Gene Expression Noise in Spatial Patterning: hunchback Promoter Structure Affects Noise Amplitude and Distribution in Drosophila Segmentation

Positional information in developing embryos is specified by spatial gradients of transcriptional regulators. One of the classic systems for studying this is the activation of the hunchback (hb) gene in early fruit fly (Drosophila) segmentation by the maternally-derived gradient of the Bicoid (Bcd) protein. Gene regulation is subject to intrinsic noise which can produce variable expression. This variability must be constrained in the highly reproducible and coordinated events of development. We identify means by which noise is controlled during gene expression by characterizing the dependence of hb mRNA and protein output noise on hb promoter structure and transcriptional dynamics. We use a stochastic model of the hb promoter in which the number and strength of Bcd and Hb (self-regulatory) binding sites can be varied. Model parameters are fit to data from WT embryos, the self-regulation mutant hb(14F), and lacZ reporter constructs using different portions of the hb promoter. We have corroborated model noise predictions experimentally. The results indicate that WT (self-regulatory) Hb output noise is predominantly dependent on the transcription and translation dynamics of its own expression, rather than on Bcd fluctuations. The constructs and mutant, which lack self-regulation, indicate that the multiple Bcd binding sites in the hb promoter (and their strengths) also play a role in buffering noise. The model is robust to the variation in Bcd binding site number across a number of fly species. This study identifies particular ways in which promoter structure and regulatory dynamics reduce hb output noise. Insofar as many of these are common features of genes (e. g. multiple regulatory sites, cooperativity, self-feedback), the current results contribute to the general understanding of the reproducibility and determinacy of spatial patterning in early development.

Identification of the Schistosoma mansoni TNF-Alpha Receptor Gene and the Effect of Human TNF-Alpha on the Parasite Gene Expression Profile

Background: Schistosoma mansoni is the major causative agent of schistosomiasis. The parasite takes advantage of host signals to complete its development in the human body. Tumor necrosis factor-alpha (TNF-alpha) is a human cytokine involved in skin inflammatory responses, and although its effect on the adult parasite's metabolism and egg-laying process has been previously described, a comprehensive assessment of the TNF-alpha pathway and its downstream molecular effects is lacking. Methodology/Principal Findings: In the present work we describe a possible TNF-alpha receptor (TNFR) homolog gene in S. mansoni (SmTNFR). SmTNFR encodes a complete receptor sequence composed of 599 amino acids, and contains four cysteine-rich domains as described for TNFR members. Real-time RT-PCR experiments revealed that SmTNFR highest expression level is in cercariae, 3.5 (+/- 0.7) times higher than in adult worms. Downstream members of the known human TNF-alpha pathway were identified by an in silico analysis, revealing a possible TNF-alpha signaling pathway in the parasite. In order to simulate parasite's exposure to human cytokine during penetration of the skin, schistosomula were exposed to human TNF-alpha just 3 h after cercariae-to-schistosomula in vitro transformation, and large-scale gene expression measurements were performed with microarrays. A total of 548 genes with significantly altered expression were detected, when compared to control parasites. In addition, treatment of adult worms with TNF-alpha caused a significantly altered expression of 1857 genes. Interestingly, the set of genes altered in adults is different from that of schistosomula, with 58 genes in common, representing 3% of altered genes in adults and 11% in 3 h-old early schistosomula. Conclusions/Significance: We describe the possible molecular elements and targets involved in human TNF-alpha effect on S. mansoni, highlighting the mechanism by which recently transformed schistosomula may sense and respond to this host mediator at the site of cercarial penetration into the skin.

Cloning, expression, molecular modelling and docking analysis of glutathione transferase from Saccharum officinarum

Sugarcane yield and quality are affected by a number of biotic and abiotic stresses. In response to such stresses, plants may increase the activities of some enzymes such as glutathione transferase (GST), which are involved in the detoxification of xenobiotics. Thus, a sugarcane GST was modelled and molecular docked using the program LIGIN to investigate the contributions of the active site residues towards the binding of reduced glutathione (GSH) and 1-chloro-2,4-dinitrobenzene (CDNB). As a result, W13 and I119 were identified as key residues for the specificity of sugarcane GSTF1 (SoGSTF1) towards CDNB. To obtain a better understanding of the catalytic specificity of sugarcane GST (SoGSTF1), two mutants were designed, W13L and I119F. Tertiary structure models and the same docking procedure were performed to explain the interactions between sugarcane GSTs with GSH and CDNB. An electron-sharing network for GSH interaction was also proposed. The SoGSTF1 and the mutated gene constructions were cloned and expressed in Escherichia coli and the expressed protein purified. Kinetic analyses revealed different Km values not only for CDNB, but also for GSH. The Km values were 0.2, 1.3 and 0.3 mM for GSH, and 0.9, 1.2 and 0.5 mM for CDNB, for the wild type, W13L mutant and I119F mutant, respectively. The V(max) values were 297.6, 224.5 and 171.8 mu mol min(-1) mg(-1) protein for GSH, and 372.3, 170.6 and 160.4 mu mol min(-1) mg(-1) protein for CDNB.

