The highly recombinogenic bz locus lies in an unusually gene-rich region of the maize genome

The bronze (bz) locus exhibits the highest rate of recombination of any gene in higher plants. To investigate the possible basis of this high rate of recombination, we have analyzed the physical organization of the region around the bz locus. Two adjacent bacterial artificial chromosome clones, comprising a 240-kb contig centered around the Bz-McC allele, were isolated, and 60 kb of contiguous DNA spanning the two bacterial artificial chromosome clones was sequenced. We find that the bz locus lies in an unusually gene-rich region of the maize genome. Ten genes, at least eight of which are shown to be transcribed, are contained in a 32-kb stretch of DNA that is uninterrupted by retrotransposons. We have isolated nearly full length cDNAs corresponding to the five proximal genes in the cluster. The average intertranscript distance between them is just 1 kb, revealing a surprisingly compact packaging of adjacent genes in this part of the genome. At least 11 small insertions, including several previously described miniature inverted repeat transposable elements, were detected in the introns and 3′ untranslated regions of genes and between genes. The gene-rich region is flanked at the proximal and distal ends by retrotransposon blocks. Thus, the maize genome appears to have scattered regions of high gene density similar to those found in other plants. The unusually high rate of intragenic recombination seen in bz may be related to the very high gene density of the region.

Transcriptional regulation of the Rhodococcus rhodochrous J1 nitA gene encoding a nitrilase.

The 1.4-kb downstream region from a nitrilase gene (nitA) of an actinomycete Rhodococcus rhodochrous J1, which is industrially in use, was found to be required for the isovaleronitrile-dependent induction of nitrilase synthesis in experiments using a Rhodococcus-Escherichia coli shuttle vector pK4 in a Rhodococcus strain. Sequence analysis of the 1.4-kb region revealed the existence of an open reading frame (nitR) of 957 bp, which would encode a protein with a molecular mass of 35,100. Deletion of the central and 3'-terminal portion of nitR resulted in the complete loss of nitrilase activity, demonstrating that nitR codes for a transcriptional positive regulator in nitA expression. The deduced amino acid sequence of nitR showed similarity to a positive regulator family including XylS from Pseudomonas putida and AraC from E. coli. By Northern blot analysis, the 1.4-kb transcripts for nitA were detected in R. rhodochrous J1 cells cultured in the presence of isovaleronitrile, but not those cultured in the absence of isovaleronitrile. The transcriptional start site for nitA was mapped to a C residue located 26 bp upstream of its translational start site. Deletion analysis to define the nitA promoter region suggested the possible participation of an inverted repeat sequence, centered on base pair -52, in induction of nitA transcription.

Initiation of (-) strand DNA synthesis from tRNA(3Lys) on lentiviral RNAs: implications of specific HIV-1 RNA-tRNA(3Lys) interactions inhibiting primer utilization by retroviral reverse transcriptases.

Initiation of minus (-) strand DNA synthesis was examined on templates containing R, U5, and primer-binding site regions of the human immunodeficiency virus type 1 (HIV-1), feline immunodeficiency virus (FIV), and equine infectious anemia virus (EIAV) genomic RNA. DNA synthesis was initiated from (i) an oligoribonucleotide complementary to the primer-binding sites, (ii) synthetic tRNA(3Lys), and (iii) natural tRNA(3Lys), by the reverse transcriptases of HIV-1, FIV, EIAV, simian immunodeficiency virus, HIV type 2 (HIV-2), Moloney murine leukemia virus, and avian myeloblastosis virus. All enzymes used an oligonucleotide on wild-type HIV-1 RNA, whereas only a limited number initiated (-) strand DNA synthesis from either tRNA(3Lys). In contrast, all enzymes supported efficient tRNA(3Lys)-primed (-) strand DNA synthesis on the genomes of FIV and EIAV. This may be in part attributable to the observation that the U5-inverted repeat stem-loop of the EIAV and FIV genomes lacks an A-rich loop shown with HIV-1 to interact with the U-rich tRNA anticodon loop. Deletion of this loop in HIV-1 RNA, or disrupting a critical loop-loop complex by tRNA(3Lys) extended by 9 nt, restored synthesis of HIV-1 (-) strand DNA from primer tRNA(3Lys) by all enzymes. Thus, divergent evolution of lentiviruses may have resulted in different mechanisms to use the same host tRNA for initiation of reverse transcription.

