956 resultados para Triplet repeat expansion
Resumo:
Myotonic dystrophy Type 1 (DM-1) is caused by abnormal expansion of a (CTG) repeat located in the DM protein kinase gene. Respiratory problems have long been recognized to be a major feature of this disorder. Because respiratory failure can be associated with dysfunction of phrenic nerves and diaphragm muscle, we examined the diaphragm and respiratory neural network in transgenic mice carrying the human genomic DM-1 region with expanded repeats of more than 300 CTG, a valid model of the human disease. Morphologic and morphometric analyses revealed distal denervation of diaphragm neuromuscular junctions in DM-1 transgenic mice indicated by a decrease in the size and shape complexity of end-plates and a reduction in the concentration of acetyl choline receptors on the postsynaptic membrane. More importantly, there was a significant reduction in numbers of unmyelinated, but not of myelinated, fibers in DM-1 phrenic nerves; no morphologic alternations of the nerves or loss of neuronal cells were detected in medullary respiratory centers or cervical phrenic motor neurons. Because neuromuscular junctions are involved in action potential transmission and the afferent phrenic unmyelinated fibers control the inspiratory activity, our results suggest that the respiratory impairment associated with DM-1 may be partially due to pathologic alterations in neuromuscular junctions and phrenic nerves.
Resumo:
BACKGROUND: Fragile X-associated tremor/ataxia syndrome (FXTAS) is an inherited late-onset neurodegenerative disorder, characterized both by neurological and cognitive deficits. It is caused by the expansion of CGG repeats (55 to 200 repeats) in the noncoding region of the fragile X mental retardation 1 (FMR1) gene. Abnormal immunological patterns are often associated with neurodegenerative disorders and implicated in their etiology. We therefore investigated the immune status of FXTAS patients, which had not been assessed prior to this study. METHOD: Peripheral blood mononuclear cells (PBMCs) were collected from 15 asymptomatic FMR1 premutation carriers and 20 age-matched controls. Concentrations of three cytokines (IL-6, IL-8, IL-10) were measured in PBMC supernatants using ELISA assays. RESULTS: We found a significant increase in the concentration of the major anti-inflammatory cytokine IL-10 in supernatants of PBMCs derived from premutation carriers, when compared with controls (P = 0.019). This increase correlated significantly with the number of CGG repeats (P = 0.002). CONCLUSIONS: Elevated IL-10 levels were observed in all premutation carriers, before appearance of the classical neurological symptoms; therefore, IL-10 may be one of the early biomarkers of FXTAS.
Resumo:
Low-complexity regions (LCRs) in proteins are tracts that are highly enriched in one or a few aminoacids. Given their high abundance, and their capacity to expand in relatively short periods of time through replication slippage, they can greatly contribute to increase protein sequence space and generate novel protein functions. However, little is known about the global impact of LCRs on protein evolution. We have traced back the evolutionary history of 2,802 LCRs from a large set of homologous protein families from H.sapiens, M.musculus, G.gallus, D.rerio and C.intestinalis. Transcriptional factors and other regulatory functions are overrepresented in proteins containing LCRs. We have found that the gain of novel LCRs is frequently associated with repeat expansion whereas the loss of LCRs is more often due to accumulation of amino acid substitutions as opposed to deletions. This dichotomy results in net protein sequence gain over time. We have detected a significant increase in the rate of accumulation of novel LCRs in the ancestral Amniota and mammalian branches, and a reduction in the chicken branch. Alanine and/or glycine-rich LCRs are overrepresented in recently emerged LCR sets from all branches, suggesting that their expansion is better tolerated than for other LCR types. LCRs enriched in positively charged amino acids show the contrary pattern, indicating an important effect of purifying selection in their maintenance. We have performed the first large-scale study on the evolutionary dynamics of LCRs in protein families. The study has shown that the composition of an LCR is an important determinant of its evolutionary pattern.