A conserved dibasic site is essential for correct processing of the peptide hormone AtRALF1 in Arabidopsis thaliana

Prohormone proteins in animals and yeast are typically processed at dibasic sites by convertases. Propeptide hormones are also found in plants but little is known about processing. We show for the first time that a dibasic site upstream of a plant peptide hormone, AtRALF1, is essential for processing. Overexpression of preproAtRALF1 causes semidwarfism whereas overexpression of preproAtRALF1(R69A), the propeptide with a mutation in the dibasic site, shows a normal phenotype. RALF1(R69A) plants accumulate only the mutated proprotein and not the processed peptide. In vitro processing using microsomal fractions suggests that processing is carried out by a kexin-like convertase. (C) 2008 Federation of European Biochemical Societies. Published by Elsevier B. V. All rights reserved.

Binding of YY1 and Oct1 to a novel element that downregulates expression of IL-5 in human T cells

Background: IL-5 controls development of eosinophilia and has been shown to be involved in the pathogenesis of allergic diseases. In both atopic and nonatopic asthma, elevated IL-5 has been detected in peripheral blood and the airways. IL-5 is produced mainly by activated T cells, and its expression is regulated at the transcriptional level. Objective: This study focuses on the functional analysis of the human IL-5 (hIL-5) promoter and characterization of eis-regulatory elements and transcription factors involved in the suppression of IL-5 transcription in T cells. Methods: Methods used in this study include DNase I footprint assays, electrophoretic mobility shift assays, and functional analysis by mammalian cell transfection involving deletion analysis and site-directed mutagenesis. Results: We identified 5 protein binding regions (BRs) located within the proximal hIL-5 promoter. Functional analysis indicates that the BRs are involved in control of hIL-5 promoter activity. Two of these regions, BR3 and BR4 located at positions -102 to -73, have not previously been described as regulators of IL-5 expression in T cells. We show that the BR3 sequence contains a novel negative regulatory element located at positions -90 to -79 of the hIL-5 promoter, which binds Oct1, octamer-like, and YY1 nuclear factors. Substitution mutations, which abolished binding of these proteins to the BR3 sequence, significantly increased hIL-5 promoter activity in activated T cells. Conclusion: We suggest that Oct1, YY1, and octamer-like factors binding to the -90/-79 sequence within the proximal IL-5 promoter are involved in suppression of IL-5 transcription in T cells.

Development of P2 olfactory glomeruli in P2-internal ribosome entry site-tau-lacZ transgenic mice

Primary olfactory neurons project their axons to the olfactory bulb, where they terminate in discrete loci called glomeruli. All neurons expressing the same odorant receptor appear to terminate in a few glomeruli in each olfactory bulb. In the P2-IRES-tau-LacZ line of transgenic mice, LacZ is expressed in the perikarya and axons of primary olfactory neurons that express the P2 odorant receptor. In the present study, we examined the developmental appearance of P2 neurons, the topographical targeting of P2 axons, as well as the formation of P2 glomeruli in the olfactory bulb. P2 axons were first detected in the olfactory nerve fiber layer at embryonic day 14.5 (E14.5), and by E15.5 these axons terminated in a broad locus in the presumptive glomerular layer. During the next 5 embryonic days, the elongated cluster of axons developed into discrete glomerulus-like structures. In many cases, glomeruli appeared as pairs, which were initially connected by a fascicle of P2 axons. This connection was lost by postnatal day 7.5, and double glomeruli at the same locus were observed in 85% of adult animals. During the early postnatal period, there was considerable mistargeting of P2 axons. In some cases P2 axons entered inappropriate glomeruli or continued to grow past the glomerular layer into the deeper layers of the olfactory bulb. These aberrant axons were not observed in adult animals. These results indicate that olfactory axons exhibit errors while converging onto a specific glomerulus and suggest that guidance cues may be diffusely distributed at target sites in the olfactory bulb.

