Nucleotide sequence of a cucumber chloroplast proline tRNA

The nucleotide sequence of a proline tRNA (anticodon UGG) from cucumber chloroplasts has been determined. The sequence is: pAAGGAUGUAGCGCAGCUUCADAGCGCAΨUUGUUUUGGNΨFACAAAAUm7GUCACGGGTΨCAAAUCCUGUCAUCCUUACCAOH. It shows 93% homology with spinach chloroplast tRNAPro (UGG) and 72% homology with bean mitochondrial tRNA Pro (UGG), the other two known plant organellar tRNAsPro.

Light- and cytokinin-induced changes in the levels of leucine and tyrosine isoaccepting tRNA species and modified nucleotide contents of total tRNA in cucumber seedlings

We have determined relative levels of chloroplast leucine and tyrosine isoaccepting tRNAs and modified nucleotide contents from total tRNAs isolated from dark-grown, light-grown, N6-isopentenyladenine (i6A)-treated dark-grown and i6A-treated light-grown cucumber seedlings. Significant increases in the relative amounts of tRNA(Leu)2 and tRNA(Leu)3 were observed in the i6A-treated dark-grown seedlings compared to dark-grown, light-grown and i6A-treated light-grown seedlings. On the other hand, i6A-treated light-grown seedlings tRNA(Tyr)1 increased to 85% of total tRNAs(Tyr) from about 9% in light-grown seedlings and tRNA(Tyr)2 decreased to 15% compared with 91% in light-grown seedlings. Analysis of modified nucleotide of total tRNAs indicated that pT, pI, pm1A, pm5C, pGm, pm1G, pm2G and pm7G contents were significantly higher in the total tRNA of i6A-treated dark-grown seedlings than those from untreated dark-grown seedlings. Illumination of 8-day-old dark-grown seedlings for 12 h increased the contents of pT, pI, pGm and pm1G when compared to 8-day-old dark-grown seedlings with extended growth for 12 h in dark. On the contrary, i6A had no stimulatory effect in the contents of modified nucleotide in the light-grown seedlings.

Cucumber chloroplast trnL(CAA) gene: nucleotide sequence and in vivo expression analysis in etiolated cucumber seedlings treated with benzyladenine and light.

The nucleotide sequence of a 714 bp BamHI-EcoRI fragment of cucumber chloroplast DNA was determined. The fragment contained a gene for tRNA(Leu) together with its flanking regions. The trnL(CAA) gene sequence is about 99% in similarity to broad bean, cauliflower, maize, spinach and tobacco corresponding genes. The relative expression level of the gene was determined by Northern (tRNA) gel blot and Northern (total cellular RNA) slot-blot analyses using the trnL gene probe in 6-day old etiolated cucumber seedlings and the seedlings that had been kept in the dark (dark-grown), treated with benzyladenine (BA) and kept in the dark (BA-treated dark-grown), illuminated (light-grown), and treated with BA and illuminated (BA-treated light-grown), for additional 4, 8 or 12 hr. The trnL transcripts and tRNA(Leu) levels in BA-treated dark-grown seedlings were 5 and 3 times higher, respectively after 4 hr BA treatment, while in the BA treated light-grown seedlings the level of trnL transcripts was only 3 times higher and had no detectable effect on mature tRNA(Leu) when compared to the time-4 hr dark-grown seedlings. However, the level of mature tRNA(Leu) did not show marked changes in the light-grown seedlings, whereas the level of trnL transcripts increases 3 times after 8 hr illumination of dark-grown seedlings. These data indicate that both light and cytokinin can signal changes in plastid tRNA gene expression. The possible regulatory mechanisms for such changes are discussed.

Cucumber chloroplast trnL(CAA) gene: nucleotide sequence and in vivo expression analysis in etiolated cucumber seedlings treated with benzyladenine and light

The nucleotide sequence of a 714 bp BamHI-EcoRI fragment of cucumber chloroplast DNA was determined. The fragment contained a gene for tRNA(Leu) together with its flanking regions. The trnL(CAA) gene sequence is about 99% in similarity to broad bean, cauliflower, maize, spinach and tobacco corresponding genes. The relative expression level of the gene was determined by Northern (tRNA) gel blot and Northern (total cellular RNA) slot-blot analyses using the trnL gene probe in 6-day old etiolated cucumber seedlings and the seedlings that had been kept in the dark (dark-grown), treated with benzyladenine (BA) and kept in the dark (BA-treated dark-grown), illuminated (light-grown), and treated with BA and illuminated (BA- treated light-grown), for additional 4, 8 or 12 hr. The trnL transcripts and tRNA(Leu) levels in BA-treated dark-grown seedlings were 5 and 3 times higher, respectively after 4 hr BA treatment, while in the BA treated light-grown seedlings the level of trnL transcripts was only 3 times higher and had not detectable effect on mature tRNA(Leu) when compared to the time-4 hr dark-grown seedlings. However, the level of mature tRNA(Leu) did not show marked changes in the light-grown seedlings, whereas the level of trnL transcripts increases 3 times after 8 hr illumination of dark-grown seedlings. These date indicate that both light and cytokinin can signal changes in plastid tRNA gene expression. The possible regulatory mechanisms for such changes are discussed.

