194 resultados para chloroplasts
Resumo:
Virus-like particle-based vaccines for high-risk human papillomaviruses (HPVs) appear to have great promise; however, cell culture-derived vaccines will probably be very expensive. The optimization of expression of different codon-optimized versions of the HPV-16 L1 capsid protein gene in plants has been explored by means of transient expression from a novel suite of Agrobacterium tumefaciens binary expression vectors, which allow targeting of recombinant protein to the cytoplasm, endoplasmic reticulum (ER) or chloroplasts. A gene resynthesized to reflect human codon usage expresses better than the native gene, which expresses better than a plant-optimized gene. Moreover, chloroplast localization allows significantly higher levels of accumulation of L1 protein than does cytoplasmic localization, whilst ER retention was least successful. High levels of L1 (>17% total soluble protein) could be produced via transient expression: the protein assembled into higher-order structures visible by electron microscopy, and a concentrated extract was highly immunogenic in mice after subcutaneous injection and elicited high-titre neutralizing antibodies. Transgenic tobacco plants expressing a human codon-optimized gene linked to a chloroplast-targeting signal expressed L1 at levels up to 11% of the total soluble protein. These are the highest levels of HPV L1 expression reported for plants: these results, and the excellent immunogenicity of the product, significantly improve the prospects of making a conventional HPV vaccine by this means. © 2007 SGM.
Resumo:
Herbarium accession data offer a useful historical botanical perspective and have been used to track the spread of plant invasions through time and space. Nevertheless, few studies have utilised this resource for genetic analysis to reconstruct a more complete picture of historical invasion dynamics, including the occurrence of separate introduction events. In this study, we combined nuclear and chloroplast microsatellite analyses of contemporary and historical collections of Senecio madagascariensis, a globally invasive weed first introduced to Australia c. 1918 from its native South Africa. Analysis of nuclear microsatellites, together with temporal spread data and simulations of herbarium voucher sampling, revealed distinct introductions to south-eastern Australia and mid-eastern Australia. Genetic diversity of the south-eastern invasive population was lower than in the native range, but higher than in the mid-eastern invasion. In the invasive range, despite its low resolution, our chloroplast microsatellite data revealed the occurrence of new haplotypes over time, probably as the result of subsequent introduction(s) to Australia from the native range during the latter half of the 20th century. Our work demonstrates how molecular studies of contemporary and historical field collections can be combined to reconstruct a more complete picture of the invasion history of introduced taxa. Further, our study indicates that a survey of contemporary samples only (as undertaken for the majority of invasive species studies) would be insufficient to identify potential source populations and occurrence of multiple introductions.
Resumo:
To produce commercially valuable ketocarotenoids in Solanum tuberosum, the 4, 4′ β-oxygenase (crtW) and 3, 3′ β-hydroxylase (crtZ) genes from Brevundimonas spp. have been expressed in the plant host under constitutive transcriptional control. The CRTW and CRTZ enzymes are capable of modifying endogenous plant carotenoids to form a range of hydroxylated and ketolated derivatives. The host (cv. Désirée) produced significant levels of nonendogenous carotenoid products in all tissues, but at the apparent expense of the economically critical metabolite, starch. Carotenoid levels increased in both wild-type and transgenic tubers following cold storage; however, stability during heat processing varied between compounds. Subcellular fractionation of leaf tissues revealed the presence of ketocarotenoids in thylakoid membranes, but not predominantly in the photosynthetic complexes. A dramatic increase in the carotenoid content of plastoglobuli was determined. These findings were corroborated by microscopic analysis of chloroplasts. In tuber tissues, esterified carotenoids, representing 13% of the total pigment found in wild-type extracts, were sequestered in plastoglobuli. In the transgenic tubers, this proportion increased to 45%, with esterified nonendogenous carotenoids in place of endogenous compounds. Conversely, nonesterified carotenoids in both wild-type and transgenic tuber tissues were associated with amyloplast membranes and starch granules.
Resumo:
Background Ugni molinae Turcz. is one of the most studied species of South American Myrtaceae due to its edible fruits and foliar medicinal compounds. However, there is no anatomical study of the leaves or secretory cavities. This paper seeks to describe the leaf micromorphology and anatomy of the species using standard protocols for light and scanning electron microscopy. Secretory cavities were anatomically characterized in young and mature leaves. Histochemical staining of the cavities was performed. Results The leaves of U. molinae are hypostomatic, have a wavy surface and possess scattered hairs. Leaf anatomical features include dorsiventral mesophyll, two to three layers of palisade parenchyma with abundant chloroplasts, calcium oxalate crystals and internal phloem in vascular bundles. Schizogenous secretory cavities are present on the abaxial surface and are mainly located on the margins of the leaves. Histochemical tests of these cavities suggest the presence of lipophilic substances. Conclusions This is the first study of secretory cavities in Chilean Myrtaceae. In general, micromorphological and anatomical characters are similar to other species of the family. The present findings could provide valuable anatomical information for future research in South American Myrtaceae.