Functional analysis, using in vitro mutagenesis, of amino acids located in the phenylalanine hydroxylase active site

The 3-dimensionaI structure determination of rat phenylalanine hydroxylase (PAH) has identified potentially important amino acids lining the active site cleft with the majority of these having hydrophobic side-chains including several with aromatic side chains. Here we have analyzed the effect on rat PAH enzyme kinetics of in vitro mutagenesis of a number of these amino acids lining the PAH active site. Mutation of F299, Y324, F331, and Y343 caused a significant decrease in enzyme activity but no change in the K-m for substrate or cofactor. me conclude that these aromatic residues are essential for activity but are not significantly involved in binding of the substrate or cofactor. in contrast the PAH mutant, S349T, showed an 18-fold increase in K-m for phenylalanine, showing the first functional evidence that this residue was binding at or near the phenylalanine binding site. This confirms the recently published model for the binding of phenylalanine to the PAH active site that postulated S349 interacts with the amino group on the main chain of the phenylalanine molecule. This result differs with that found for the equivalent mutation (S395T), in the closely related tyrosine hydroxylase, which had no effect on substrate K-m, showing that while the architecture of the two active sites are very similar the amino acids that bind to the respective substrates are different. (C) 2000 Academic Press.

Using biplots to interpret gene expression patterns in plants

Sum: Plant biologists in fields of ecology, evolution, genetics and breeding frequently use multivariate methods. This paper illustrates Principal Component Analysis (PCA) and Gabriel's biplot as applied to microarray expression data from plant pathology experiments. Availability: An example program in the publicly distributed statistical language R is available from the web site (www.tpp.uq.edu.au) and by e-mail from the contact. Contact: scott.chapman@csiro.au.

Quantification of prolactin-releasing peptide (PrRP) mRNA expression in specific brain regions of the rat during the oestrous cycle and in lactation

Real-time Taqman(TM) RT-PCR was used to make quantitative comparisons of the levels of PrRP mRNA expression in micropunch brain samples from rats at different stages of the oestrous cycle and in lactation. The nucleus of the solitary tract and ventrolateral reticular nuclei of the medulla oblongata contained significantly (P < 0.05) greater levels of PrRP mRNA than any hypothalamic region. Within the hypothalamus, the highest level of PrRP expression was localised to the dorsomedial aspect of the ventromedial hypothalamus. All other hypothalamic regions exhibited significantly (P < 0.05) lower levels of expression, including the rostral and caudal dorsomedial hypothalamus. Very low levels of PrRP expression were observed in the arcuate nucleus, paraventricular nucleus, medial preoptic nucleus and ventrolateral aspect of the ventromedial hypothalamus. No significant changes in PrRP expression were noted in any sampled region between proestrus, oestrus or dioestrus. Similarly, PrRP expression in hypothalamic regions did not differ between lactating and non-lactating (dioestrous) animals. During validation of RT-PCR techniques we cloned and sequenced a novel splice variant of PrRP from the hypothalamus. This variant arises from alternative splicing of the donor site within exon 2, resulting in an insert of 64 base pairs and shift in the-codon:reading frame with the introduction of an early stop codon. In the hypothalamus and brainstem, mRNA expression of the variant was restricted to regions that expressed PrRP. These results suggest that PrRP expression in the hypothalamus may be more Widespread than previously reported. However, the relatively low level of PrRP in the hypothalamus and the lack of significant changes in expression during the oestrous cycle and lactation provides further evidence that PrRP is unlikely to be involved in the regulation of prolactin, secretion. (C) 2003 Elsevier Science B.V. All rights reserved.

Proteasomal degradation of N-acetyltransferase 1 is prevented by acetylation of the active site cysteine - A mechanism for the slow acetylator phenotype and substrate-dependent down-regulation