Status and management of the sea cucumber fishery of La Grande Terre, New Caledonia

From October 2006 to May 2008, The WorldFish Center coordinated a ZoNéCo project to provide support to the Southern and Northern Provinces for decisions about how best to manage the sea cucumber fishery around La Grande Terre. We collected data during underwater population surveys, questionnaire-based interviews with fishers and processors, and landing catch surveys. A core aim was to furnish the Provinces with ‘ballpark’ estimates of the abundance and density of commercially important sea cucumbers on 50 lagoon and barrier reefs. Analysis and synthesis of the ecological and sociological data provide the basis for informed recommendations for fisheries management. Counts of trochus and giant clams on the reefs allow us to also describe the general status of those resources. We propose 13 recommendations for management actions and fishery regulations and advocate an adaptive management approach. This multidisciplinary study should serve as a useful template for assessing other fisheries, and we provide a series of generic ‘lessons learnt’ to aid future programmes. (PDF has 140 pages.)

Value chain analysis for sea cucumber in the Philippines

This study examined the sea cucumber industry in the Philippines through the value chain lens. The intent was to identify effective pathways for the successful introduction of sandfish culture as livelihood support for coastal communities. Value chain analysis is a high-resolution analytical tool that enables industry examination at a detailed level. Previous industry assessments have provided a general picture of the sea cucumber industry in the country. The present study builds on the earlier work and supplies additional details for a better understanding of the industry's status and problems, especially their implications for the Australian Center for International Agricultural Research (ACIAR) funded sandfish project "Culture of sandfish (Holothuria scabra) in Asia- Pacific" (FIS/2003/059). (PDF contains 54 pages)

A study of tagging methods for the sea cucumber Cucumaria frondosa in the waters off Maine

The sea cucumber fishery in waters off Maine is developing and has recently experienced great increases in landings, corresponding to expanding export markets. Between 1994 and 1996, reported landings ranged from one to three million pounds (Fig. 1). In 1999, reported landings were over eight million pounds and rose to over nine million in 2000 (Feindel1). Like other developing fisheries, we have little information about the biology and ecology of the sea cucumber off Maine, limited data on the fishery, and little knowledge about the key life history processes that characterize its population dynamics. Therefore, we have a limited understanding of the current status of the resource and the impacts the fishery may have on the stock.

Hatchery and culture technology for the sea cucumber Holothuria scabra Jaeger, in India

The seed of the sea cucumber Holothuria scabra jaeger is being produced at the Central Marine Fisheries Research Institute in India. This article describes the techniques being used in the production of seed and the experiments being carried out for the rearing of juveniles. Trials to grow juveniles in hatcheries on prawn farms have shown spectabular results that are both cost efficient and environmentally friendly.

A Review of Recent Developments in the World Sea Cucumber Fisheries

Sea cucumbers (Holothuridae and Stichopodidae) have been harvested commercially for at least 1,000 years. The world fisheries for sea cucumbers, however, are not well documented and in general are poorly managed. Depending upon the species exploited, there are two processing procedures for the sea cucumber product. Some species are eaten raw, while most commercial species are processed into a dry product called beche-de-mer or trepang. This dry product is exported to a central market such as Hong Kong and then re-exported to the consumers. In this review, recent statistics on the world sea cucumber fisheries, collected from different services, are detailed for each major fishing area. Case studies for each fishing area are also presented. Recent major changes in the Indo-Pacific fishery include the participation of new producer countries, the shift in the species being exploited, and an increase in the Chinese market. The expansion of the largely monospecific temperate North Pacific fisheries is also described. Statistics from Hong Kong, Singapore, Taiwan, and the Food and Agriculture Organization provide valuable information on the producer and importer countries. Particular attention is paid to the reciprocal trade of beche-de-mer between Hong Kong and Singapore. An evaluation of the world sea cucumber landings and beche-de-mer production is presented. Recent developments include an expansion of the Hong Kong market due to increased demand by China, the importance of Indonesia as a major world producer, and an increase in the fisheries of Tropical Pacific nations. This increase is best documented for New Caledonia and Fiji. Ways to improve the access and the reliability of the statistics for the sea cucumber fishery are discussed, as is the potential for management of artisanal fisheries.