Resumo:
Engineering the production of polyhydroxyalkanoates (PHAs) into high biomass bioenergy crops has the potential to provide a sustainable supply of bioplastics and energy from a single plant feedstock. One of the major challenges in engineering C-4 plants for the production of poly[(R)-3-hydroxybutyrate] (PHB) is the significantly lower level of polymer produced in the chloroplasts of mesophyll (M) cells compared to bundle sheath (BS) cells, thereby limiting the full PHB yield-potential of the plant. In this study, we provide evidence that the access to substrate for PHB synthesis may limit polymer production in M chloroplasts. Production of PHB in M cells of sugarcane is significantly increased by replacing -ketothiolase, the first enzyme in the bacterial PHA pathway, with acetoacetyl-CoA synthase. This novel pathway enabled the production of PHB reaching an average of 6.3% of the dry weight of total leaf biomass, with levels ranging from 3.6 to 11.8% of the dry weight (DW) of individual leaves. These yields are more than twice the level reported in PHB-producing sugarcane containing the -ketothiolase and illustrate the importance of producing polymer in mesophyll plastids to maximize yield. The molecular weight of the polymer produced was greater than 2x10(6)Da. These results are a major step forward in engineering a high biomass C-4 grass for the commercial production of PHB.
Resumo:
Lutein (3,3'-dihydroxy alpha-carotene), a xanthophyll present in plant chloroplasts, increases the permeability of phospholipid vesicles to Ca2+, even though the pigment does not bind the metal ion. Energy-dependent uptake of Ca2+ by mitochondria is inhibited by lutein, which permits a rapid efflux of the ion from Ca2+-loaded mitochondria. These results are consistent with the view that the deleterious action of lutein on mitochondrial oxidative phosphorylation results from its destabilizing action on membrane structure.
Resumo:
A suite of co-occurring eriophyid mite species are significant pests in subtropical Australia, causing severe discolouration, blistering, necrosis and leaf loss to one of the region's most important hardwood species, Corymbia citriodora subsp. variegata (F. Muell.) K. D. Hill & L. A. S. Johnson (Myrtaceae). In this study, we examined mite population dynamics and leaf damage over a 1-year period in a commercial plantation of C. citriodora subsp. variegata. Our aims were to link the incidence and severity of mite damage, and mite numbers, to leaf physical traits (moisture content and specific leaf weight (SLW)); to identify any seasonal changes in leaf surface occupancy (upper vs. lower lamina); and host tree canopy strata (upper, mid or lower canopy). We compared population trends with site rainfall, temperature and humidity. We also examined physical and anatomical changes in leaf tissue in response to mite infestation to characterize the plants' physiological reaction to feeding, and how this might affect photosynthesis. Our main findings included positive correlations with leaf moisture content and mite numbers and with mite numbers and damage severity. Wet and dry leaf mass and SLW were greater for damaged tissue than undamaged tissue. Mites were distributed equally throughout the canopy and on both leaf surfaces. No relationships with climatic factors were found. Damage symptoms occurred equally and were exactly mirrored on both leaf surfaces. Mite infestation increased the overall epidermal thickness and the number and size of epidermal cells and was also associated with a rapid loss of chloroplasts from mesophyll cells beneath damage sites. The integrity of the stomatal complex was severely compromised in damaged tissues. These histological changes suggest that damage by these mites will negatively impact the photosynthetic efficiency of susceptible plantation species.
Resumo:
A suite of co-occurring eriophyid mite species are significant pests in subtropical Australia, causing severe discolouration, blistering, necrosis and leaf loss to one of the region's most important hardwood species, Corymbia citriodora subsp. variegata (F. Muell.) K. D. Hill & L. A. S. Johnson (Myrtaceae). In this study, we examined mite population dynamics and leaf damage over a 1-year period in a commercial plantation of C. citriodora subsp. variegata. Our aims were to link the incidence and severity of mite damage, and mite numbers, to leaf physical traits (moisture content and specific leaf weight (SLW)); to identify any seasonal changes in leaf surface occupancy (upper vs. lower lamina); and host tree canopy strata (upper, mid or lower canopy). We compared population trends with site rainfall, temperature and humidity. We also examined physical and anatomical changes in leaf tissue in response to mite infestation to characterize the plants' physiological reaction to feeding, and how this might affect photosynthesis. Our main findings included positive correlations with leaf moisture content and mite numbers and with mite numbers and damage severity. Wet and dry leaf mass and SLW were greater for damaged tissue than undamaged tissue. Mites were distributed equally throughout the canopy and on both leaf surfaces. No relationships with climatic factors were found. Damage symptoms occurred equally and were exactly mirrored on both leaf surfaces. Mite infestation increased the overall epidermal thickness and the number and size of epidermal cells and was also associated with a rapid loss of chloroplasts from mesophyll cells beneath damage sites. The integrity of the stomatal complex was severely compromised in damaged tissues. These histological changes suggest that damage by these mites will negatively impact the photosynthetic efficiency of susceptible plantation species.