Many drugs and chemicals found in the environment are either detoxified by N-acetyltransferase 1 (NAT1, EC 2.3.1.5) and eliminated from the body or bioactivated to metabolites that have the potential to cause toxicity and/or cancer. NAT1 activity in the body is regulated by genetic polymorphisms as well as environmental factors such as substrate-dependent down-regulation and oxidative stress. Here we report the molecular mechanism for the low protein expression from mutant NAT1 alleles that gives rise to the slow acetylator phenotype and show that a similar process accounts for enzyme down-regulation by NAT1 substrates. NAT1 allozymes NAT1 14, NAT1 15, NAT1 17, and NAT1 22 are devoid of enzyme activity and have short intracellular half-lives (similar to4 h) compared with wild-type NAT1 4 and the active allozyme NAT1 24. The inactive allozymes are unable to be acetylated by cofactor, resulting in ubiquitination and rapid degradation by the 26 S proteasome. This was confirmed by site-directed mutagenesis of the active site cysteine 68. The NAT1 substrate p-aminobenzoic acid induced ubiquitination of the usually stable NAT1 4, leading to its rapid degradation. From this study, we conclude that NAT1 exists in the cell in either a stable acetylated state or an unstable non-acetylated state and that mutations in the NAT1 gene that prevent protein acetylation produce a slow acetylator phenotype.

Folate-sensitive fragile site FRA10A is due to an expansion of a CGG repeat in a novel gene, FRA10AC1, encoding a nuclear protein

Fragile sites appear visually as nonstaining gaps on chromosomes that are inducible by specific cell culture conditions. Expansion of CGG/ CCG repeats has been shown to be the molecular basis of all five folate-sensitive fragile sites characterized molecularly so far, i.e., FRAXA, FRAXE, FRAXF, FRA11B, and FRA16A. In the present study we have refined the localization of the FRA10A folate-sensitive fragile site by fluorescence in situ hybridization. Sequence analysis of a BAC clone spanning FRA10A identified a single, imperfect, but polymorphic CGG repeat that is part of a CpG island in the 5'UTR of a novel gene named FRA10ACl. The number of CGG repeats varied in the population from 8 to 13. Expansions exceeding 200 repeat units were methylated in all FRA10A fragile site carriers tested. The FRA10ACl gene consists of 19 exons and is transcribed in the centromeric direction from the FRA10A repeat. The major transcript of similar to 1450 nt is ubiquitously expressed and codes for a highly conserved protein, FRA10ACl, of unknown function. Several splice variants leading to alternative 3' ends were identified (particularly in testis). These give rise to FRA10ACl proteins with altered COOH-termini. Immunofluorescence analysis of full-length, recombinant EGFP-tagged FRA10ACl protein showed that it was present exclusively in the nucleoplasm. We show that the expression of FRA10A, in parallel to the other cloned folate-sensitive fragile sites, is caused by an expansion and subsequent methylation of an unstable CGG trinucleotide repeat. Taking advantage of three cSNPs within the FRA10ACl gene we demonstrate that one allele of the gene is not transcribed in a FRA10A carrier. Our data also suggest that in the heterozygous state FRA10A is likely a benign folate-sensitive fragile site. (C) 2004 Elsevier Inc. All rights reserved.

Regulation of CSF-1 receptor expression

Cells of the mononuclear phagocyte lineage possess receptors for macrophage colony-stimulating factor (CSF-1) encoded by the c-fms protooncogene and respond to CSF-1 with increased survival, growth, differentiation, and reversible changes in function. The c-fms gene is itself a macrophage differentiation marker. In whole mount analyses of mRNA expression in embryos, c-fms is expressed at very high levels on placental trophoblasts. It is detectable on individual cells in the yolk sac around 8.5 to 9 days postcoitus, appears on isolated cells in the head of the embryo around 9.5 dpc, and appears on numerous cells throughout the embryo by day 10.5. The extent of c-fms expression is much greater than for other macrophage-specific genes including lysozyme and a macrophage-specific protein tyrosine phosphatase. Our studies of the cis-acting elements of the c-fms promoter have indicated a key role for collaboration between the macrophage-specific transcription factor, Pu.1, which functions in determining the site of transcription initiation, and other members of the Ets transcription factor family. This is emerging as a common pattern in macrophage-specific promoters. We have shown that two PU box elements alone can function as a macrophage-specific promoter. The activity of both the artifical promoter and the c-fms promoter is activated synergistically by coexpression of Pu.1 and another Ets factor, c-Ets-2. A 3.5kb c-fms exon 2 promoter (but not the 300bp proximal promoter) is also active in a wide diversity of tumor cell lines. The interesting exception is the melanoma cell line K1735, in which the promoter is completely shut down and expression of c-fms causes growth arrest and cell death. The activity of the exon 2 promoter in these nonmacrophages is at least as serum responsive as the classic serum-responsive promoter of the c-fos gene. It is further inducible in nonmacrophages by coexpression of the c-fms product. Unlike other CSF-1/c-fms-responsive promoters, the c-fms promoter is not responsive to activated Ras even when c-Ets-2 is coexpressed. In most lines, production of full length c-fms is prevented by a downstream intronic terminator, but in Lewis lung carcinoma, read-through does occur, and expression of both c-fms and other macrophage-specific genes such as lysozyme and urokinase becomes detectable in conditions of serum deprivation. (C) 1997 Wiley-Liss, Inc.