Molecular cloning of a rat chromosome putative recombinogenic sequence homologous to the hepatitis B virus encapsidation signal.

Previously, we reported that a 61-bp subgenomic HBV DNA sequence (designated as 15AB, nt 1855-1915) is a hot spot for genomic recombination and that a cellular protein binding to 15AB may be the putative recombinogenic protein. In the present study, we established the existence of a 15AB-like sequence in human and rat chromosomal DNA by Southern blot analysis. The 15AB-like sequence isolated from the rat chromosome demonstrated a 80.9% identity with 5'-CCAAGCTGTGCCTTGGGTGGC-3', at 1872-1892 of the hepatitis B virus genome, thought to be the essential region for recombination. Interestingly, this 15AB-like sequence also contained the pentanucleotide motifs GCTGG and CCAGC as an inverted repeat, part of the chi known hot spot for recombination in Escherichia coli. Importantly, a portion of the 15AB-like sequence is homologous (82.1%, 23/28 bp) to break point clusters of the human promyelocytic leukemia (PML) gene, characterized by a translocation [t(15;17)], and to rearranged mouse DNA for the immunoglobulin kappa light chain. Moreover, 15AB and 15AB-like sequences have striking homologies (12/15 = 80.0% and 13/15 = 86.7%, respectively) to the consensus sequence for topoisomerase II. Our present results suggest that this 15AB-like sequence in the rat genome might be a recombinogenic candidate triggering genomic instability in carcinogenesis.

Copy-choice recombination mediated by DNA polymerase III holoenzyme from Escherichia coli.

Formation of deletions by recombination between short direct repeats is thought to involve either a break-join or a copy-choice process. The key step of the latter is slippage of the replication machinery between the repeats. We report that the main replicase of Escherichia coli, DNA polymerase III holoenzyme, slips between two direct repeats of 27 bp that flank an inverted repeat of approximately equal 300bp. Slippage was detected in vitro, on a single-stranded DNA template, in a primer extension assay. It requires the presence of a short (8 bp) G+C-rich sequence at the base of a hairpin that can form by annealing of the inverted repeats. It is stimulated by (i) high salt concentration, which might stabilize the hairpin, and (ii) two proteins that ensure the processivity of the DNA polymerase III holoenzyme: the single-stranded DNA binding protein and the beta subunit of the polymerase. Slippage is rather efficient under optimal reaction conditions because it can take place on >50% of template molecules. This observation supports the copy-choice model for recombination between short direct repeats.

Identification of functional domains and evolution of Tc1-like transposable elements.

Tc1-like transposable elements from teleost fish have been phylogenetically examined to determine the mechanisms involved in their evolution and conserved domains of function. We identified two new functional domains in these elements. The first is a bipartite nuclear localization signal, indicating that transposons can take advantage of the transport machinery of host cells for nuclear uptake of their transposases. The second is a novel combination of a paired domain-related protein motif juxtaposed to a leucine zipper-like domain located in the putative DNA-binding regions of the transposases. This domain coexists with a special inverted repeat structure in certain transposons in such phylogenetically distant hosts as fish and insects. Our data indicate that reassortment of functional domains and horizontal transmission between species are involved in the formation and spread of new types of transposable elements.

Mg-SINE: a short interspersed nuclear element from the rice blast fungus, Magnaporthe grisea.

A short interspersed nuclear element, Mg-SINE, was isolated and characterized from the genome of the rice blast fungus, Magnaporthe grisea. Mg-SINE was isolated as an insertion element within Pot2, an inverted-repeat transposon from M. grisea and shows typical features of a mammalian SINE. Mg-SINE is present as a 0.47-kb interspersed sequence at approximately 100 copies per haploid genome in both rice and non-rice isolates of M. grisea, indicating a common evolutionary origin. Secondary structure analysis of Mg-SINE revealed a tRNA-related region at the 5' end which folds into a cloverleaf structure. Genomic fusions resulting in chimeric Mg-SINEs (Ch-SINEs) composed of a sequence homologous to Mg-SINE at the 3' end and an unrelated sequence at its 5' end were also isolated, indicating that this and other DNA rearrangements mediated by these elements may have a major effect on the genomic architecture of this fungus.

A regulatory element in the promoter of the human granulocyte-macrophage colony-stimulating factor gene that has related sequences in other T-cell-expressed cytokine genes.