Resumo:
Huntington's disease is a rare neurodegenerative disease caused by a pathologic CAG expansion in the exon 1 of the huntingtin (HTT) gene. Aggregation and abnormal function of the mutant HTT (mHTT) cause motor, cognitive and psychiatric symptoms in patients, which lead to death in 15-20 years. Currently, there is no treatment for HD. Experimental approaches based on drug, cell or gene therapy are developed and reach progressively to the clinic. Among them, mHTT silencing using small non-coding nucleic acids display important physiopathological benefit in HD experimental models.
Resumo:
Le syndrome du X fragile (SXF) est la première cause héréditaire de déficience intellectuelle et également la première cause monogénique d’autisme. Le SXF est causé par l'expansion de la répétition du nucléotide CGG sur le gène FMR1, ce qui empêche l’expression de la protéine FMRP. L’absence du FMRP mène à une altération du développement structurel et fonctionnel de la synapse, ce qui empêche la maturation des synapses induite par l’activité et l’élagage synaptique, qui sont essentiels pour le développement cérébral et cognitif. Nous avons investigué les potentiels reliés aux événements (PRE) évoqués par des stimulations fondamentales auditives et visuelles dans douze adolescents et jeunes adultes (10-22) atteints du SXF, ainsi que des participants contrôles appariés en âge chronologique et développemental. Les résultats indiquent un profil des PRE altéré, notamment l’augmentation de l’amplitude de N1 auditive, par rapport aux deux groupes contrôle, ainsi que l’augmentation des amplitudes de P2 et N2 auditifs et de la latence de N2 auditif. Chez les patients SXF, le traitement sensoriel semble être davantage perturbé qu’immature. En outre, la modalité auditive semble être plus perturbée que la modalité visuelle. En combinaison avec des résultats anatomique du cerveau, des mécanismes biochimiques et du comportement, nos résultats suggèrent une hyperexcitabilité du système nerveux dans le SXF.
Resumo:
The cause of Huntington disease (HD) is a polyglutamine repeat expansion of more than 36 units in the huntingtin protein, which is inversely correlated with the age at onset of the disease. However, additional genetic factors are believed to modify the course and the age at onset of HD. Recently, we identified the V471A polymorphism in the autophagy-related gene ATG7, a key component of the autophagy pathway that plays an important role in HD pathogenesis, to be associated with the age at onset in a large group of European Huntington disease patients. To confirm this association in a second independent patient cohort, we analysed the ATG7 V471A polymorphism in additional 1,464 European HD patients of the "REGISTRY" cohort from the European Huntington Disease Network (EHDN). In the entire REGISTRY cohort we could not confirm a modifying effect of the ATG7 V471A polymorphism. However, analysing a modifying effect of ATG7 in these REGISTRY patients and in patients of our previous HD cohort according to their ethnic origin, we identified a significant effect of the ATG7 V471A polymorphism on the HD age at onset only in the Italian population (327 patients). In these Italian patients, the polymorphism is associated with a 6-years earlier disease onset and thus seems to have an aggravating effect. We could specify the role of ATG7 as a genetic modifier for HD particularly in the Italian population. This result affirms the modifying influence of the autophagic pathway on the course of HD, but also suggests population-specific modifying mechanisms in HD pathogenesis.