Resumo:
The nucleotide sequence of a proline tRNA (anticodon UGG) from cucumber chloroplasts has been determined. The sequence is: pAAGGAUGUAGCGCAGCUUCADAGCGCAΨUUGUUUUGGNΨFACAAAAUm7GUCACGGGTΨCAAAUCCUGUCAUCCUUACCAOH. It shows 93% homology with spinach chloroplast tRNAPro (UGG) and 72% homology with bean mitochondrial tRNA Pro (UGG), the other two known plant organellar tRNAsPro.
Resumo:
F4 fimbriae of enterotoxigenic Escherichia coli (ETEC) are highly stable multimeric structures with a capacity to evoke mucosal immune responses. With these characters F4 offer a unique model system to study oral vaccination against ETEC-induced porcine postweaning diarrhea. Postweaning diarrhea is a major problem in piggeries worldwide and results in significant economic losses. No vaccine is currently available to protect weaned piglets against ETEC infections. Transgenic plants provide an economically feasible platform for large-scale production of vaccine antigens for animal health. In this study, the capacity of transgenic plants to produce FaeG protein, the major structural subunit and adhesin of F4 fimbria, was evaluated. Using the model plant tobacco, the optimal subcellular location for FaeG accumulation was examined. Targeting of FaeG into chloroplasts offered a superior accumulation level of 1% of total soluble proteins (TSP) over the other investigated subcellular locations, namely, the endoplasmic reticulum and the apoplast. Moreover, we determined whether the FaeG protein, when isolated from its fimbrial background and produced in a plant cell, would retain the key properties of an oral vaccine, i.e. stability in gastrointestinal conditions, binding to porcine intestinal F4 receptors (F4R), and inhibition of the F4-possessing (F4+) ETEC attachment to F4R. The chloroplast-derived FaeG protein did show resistance against low pH and proteolysis in the simulated gastrointestinal conditions and was able to bind to the F4R, subsequently inhibiting the F4+ ETEC binding in a dose-dependent manner. To investigate the oral immunogenicity of FaeG protein, the edible crop plant alfalfa was transformed with the chloroplast-targeting construct and equally to tobacco plants, a high-yield FaeG accumulation of 1% of TSP was obtained. A similar yield was also obtained in the seeds of barley, a valuable crop plant, when the FaeG-encoding gene was expressed under an endosperm-specific promoter and subcellularly targeted into the endoplasmic reticulum. Furthermore, desiccated alfalfa plants and barley grains were shown to have a capacity to store FaeG protein in a stable form for years. When the transgenic alfalfa plants were administred orally to weaned piglets, slight F4-specific systemic and mucosal immune responses were induced. Co-administration of the transgenic alfalfa and the mucosal adjuvant cholera toxin enhanced the F4-specific immune response; the duration and number of F4+ E. coli excretion following F4+ ETEC challenge were significantly reduced as compared with pigs that had received nontransgenic plant material. In conclusion, the results suggest that transgenic plants producing the FaeG subunit protein could be used for production and delivery of oral vaccines against porcine F4+ ETEC infections. The findings here thus present new approaches to develop the vaccination strategy against porcine postweaning diarrhea.