Human chromosomal fragile site FRA16B is an amplified AT-rich minisatellite repeat

Fragile sites are nonstaining gaps in chromosomes induced by specific tissue culture conditions. They vary both in population frequency and in the culture conditions required for induction. Folate-sensitive fragile sites are due to expansion of p(CCG)(n) trinucleotide repeats; however, the relationship between sequence composition and the chemistry of induction of fragile sites is unclear. To clarify this relationship, the distamycin A-sensitive fragile site FRA16B was isolated by positional cloning and found to be an expanded 33 bp AT-rich minisatellite repeat, p(ATATATTATATATTATATCTAATAATATAT(C)/(A)TA)(n) (consistent with DNA sequence binding preferences of chemicals that induce its cytogenetic expression). Therefore the mutation mechanism associated with trinucleotide repeats is also a property of minisatellite repeats (variable number tandem repeats).

Coordinated expression of galectin-3 and galectin-3-binding sites in malignant mammary tumors: implications for tumor metastasis

Galectin-3 is a glycan-binding protein that mediates cell-cell and/or cell-extracellular matrix (ECM) interactions. Although galectin-3 is implicated in the progression of various types of cancers, the mechanisms by which galectin-3 enhances metastasis remain unclear. In order to elucidate the role of galectin-3 in the complex multistage process of cancer metastasis, we examined galectin-3 and galectin-3-binding site expression in a series of 82 spontaneous canine mammary tumors (CMT) and two CMT cell lines. Benign CMT tumors exhibited strong nuclear/cytoplasmic galectin-3 immunostaining, whereas malignant CMT tumors and metastases exhibited dramatically decreased galectin-3 expression with the majority of the immunostaining confined to the cytoplasm. Interestingly, intravascular tumor cells overexpressed galectin-3 regardless of their location. CMT-U27 xenografts displayed the same pattern of galectin-3 expression found in spontaneous malignant CMT. In parallel with the downregulation of galectin-3, malignant CMT displayed an overall loss of galectin-3-binding sites in the ECM and focal expression of galectin-3-binding sites mainly detected in intravascular tumor cells and endothelium. Furthermore, loss of galectin-3-binding sites was correlated with the downregulation of GLT25D1, a beta (1-O) galactosyltransferase that modifies collagen, and upregulation of stromal galectin-1. Finally, GLT25D1 mRNA expression was strikingly downregulated in malignant CMT-U27 compared with the benign cell line, and its expression was further de-creased in a galectin-3 knockdown CMT-U27 cell line. We therefore hypothesized that the loss of galectin-3-binding sites in the ECM in conjunction with the overexpression of galectin-3 in specific tumor cell subpopulations are crucial events for the development of mammary tumor metastases.

Mucinous colorectal adenocarcinoma: influence of mucin expression (Muc1, 2 and 5) on clinico-pathological features and prognosis

Background Mucinous component is associated with distinct clinical and pathological features and poor survival in colorectal cancer. The purpose of this study was to determine differences in outcomes of patients with mucinous colorectal adenocarcinoma according to the type of mucin expressed. Materials and Methods Immunohistochemistry was performed in all tumors of patients who underwent radical surgery between 1998 and 2003 with mucinous colorectal cancer using antibodies against MUC1, 2, and 5. Correlation between immunoexpression and clinical, pathological features and survival was performed. Results Of the 418 patients treated in this period, only 35 had a mucinous adenocarcinoma. Of these, 25 were positive for 1 or more mucin expression. MUC2 expression correlated with tumor site and depth of penetration, while MUC5 expression correlated to tumor site. Overall survival was significantly worse for patients with MUC2 expression, and disease-free survival was significantly worse for patients with MUC1 expression. Conclusions Mucin expression may have significant correlation to specific clinical-pathological features and survival of patients with mucinous-type colorectal adenocarcinoma. These differences may reflect distinct molecular mechanisms involved in carcinogenesis of mucinous colorectal adenocarcinoma.