Granulocyte-macrophage colony-stimulating factor (GM-CSF) is a cytokine with a broad spectrum of cell-differentiating and colony-stimulating activities. It is expressed by several undifferentiated (bone marrow stromal cells, fibroblasts) and fully differentiated (T cells, macrophages, and endothelial cells) cells. Its expression in T cells is activation dependent. We have found a regulatory element in the promoter of the GM-CSF gene which contains two symmetrically nested inverted repeats (-192 CTTGGAAAGGTTCATTAATGAAAACCCCCAAG -161). In transfection assays with the human GM-CSF promoter, this element has a strong positive effect on the expression of a reporter gene by the human T-cell line Jurkat J6 upon stimulation with phorbol dibutyrate and ionomycin or anti-CD3 antibody. This element also acts as an enhancer when inserted into a minimal promoter vector. In DNA band-retardation assays this sequence produces six specific bands that involve one or the other of the inverted repeats. We have also shown that a DNA-protein complex can be formed involving both repeats and probably more than one protein. The external inverted repeat contains a core sequence CTTGG...CCAAG, which is also present in the promoters of several other T-cell-expressed human cytokines (interleukins 4, 5, and 13). The corresponding elements in GM-CSF and interleukin 5 promoters compete for the same proteins in band-retardation assays. The palindromic elements in these genes are larger than the core sequence, suggesting that some of the interacting proteins may be different for different genes. Considering the strong positive regulatory effect and their presence in several T-cell-expressed cytokine genes, these elements may be involved in the coordinated expression of these cytokines in T-helper cells.

Análise funcional das proteínas HrcA, GroES/GroEL e DnaK/DnaJ em Caulobacter crescentus

O operon groESL de C. crescentus apresenta dupla regulação. A indução deste operon por choque térmico é dependente do fator sigma de choque térmico σ32. A temperaturas fisiológicas, a expressão de groESL apresenta regulação temporal durante o ciclo celular da bactéria e o controle envolve a proteína repressora HrcA e o elemento CIRCE (controlling inverted repeat of chaperonin expression). Para estudar a atividade da proteína repressora in vitro, produzimos e purificamos de E. coli a HrcA de C. creseentus contendo uma cauda de histidinas e a ligação especifica ao elemento CIRCE foi analisada em ensaios de migração retardada em gel de poliacrilamida (EMRGP). A quantidade de DNA retardada pela ligação a HrcA aumentou significativamente na presença de GroES/GroEL, sugerindo que estas proteínas modulam a atividade de HrcA. Corroboração desta modulação foi obtida analisando fusões de transcrição da região regulatória de groESL com o gene lacZ, em células de C. crescentus produzindo diferentes quantidades de GroES/EL. HrcA contendo as substituições Pro81 AJa e Arg87Ala, aminoácidos que se localizam no domínio putativo de ligação ao DNA da proteína, mostraram ser deficientes na ligação a CIRCE, tanto in vitro como in vivo. Em adição, HrcA Ser56Ala expressa na mesma célula juntamente com a proteína selvagem produziu um fenótipo dominante-negativo, indicando que a HrcA de C. crescentus liga-se a CIRCE como um oligômero, provavelmente um dímero. As tentativas de obtenção de mutantes nulos para os genes groESL ou dnaKJ falharam, indicando que as proteínas GroES/GroEL e DnaK/DnaJ são essenciais em C. crescentus, mesmo a temperaturas normais. Foram então construídas no laboratório as linhagens mutantes condicionais SG300 e SG400 de C. crescentus, onde a expressão de groESL e de dnaKJ, respectivamente, está sob controle de um promotor induzido por xilose (PxyIX). Estas linhagens foram caracterizadas quanto á sua morfologia em condições permissivas ou restritivas, assim como quanto à capacidade de sobrevivência frente a vários tipos de estresse. As células da linhagem SG300, exauridas de GroES/GroEL, são resistentes ao choque térmico a 42°C e são capazes de adquirir alguma termotolerância. Entretanto, estas células são sensíveis aos estresses oxidativo, salino e osmótico. As células da linhagem SG400, exauridas de DnaKlJ, são sensíveis ao choque térmico, à exposição a etanol e ao congelamento, e são incapazes de adquirir termotolerância. Além disso, tanto as células exauridas de GroES/GroEL quanto as exauridas de DnaK/DnaJ apresentam problemas na sua morfologia. As células de SG300 exauridas de GroES/GroEL formam filamentos longos que possuem constrições fundas e irregulares. As células de SG400 exauridas de DnaK/DnaJ são apenas um pouco mais alongadas que as células pré-divisionais selvagens e a maioria das células não possuem septo. Estas observações indicam bloqueio da divisão celular, que deve ocorrer em diferentes estágios em cada linhagem.