Resumo:
Plants are capable of recognizing phytopathogens through the perception of pathogen-derived molecules or plant cell-wall degradation products due to the activities of pathogen-secreted enzymes. Such elicitor recognition events trigger an array of inducible defense responses involving signal transduction networks and massive transcriptional re-programming. The outcome of a pathogen infection relies on the balance between different signaling pathways, which are integrated by regulatory proteins. This thesis characterized two key regulatory components: a damage control enzyme, chlorophyllase 1 (AtCHL1), and a transcription factor, WRKY70. Their roles in defense signaling were then investigated. The Erwinia-derived elicitors rapidly activated the expression of AtCLH1 and WRKY70 through different signaling pathways. The expression of the AtCHL1 gene was up-regulated by jasmonic acid (JA) but down-regulated by salicylic acid (SA), whereas WRKY70 was activated by SA and repressed by JA. In order to elucidate the functions of AtCLH1 and WRKY70 in plant defense, stable transgenic lines were produced where these genes were overexpressed or silenced. Additionally, independent knockout lines were also characterized. Bacterial and fungal pathogens were then used to assess the contribution of these genes to the Arabidopsis disease resistance. The transcriptional modulation of AtCLH1 by either the constitutive over-expression or RNAi silencing caused alterations in the chlorophyll-to-chlorophyllide ratio, supporting the claim that chlorophyllase 1 has a role in the chlorophyll degradation pathway. Silencing of this gene led to light-dependent over-accumulation of the reactive oxygen species (ROS) in response to infection by Erwinia carotovora subsp. carotovora SCC1. This was followed by an enhanced induction of SA-dependent defense genes and an increased resistance to this pathogen. Interestingly, little effect on the pathogen-induced SA accumulation at the early infection was observed, suggesting that action of ROS might potentiate SA signaling. In contrast, the pathogen-induced JA production was significantly reduced in the RNAi silenced plants. Moreover, JA signaling and resistance to Alternaria brassicicola were impaired. These observations provide support for the argument that the ROS generated in chloroplasts might have a negative impact on JA signaling. The over-expression of WRKY70 resulted in an enhanced resistance to E. carotovora subsp. carotovora SCC1, Pseudomonas syringae pv. tomato DC3000 and Erysiphe cichoracearum UCSC1, whilst an antisense suppression or an insertional inactivation of WRKY70 led to a compromised resistance to E. carotovora subsp. carotovora SCC1 and to E. cichoracearum UCSC1 but not to P. syringae pv. tomato DC3000. Gene expression analysis revealed that WRKY70 activated many known defense-related genes associated with the SAR response but suppressed a subset of the JA-responsive genes. In particular, I was able to show that both the basal and the induced expression of AtCLH1 was enhanced by the antisense silencing or the insertional inactivation of WRKY70, whereas a reduction in AtCLH1 expression was observed in the WRKY70 over-expressors following an MeJA application or an A. brassicicola infection. Moreover, the SA-induced suppression of AtCLH1 was relieved in wrky70 mutants. These results indicate that WRKY70 down-regulates AtCLH1. An epistasis analysis suggested that WRKY70 functions downstream of the NPR1 in an SA-dependent signaling pathway. When challenged with A. brassicicola, WRKY70 over-expressing plants exhibited a compromised disease resistance while wrky70 mutants had the opposite effect. These results confirmed the WRKY70-mediated inhibitory effects on JA signaling. Furthermore, the WRKY70-controlled suppression of A. brassicicola resistance was mainly through an NPR1-dependent mechanism. Taking all the data together, I suggest that the pathogen-responsive transcription factor WRKY70 is a common component in both SA- and JA-dependent pathways and plays a crucial role in the SA-mediated suppression of JA signaling.
Resumo:
The relative amounts of chloroplast tRNAs(Leu), tRNA(Glu), tRNA(Phe), tRNAs(Thr), and tRNA(Tyr) and of chloroplastic and cytoplasmic aminoacyl-tRNA synthetases were compared in green leaves, yellowing senescing leaves, and N(6)-benzyladenine-treated senescing leaves from bean (Phaseolus vulgaris, var Contender). Aminoacylation of the tRNAs using Escherichia coli aminoacyl-tRNA synthetases indicated that in senescing leaves the relative amount of chloroplast tRNA(Phe) was significantly lower than in green leaves. Senescing leaves treated with N(6)-benzyladenine contained higher levels of this tRNA than untreated senescing leaves. No significant change in the relative amounts of chloroplast tRNAs(Leu), tRNAs(Thr), and tRNA(Tyr) was detected in green, yellow senescing, or N(6)-benzyladine-treated senescing leaves. Relative levels of chloroplast tRNAs were also estimated by hybridization of tRNAs to DNA blots of gene specific probes. These experiments confirmed the results obtained by aminoacylation and revealed in addition that the relative level of chloroplast tRNA(Glu) is higher in senescing leaves than in green leaves. Transcription run-on assays indicated that these changes in tRNA levels are likely to be due to a differential rate of degradation rather than to a differential rate of transcription of the tRNA genes. Chloroplastic and cytoplasmic leucyl-, phenylalanyl-, and tyrosyl-tRNA synthetase activities were greatly reduced in senescing leaves as compared to green leaves, whereas N(6)-benzyladenine-treated senescing leaves contained higher enzyme activities than untreated senescing leaves. These results suggest that during senescence, as well as during senescence-retardation by cytokinins, changes in enzyme activities, such as aminoacyl-tRNA synthetases, rather than reduced levels of tRNAs, affect the translational capacity of chloroplasts.
