durée de vie commune équivalente au premier groupe. Chaque couple a été rencontré dans le cadre d'un unique entretien. Leur première tâche a été de décrire leurs vies de couple passée et actuelle au travers de valeurs et devises. Un questionnaire créé pour cette recherche a ensuite permis d'évaluer la représentation des conjoints quant à l'évolution de leur couple, et ce sur la base de cinq dimensions à même de caractériser la manière d'être ensemble des conjoints. Finalement, les jeunes parents ont participé à un entretien semi-directif afin de témoigner des changements personnels et de couple vécus dans le cadre de la transition à la parentalité. Des analyses qualitatives et quantitatives basées sur les données récoltées au travers de nos trois outils révèlent plusieurs résultats. Les conjoints sans enfant décrivent avant tout leur couple comme un cocon au sein duquel deux individus autonomes trouvent refuge et réconfort. Les jeunes parents se démarquent quant à eux par une diminution de leur sentiment d'indépendance, reflet de la nécessaire collaboration propre au co-parentage. Une analyse des entretiens semi-structurés croisée avec l'évaluation du degré de satisfaction conjugale permet le constat suivant : la diminution avérée de la satisfaction conjugale lors de la transition à la parentalité n'est pas strictement associée aux bouleversements conjugaux. Ce déclin lors de l'arrivée et de l'accueil du premier enfant semble en effet être également en lien avec une difficile articulation, chez chaque partenaire, de leurs identités personnelle, conjugale, parentale et socio-professionnelle. - This research investigates the impact of the transition to parenthood on marital identity. To highlight the changes brought about by the arrival of the first child on the couple, two groups of subjects constituted our sample: couples with a first child of 9 to 12 months and childless couples but with a period of cohabitation equivalent to that of the first group. Each couple was interviewed once only. Their first task was to describe their lives as a couple past and present through values and principles. A questionnaire devised for this research was then used to evaluate partners' responses regarding the evolution of their relationship, this based on five criteria to characterise the couples' way of being together. Finally, young parents participated in a semi- structured interview to describe personal changes and those as a couple experienced in the transition to parenthood. Qualitative and quantitative analyses based on data collected through our three tools reveal several results. Spouses without children describe their relationship primarily as a cocoon in which two autonomous individuals find refuge and comfort. Young parents differ in reducing their feelings of independence, reflecting the collaborative needs specific to co-parenting. An analysis of the semi- structured interviews crossed with the assessment of marital satisfaction gives rise to the following observation: the pronounced reduction in marital satisfaction during the transition to parenthood is not strictly associated with marital disruption. This decline upon the arrival of the first child seems to be in line with a difficult balance for each partner between their personal, marital, parental and socio- professional identities.

Dépressivité maternelle au post-partum et symptomatologie du bébé à trois mois : l'effet modérateur de l'alliance familiale et de la satisfaction conjugale

Les troubles de l'humeur sont très fréquents dans la période périnatale. Ils se manifestent sous forme d'une humeur dépressive « sub-clinique » voire sous la forme d'une dépression post-partum avérée. Cette « dépressivité » provoque des perturbations des comportements de parentage, des troubles de la relation à l'enfant et débouchent sur des difficultés émotionnelles, cognitives et comportementales de l'enfant. Plusieurs facteurs peuvent néanmoins tempérer cet enchaînement. L'étude présentée dans cet article évalue dans quelle mesure l'alliance familiale et la satisfaction conjugale modèrent le lien entre dépressivité et développement de l'enfant. Cinquante-sept familles ont participé à l'étude avec leur bébé de trois mois. La dépressivité maternelle a été évaluée par entretien et par questionnaire. L'alliance familiale a été évaluée dans le Jeu Trilogique de Lausanne. La satisfaction conjugale et les symptômes de l'enfant sont rapportés par questionnaires par la mère. Les résultats montrent que (i) le niveau de dépressivité dans notre population est conforme à celui rapporté dans la littérature, (ii) il y a un lien entre dépressivité et difficultés de l'enfant, (iii) ces liens sont effectivement modérés par la satisfaction conjugale, qui joue le rôle de facteur protecteur, et par l'alliance familiale, qui joue le rôle de facteur aggravant. Ces résultats montrent qu'il est indispensable de tenir compte du contexte relationnel dans lequel la mère évolue, afin de pouvoir comprendre sous quelles conditions des troubles de l'humeur maternels vont affecter le développement de l'enfant.

Couple conjugal et couple co-parental: quelle articulation lors de la transition à la parentalité ?