Sequence analysis and distribution in Salmonella enterica serovars of IS3-like elements

The genome of Salmonella enterica serovar Enteritidis was shown to possess three IS3-like insertion elements, designated IS1230A, B and C, and each was cloned and their respective deoxynucleotide sequences determined. Mutations in elements IS1230A and B resulted in frameshifts in the open reading frames that encoded a putative transposase to be inactive. IS1230C was truncated at nucleotide 774 relative to IS1230B and therefore did not possess the 3' terminal inverted repeat. The three IS1230 derivatives were closely related to each other based on nucleotide sequence similarity. IS1230A was located adjacent to the sef operon encoding SEF14 fimbriae located at minute 97 of the genome of S. Enteritidis. IS1230B was located adjacent to the umuDC operon at minute 42.5 on the genome, itself located near to one terminus of an 815-kb genome inversion of S. Enteritidis relative to S. Typhimurium. IS1230C was located next to attB, the bacteriophage P22 attachment site, and proB, encoding gamma-glutamyl phosphate reductase. A truncated 3' remnant of IS1230, designated IS1230T, was identified in a clinical isolate of S. Typhimurium DT193 strain 2391. This element was located next to attB adjacent to which were bacteriophage P22-like sequences. Southern hybridisation of total genomic DNA from eighteen phage types of S. Enteritidis and eighteen definitive types of S. Typhimurium showed similar, if not identical, restriction fragment profiles in the respective serovars when probed with IS1230A.

Discovery of stable and variable differences in the Mycobacterium avium subsp. paratuberculosis type I, II, and III genomes by pan-genome microarray analysis

Mycobacterium avium subsp. paratuberculosis is an important animal pathogen widely disseminated in the environment that has also been associated with Crohn's disease in humans. Three M. avium subsp. paratuberculosis genomotypes are recognized, but genomic differences have not been fully described. To further investigate these potential differences, a 60-mer oligonucleotide microarray (designated the MAPAC array), based on the combined genomes of M. avium subsp. paratuberculosis (strain K-10) and Mycobacterium avium subsp. hominissuis (strain 104), was designed and validated. By use of a test panel of defined M. avium subsp. paratuberculosis strains, the MAPAC array was able to identify a set of large sequence polymorphisms (LSPs) diagnostic for each of the three major M. avium subsp. paratuberculosis types. M. avium subsp. paratuberculosis type II strains contained a smaller genomic complement than M. avium subsp. paratuberculosis type I and M. avium subsp. paratuberculosis type III genomotypes, which included a set of genomic regions also found in M. avium subsp. hominissuis 104. Specific PCRs for genes within LSPs that differentiated M. avium subsp. paratuberculosis types were devised and shown to accurately screen a panel (n = 78) of M. avium subsp. paratuberculosis strains. Analysis of insertion/deletion region INDEL12 showed deletion events causing a reduction in the complement of mycobacterial cell entry genes in M. avium subsp. paratuberculosis type II strains and significantly altering the coding of a major immunologic protein (MPT64) associated with persistence and granuloma formation. Analysis of MAPAC data also identified signal variations in several genomic regions, termed variable genomic islands (vGIs), suggestive of transient duplication/deletion events. vGIs contained significantly low GC% and were immediately flanked by insertion sequences, integrases, or short inverted repeat sequences. Quantitative PCR demonstrated that variation in vGI signals could be associated with colony growth rate and morphology.

Dynamics of 5S rDNA in the tilapia (Oreochromis niloticus) genome: repeat units, inverted sequences, pseudogenes and chromosome loci

In higher eukaryotes, the 5S ribosomal DNA (5S rDNA) is organized in tandem arrays with repeat units composed of a coding region and a non-transcribed spacer sequence (NTS). These tandem arrays can be found on either one or more chromosome pairs. 5S rDNA copies from the tilapia fish. Oreochromis niloticus, were cloned and the nucleotide sequences of the coding region and of the non-transcribed spacer were deter-mined. Moreover, the genomic organization of the 5S rDNA tandem repeats was investigated by fluorescence in situ hybridization (FISH) and Southern blot hybridization. Two 5S rDNA classes, one consisting of 1.4-kb repeats and another one with 0.5-kb repeats were identified and designated 5S rDNA type I and type II, respectively, An inverted 5S rRNA gene and a 5S rRNA putative pseudogene were also identified inside the tandem repeats of 5S rDNA type I. FISH permitted the visualization of the 5S rRNA genes at three chromosome loci, one of them consisting of arrays of the 5S rDNA type I, and the two others corresponding to arrays of the 5S rDNA type II. The two classes of the 5S rDNA. The presence of pseudogenes, and the inverted genes observed in the O. niloticus genome might be a consequence of the intense dynamics of the evolution of these tandem repeat elements. Copyright (C) 2002 S. Karger AG, Basel.