Resumo:
Peptides Possessing antibiotic activity isolated from microbial sources have been the subject of intensive structural and biological investigation over the past two decades. Perhaps, the discovery and widespread use of penicillin, a molecule biosynthetically derived from a tripeptide precursor, as a strong antibacterial agent, has provided the necessary impetus for the detailed study of microbial peptides. While many of these peptides have not been used clinically, They show unique metal binding properties and often possess the ability to modify the electrical properties or ion permeabilities of artificial lipid membranes. Hence, these peptides have been used extensively to study transmembrane ion transport processes in model and natural systems like mitochondria, chloroplasts and plasma membranes.
Resumo:
The effect of four phenoxy compounds [2,4-dichlorophenoxyacetic acid (2,4-D), 2,4,5-trichlorophenoxyacetic acid, 4-chlorophenoxyacetic acid 2-(dimethylamino)ethyl ester (centrophenoxine), and 4-chlorophenoxy ethyl 2-(dimethylamino) ethyl ether (neophenoxine)] on lipid metabolism in groundnut (Arachis hypogaea) leaves was investigated under nonphotosynthetic conditions. In experiments with leaf disks, the uptake of [1-14C]acetate, [32P]orthophosphate, [35S]sulfate and [methyl-14C]choline was substantially inhibited by all the phenoxy compounds except neophenoxine. When the incorporation of these precursors into lipids was measured and expressed as percentage of total uptake, there was significant inhibition of incorporation of [1-14C]acetate and [32P]orthophosphate into lipids by all the compounds except neophenoxine. The incorporation of [methyl-14C]choline was unaffected by all except centrophenoxine which showed stastically significant stimulation. [35S]Sulfate incorporation into lipids was markedly inhibited only by centrophenoxine. The fatty acid synthetase of isolated chloroplasts assayed in the absence of light was inhibited 20–50% by the phenoxy compounds at 0.5 mM concentration. This inhibition showed a dependence on time of preincubation with the herbicide suggesting an interaction with the enzyme. It was, however, reversible and excess substrate did not prevent the inhibition, suggesting that the herbicide interaction may not be at the active site. sn-Glycerol-3-phosphate acyltransferase in the chloroplast and microsomal fractions was inhibited by 2,4-D while the phosphatidic acid phosphatase was insensitive to all the phenoxy compounds. It is concluded that phenoxy compounds affect precursor uptake, their incorporation into lipids, and the chloroplast fatty acid synthetase. The free acids were the most potent compounds while the ester (centrophenoxine) was less effective and the ether (neophenoxine) was completely ineffective in their influence on lipid metabolism.
Resumo:
The effect of thiocarbamates (S-ethyldipropylthiocarbamate and diallate), substituted ureas (monuron and diuron), and uracils (bromacil and terbacil) on lipid metabolism in groundnut (Arachis hypogaea) leaves was investigated under nonphotosynthetic conditions. The uptake of [1-14C]acetate by leaf disks was inhibited by the thiocarbamates and marginally by the substituted ureas, but not by the uracil herbicides. The uptake of [methyl-14C]choline was inhibited to a lesser extent by thiocarbamates, while the other herbicides showed a slight stimulation. The thiocarbamates almost completely inhibited uptake of [32P]orthophosphate at 1.0 mM concentration, while diuron and terbacil showed significant inhibition. [1-14C]Acetate incorporation into lipids was inhibited only by diallate. [methyl-14C]Choline incorporation into the choline phosphoglycerides was inhibited by diallate, diuron, and bromacil. The incorporation of [32P]orthophosphate into phospholipids was substantially inhibited (over 90% at 1.0 mM) by the thiocarbamates, but not by the other herbicides. [35S]Sulfate incorporation into sulfoquinovosyl diglycerides was markedly inhibited only by the thiocarbamates. Fatty acid synthesis by isolated chloroplasts was inhibited 40–85% by thiocarbamates, substituted ureas, and bromacil, but not by terbacil. The inhibitory effect of the urea derivatives was reversible, but that of thiocarbamates was irreversible. sn-Glycerol-3-phosphate acyltransferase(s) of the chloroplast and microsomal fractions were profoundly inhibited by thiocarbamates, but not by the other two groups of herbicides. Phosphatidic acid phosphatase was insensitive to all the herbicides tested.