La venue d'un premier enfant implique d'importants remaniements. Le couple conjugal est mis à rude épreuve et la littérature anglo-saxonne fait état d'une baisse de la satisfaction conjugale durant la période de transition à la parentalité. De plus, au couple conjugal s'ajoutent le couple co-parental (relations entre les parents à propos de leur enfant) et les dyades parentales (parent/enfant). L'articulation entre les sous-systèmes conjugal, co-parental et parental va varier d'une famille à l'autre : prépondérance du parental ou du conjugal, présence d'un co-parentage soutenant ou non, etc. La baisse de la satisfaction conjugale lors de la transition à la parentalité est confirmée dans une étude réalisée en Suisse et présentée dans cet article. Des vignettes cliniques de jeux familiaux illustrent ensuite les différentes articulations possibles du conjugal, du co-parental et du familial. The birth of a first child implies important reorganizations. The marital relationship is under stress and Anglo-Saxon literature shows that there is a decrease of the marital satisfaction during the transition to parenthood. Moreover, when partners become parents, coparenting (relationship between the parents regarding their child) and parental dyads (parent-infant) are added to the marital relationship. The articulation between the conjugal, coparental and parental sub-systems varies from one family to the other : preponderance of the parental or the conjugal subsystem, presence of a supportive co-parenting or not, etc. The decrease of the marital satisfaction during the transition to parenthood is confirmed in a Swiss study and described in this article. Descriptions of family games illustrate then the different possible articulations of the conjugal, coparental and parental subsystems.

The Bison LL6 breccia

Bison LL6 chondrite is an impact breccia. The meteorite consists of unmolten clasts and accessory melt-breccia clasts incorporated into a host of the same parentage.

Paternity test in "Mangalarga-Marchador" equines by DNA-fingerprinting

GC-rich molecular minisatellite probes isolated from the human genome have presented a poor ability for individualization in horses. In this study new DNA sequences were isolated which could be used in paternity tests in horses. Genomic DNA from "Mangalarga-Marchador" horses was treated with restriction enzymes that preferentially digest non-repetitive sequences, so preserving the structure where mini and microsatellites are located. Four clones (S01, S05, S07 and S09) selected from a genomic library screened with a (TG)n oligonucleotide showed similar hybridization profiles generating bands of DNA-fingerprinting type. Using these probes the individualization power obtained was 10-8, which is 10(5)fold higher than that obtained with M13, another GC-rich type probe. All clones were efficient in parentage detection in crossbreedings and presented a 27 bp consensus sequence, GTTTCATTTATTATTCTTTGGAAGAAA, which was repeated 12, 18, 11 and 21 times in clones S01, S05, S07 and S09, respectively.

Establishment success and resulting fitness consequences for vole dispersers

Dispersal is one of the most important, yet least understood phenomena of evolutionary ecology. Triggers and consequences of dispersal are difficult to study in natural populations since dispersers can typically only be identified a posteriori. Therefore, a lot of work on dispersal is either of a theoretical nature or based on anecdotal observation. This is especially true for cryptic species such as small mammals. We conducted an experiment on the common vole, Microtus arvalis, in semi-natural enclosures and investigated the spatial and genetic establishment success of residents and dispersers in their natal and new populations. Our study uses genetic data on the reproductive success of 1255 individuals to measure the fitness trajectories of the residents and dispersing individuals. In agreement with past studies, we found that dispersal was highly male-biased, and was most probably induced by the agonistic encounters with conspecifics, suggesting it could act as an inbreeding avoidance mechanism. There was low breeding success of dispersers into new populations. Although nearly 26% of identified dispersers reproduced in their natal populations, only seven percent reproduced in the new populations. Settlement appeared to be a pre-requisite for reproduction in both sexes, and animals that did not spatially settle into a new population dispersed again, usually on the same day of immigration. In the event that dispersers reproduced in the new population, they did so at relatively low population densities. We also found age-related differences between the sexes in breeding success, and male dispersers that subsequently established in the new population were young individuals that had not reproduced in their natal population, whereas successful females had already reproduced in their natal population. In conclusion, with our detailed field data on establishment and substantial parentage assignments to understand breeding success, we were able to gain an insight into the fitness of dispersers, and how the two sexes optimise their fitness. Taken together, our results help to further understand the relative advantages and costs of dispersal in the common vole.

Novel FGF8 mutations associated with recessive holoprosencephaly, craniofacial defects, and hypothalamo-pituitary dysfunction.