Quality and sensorial characteristics of osmotically dehydrated mango with syrups of inverted sugar and sucrose

Osmotic dehydration is becoming more popular as a complementary treatment in the processing of dehydrated foods, since it presents some advantages such as minimising heat damage to the colour and flavour, inhibiting enzymatic browning and thus dispensing the addition of sulphite and, mainly, reducing energy costs. The objective of the present study was to evaluate the effect of using inverted sugar and sucrose syrups as osmotic agents in the dehydration of mango. The conditions used in the dehydration process were: syrup/fruit ratio of 3:1 (v/w); temperature of 45ºC and constant stirring. The in natura and osmo-dehydrated fruits were evaluated in relation to pH, moisture content, water activity (a w) and soluble solids (ºBrix). Solids incorporation and loss in mass after the dehydration process were also determined. The sensory acceptance of the in natura and osmo-dehydrated fruits was determined for the attributes of aroma, flavour, texture and overall acceptance using a hedonic scale. Osmotic dehydration resulted in a reduction in moisture content and water activity, an increase in Brix and maintenance of the pH. The treatment with inverted sugar syrup resulted in more significant alterations in moisture content, a w, Brix, solids incorporation and loss in mass than the treatment with sucrose syrup. Mangos osmo-dehydrated with inverted sugar (55.3% inversion rate) syrup obtained acceptance similar to in natura mangos, this treatment being considered the most adequate for dehydration purposes.

Long Terminal Repeat Sequence Analysis of HTLV-2 Molecular Variants Identified in Southern Brazil

In Brazil, human T-lymphotropic virus type 2 (HTLV-2) is endemic in Amerindians and epidemic in intravenous drug users (IDUs). The long terminal repeat (LTR) is the most divergent genomic region of HTLV-2, therefore useful to characterize subtypes. Nucleotide sequence and restriction fragment length polymorphism (RFLP) analysis of LTR genomic segments of fourteen HTLV-2 strains isolated from HIV-infected patients of Londrina, Southern Brazil, were carried out. Molecular analysis disclosed that all HTLV-2 strains belonged to 2a subtype, and RFLP detected the presence of the a4, a5, and a6 subgroups according to Switzer's nomenclature. RFLP correlated with nucleotide sequence, and phylogenetic analysis clustered HTLV-2 sequences of IDUs into subgroups a5 and a6. HTLV-2 sequences from individuals of sexual risk factor clustered into the a4 subgroup. These results extend the knowledge of the genetic diversity of HTLV-2 circulating in Brazil and provide insights into HTLV-2 transmission and virus movement in this geographic area.

Normal and defective mariner-like elements in Rhynchosciara species (Sciaridae, Diptera)

Mariner-like elements are widely present in diverse organisms. These elements constitute a large fraction of the eukaryotic genome; they transpose by a ""cut-and-paste"" mechanism with their own transposase protein. We found two groups of mobile elements in the genus Rhynchosciara. PCR using primers designed from R. americana transposons (Ramar1 and Ramar2) were the starting point for this comparative study. Genomic DNA templates of four species: R. hollaenderi, R. millerii, R. baschanti, and Rhynchosciara sp were used and genomic sequences were amplified, sequenced and the molecular structures of the elements characterized as being putative mariner-like elements. The first group included the putative full-length elements. The second group was composed of defective mariner elements that contain a deletion overlapping most of the internal region of the transposase open reading frame. They were named Rmar1 (type 1) and Rmar2 (type 2), respectively. Many conserved amino acid blocks were identified, as well as a specific D,D(34) D signature motif that was defective in some elements. Based on predicted transposase sequences, these elements encode truncated proteins and are phylogenetically very close to mariner-like elements of the mauritiana subfamily. The inverted terminal repeat sequences that flanked the mariner-like elements are responsible for their mobility. These inverted terminal repeat sequences were identified by inverse PCR.