Context: Fibroblast growth factor (FGF) 8 is important for GnRH neuronal development with human mutations resulting in Kallmann syndrome. Murine data suggest a role for Fgf8 in hypothalamo-pituitary development; however, its role in the etiology of wider hypothalamo-pituitary dysfunction in humans is unknown.Objective: The objective of this study was to screen for FGF8 mutations in patients with septo-optic dysplasia (n = 374) or holoprosencephaly (HPE)/midline clefts (n = 47).Methods: FGF8 was analyzed by PCR and direct sequencing. Ethnically matched controls were then screened for mutated alleles (n = 480-686). Localization of Fgf8/FGF8 expression was analyzed by in situ hybridization in developing murine and human embryos. Finally, Fgf8 hypomorphic mice (Fgf8(loxPNeo/-)) were analyzed for the presence of forebrain and hypothalamo-pituitary defects.Results: A homozygous p.R189H mutation was identified in a female patient of consanguineous parentage with semilobar HPE, diabetes insipidus, and TSH and ACTH insufficiency. Second, a heterozygous p.Q216E mutation was identified in a female patient with an absent corpus callosum, hypoplastic optic nerves, and Moebius syndrome. FGF8 was expressed in the ventral diencephalon and anterior commissural plate but not in Rathke's pouch, strongly suggesting early onset hypothalamic and corpus callosal defects in these patients. This was consolidated by significantly reduced vasopressin and oxytocin staining neurons in the hypothalamus of Fgf8 hypomorphic mice compared with controls along with variable hypothalamo-pituitary defects and HPE.Conclusion: We implicate FGF8 in the etiology of recessive HPE and potentially septo-optic dysplasia/Moebius syndrome for the first time to our knowledge. Furthermore, FGF8 is important for the development of the ventral diencephalon, hypothalamus, and pituitary. (J Clin Endocrinol Metab 96: E1709-E1718, 2011)

RAPD markers utilization and other parameters in the determination of mango hybrids genitors

Actually mango (Mangifera indica, L.) is considered one of the largest Brazilian fruitbusiness for the export market. Cultivar selection having high fruit quality is a fundamental step to obtain excellent results in this business. A mango breeding program based on intervarietal hybridization may produce new improved cultivars for mango growers. Mango hybrids have been obtained by controlled or open crosses. In the last one, it is important to identify the male parent because it is useful for the genetic cultivar history, thus it is important for planning further improvements. This work presents a parentage test using among others parameters RAPD (Random amplified Polymorphic DNA) markers to estimate the male parent of the selected hybrids in an open cross plot by using five mango cultivars densely planted in a latin square design.

Diversity and genetic relatedness among genotypes of Vitis spp. using microsatellite molecular markers

The purpose of this research was to study the genetic diversity and genetic relatedness of 60 genotypes of grapevines derived from the Germplasm Bank of Embrapa Semiárido, Juazeiro, BA, Brazil. Seven previously characterized microsatellite markers were used: VVS2, VVMD5, VVMD7, VVMD27, VVMD3, ssrVrZAG79 and ssrVrZAG62. The expected heterozygosity (He) and polymorphic information content (PIC) were calculated, and the cluster analysis were processed to generate a dendrogram using the algorithm UPGMA. The He ranged from 81.8% to 88.1%, with a mean of 84.8%. The loci VrZAG79 and VVMD7 were the most informative, with a PIC of 87 and 86%, respectively, while VrZAG62 was the least informative, with a PIC value of 80%. Cluster analysis by UPGMA method allowed separation of the genotypes according to their genealogy and identification of possible parentage for the cultivars 'Dominga', 'Isaura', 'CG 26916', 'CG28467' and 'Roni Redi'.

Le "métier" de parent : au-delà des compétences et des performances

Les livres et programmes sur la petite-enfance se multiplient et, de plus en plus, l’accent est mis autant par les experts que l’État sur les premières années de la vie de l’enfant. Le regard semble davantage posé sur les compétences des parents pour privilégier le développement cognitif et moteur de leur progéniture, avec l’objectif de pouvoir éviter à cette dernière des trajectoires considérées comme « déviantes ». Ce regard atteint cependant différemment les parents d’une même société. Alors qu’il s’adresse à un groupe restreint de parents ne stimulant peut-être pas assez leurs enfants de la manière promulguée par l’État, certains auteurs mettent de l’avant une tendance d’autres parents à surstimuler leur enfant (Corwin, 2006; Guthrie et Matthews, 2002; Duclos, 2006; Proulx, 2004; Elkind, 1983; Honoré, 2008; Rosenfeld et Wise, 2000). Pour d’autres encore, cette injonction de « produire » un enfant « compétent » s’ajoute à des stress déjà présents tels que la pauvreté ou la pression au travail. La tendance à surstimuler, surprogrammer ou surautonomiser les enfants dans le but de « produire » des enfants « compétents » est qualifiée d’hyper-parentage, de parentage excessif ou de surparentage et n’est pas sans rappeler la course à la performance étudiée pour les adultes par Ehrenberg (2001[1991]) ou de Gaulejac (2005). En suivant ce dernier auteur ou Perrenoud (2008), pour qui la tendance à gérer la famille comme une entreprise proviendrait d’une « contagion » du monde du travail, cette recherche porte sur le lien entre la manière dont les parents envisagent le cheminement de leur enfant et leur propre expérience de travail, en comparaison avec les discours des experts et de l’État.