Resumo:
There are many diseases associated with the expansion of DNA repeats in humans. Myotonic dystrophy type 2 is one of such diseases, characterized by expansions of a (CCTG)•(CAGG) repeat tract in intron 1 of zinc finger protein 9 (ZNF9) in chromosome 3q21.3. The DM2 repeat tract contains a flanking region 5' to the tract that consists of a polymorphic repetitive sequence (TG)14-25(TCTG)4-11(CCTG) n. The (CCTG)•(CAGG) repeat is typically 11-26 repeats in persons without the disease, but can expand up to 11,000 repeats in affected individuals, which is the largest expansion seen in DNA repeat diseases to date. This DNA tract remains one of the least characterized disease-associated DNA repeats, and mechanisms causing the repeat expansion in humans have yet to be elucidated. Alternative, non B-DNA structures formed by the expanded repeats are typical in DNA repeat expansion diseases. These sequences may promote instability of the repeat tracts. I determined that slipped strand structure formation occurs for (CCTG)•(CAGG) repeats at a length of 42 or more. In addition, Z-DNA structure forms in the flanking human sequence adjacent to the (CCTG)•(CAGG) repeat tract. I have also performed genetic assays in E. coli cells and results indicate that the (CCTG)•(CAGG) repeats are more similar to the highly unstable (CTG)•(CAG) repeat tracts seen in Huntington's disease and myotonic dystrophy type 1, than to those of the more stable (ATTCT)•(AGAAT) repeat tracts of spinocerebellar ataxia type 10. This instability, however, is RecA-independent in the (CCTG)•(CAGG) and (ATTCT)•(AGAAT) repeats, whereas the instability is RecA-dependent in the (CTG)•(CAG) repeats. Structural studies of the (CCTG)•(CAGG) repeat tract and the flanking sequence, as well as genetic selection assays may reveal the mechanisms responsible for the repeat instability in E. coli, and this may lead to a better understanding of the mechanisms contributing to the human disease state. ^
Resumo:
The Huntington disease (HD) phenotype is associated with expansion of a trinucleotide repeat in the IT15 gene, which is predicted to encode a 348-kDa protein named huntington. We used polyclonal and monoclonal anti-fusion protein antibodies to identify native huntingtin in rat, monkey, and human. Western blots revealed a protein with the expected molecular weight which is present in the soluble fraction of rat and monkey brain tissues and lymphoblastoid cells from control cases. In lymphoblastoid cell lines from juvenile-onset heterozygote HD cases, both normal and mutant huntingtin are expressed, and increasing repeat expansion leads to lower levels of the mutant protein. Immunocytochemistry indicates that huntingtin is located in neurons throughout the brain, with the highest levels evident in larger neurons. In the human striatum, huntingtin is enriched in a patch-like distribution, potentially corresponding to the first areas affected in HD. Subcellular localization of huntingtin is consistent with a cytosolic protein primarily found in somatodendritic regions. Huntingtin appears to particularly associate with microtubules, although some is also associated with synaptic vesicles. On the basis of the localization of huntingtin in association with microtubules, we speculate that the mutation impairs the cytoskeletal anchoring or transport of mitochondria, vesicles, or other organelles or molecules.
Resumo:
The advent of novel biological therapies for the treatment of rheumatic disease has renewed interest in the seronegative spondyloarthropathies (SpAs). International efforts are redefining disease classification and measures of disease activity, outcome, metrology, and imaging. However, opinion is divided between those who propose that the SpA group represents the same disease with variable expression (the lumpers) and those who consider these to be separate diseases with shared clinical features (the splitters). This review presents the evidence for both approaches.
Resumo:
La Sclérose Latérale Amyotrophique (SLA) est une maladie neurodégénérative qui affecte les neurones moteurs. 10% des cas sont des cas familiaux et l’étude de ces familles a mené à la découverte de plusieurs gènes pouvant causer la SLA, incluant SOD1, TARDBP et FUS. L’expansion de la répétition GGGGCC dans le gène C9orf72 est, à ce jour, la cause la plus connue de SLA. L’impact de cette expansion est encore méconnu et il reste à déterminer si la toxicité est causée par un gain de fonction, une perte de fonction ou les deux. Plusieurs gènes impliqués dans la SLA sont conservés entre le nématode Caenorhabditis elegans et l’humain. C. elegans est un vers transparent fréquemment utilisé pour des études anatomiques, comportementales et génétiques. Il possède une lignée cellulaire invariable qui inclue 302 neurones. Aussi, les mécanismes de réponse au stress ainsi que les mécanismes de vieillissement sont très bien conservés entre ce nématode et l’humain. Donc, notre groupe, et plusieurs autres, ont utilisé C. elegans pour étudier plusieurs aspects de la SLA. Pour mieux comprendre la toxicité causée par l’expansion GGGGCC de C9orf72, nous avons développé deux modèles de vers pour étudier l’impact d’une perte de fonction ainsi que d’un gain de toxicité de l’ARN. Pour voir les conséquences d’une perte de fonction, nous avons étudié l’orthologue de C9orf72 dans C. elegans, alfa-1 (ALS/FTD associated gene homolog). Les vers mutants alfa-1(ok3062) développent des problèmes moteurs causant une paralysie et une dégénérescence spécifique des neurones moteurs GABAergiques. De plus, les mutants sont sensibles au stress osmotique qui provoque une dégénérescence. D’autre part, l’expression de la séquence d’ARN contenant une répétition pathogénique GGGGCC cause aussi des problèmes moteurs et de la dégénérescence affectant les neurones moteurs. Nos résultats suggèrent donc qu’un gain de toxicité de l’ARN ainsi qu’une perte de fonction de C9orf72 sont donc toxiques pour les neurones. Puisque le mouvement du vers peut être rapidement évalué en cultivant les vers dans un milieu liquide, nous avons développé un criblage de molécules pouvant affecter le mouvement des vers mutants alfa-1 en culture liquide. Plus de 4 000 composés ont été évalués et 80 ameliore la mobilité des vers alfa-1. Onze molécules ont aussi été testées dans les vers exprimant l’expansion GGGGCC et huit diminuent aussi le phénotype moteur de ces vers. Finalement, des huit molécules qui diminent la toxicité causée par la perte de fonction de C9orf72 et la toxicité de l’ARN, deux restaurent aussi l’expression anormale de plusieurs transcrits d’ARN observée dans des cellules dérivées de patient C9orf72. Avec ce projet, nous voulons identifier des molécules pouvant affecter tous les modes de toxicité de C9orf72 et possiblement ouvrir de nouvelles avenues thérapeutiques
Resumo:
La Sclérose Latérale Amyotrophique (SLA) est une maladie neurodégénérative qui affecte les neurones moteurs. 10% des cas sont des cas familiaux et l’étude de ces familles a mené à la découverte de plusieurs gènes pouvant causer la SLA, incluant SOD1, TARDBP et FUS. L’expansion de la répétition GGGGCC dans le gène C9orf72 est, à ce jour, la cause la plus connue de SLA. L’impact de cette expansion est encore méconnu et il reste à déterminer si la toxicité est causée par un gain de fonction, une perte de fonction ou les deux. Plusieurs gènes impliqués dans la SLA sont conservés entre le nématode Caenorhabditis elegans et l’humain. C. elegans est un vers transparent fréquemment utilisé pour des études anatomiques, comportementales et génétiques. Il possède une lignée cellulaire invariable qui inclue 302 neurones. Aussi, les mécanismes de réponse au stress ainsi que les mécanismes de vieillissement sont très bien conservés entre ce nématode et l’humain. Donc, notre groupe, et plusieurs autres, ont utilisé C. elegans pour étudier plusieurs aspects de la SLA. Pour mieux comprendre la toxicité causée par l’expansion GGGGCC de C9orf72, nous avons développé deux modèles de vers pour étudier l’impact d’une perte de fonction ainsi que d’un gain de toxicité de l’ARN. Pour voir les conséquences d’une perte de fonction, nous avons étudié l’orthologue de C9orf72 dans C. elegans, alfa-1 (ALS/FTD associated gene homolog). Les vers mutants alfa-1(ok3062) développent des problèmes moteurs causant une paralysie et une dégénérescence spécifique des neurones moteurs GABAergiques. De plus, les mutants sont sensibles au stress osmotique qui provoque une dégénérescence. D’autre part, l’expression de la séquence d’ARN contenant une répétition pathogénique GGGGCC cause aussi des problèmes moteurs et de la dégénérescence affectant les neurones moteurs. Nos résultats suggèrent donc qu’un gain de toxicité de l’ARN ainsi qu’une perte de fonction de C9orf72 sont donc toxiques pour les neurones. Puisque le mouvement du vers peut être rapidement évalué en cultivant les vers dans un milieu liquide, nous avons développé un criblage de molécules pouvant affecter le mouvement des vers mutants alfa-1 en culture liquide. Plus de 4 000 composés ont été évalués et 80 ameliore la mobilité des vers alfa-1. Onze molécules ont aussi été testées dans les vers exprimant l’expansion GGGGCC et huit diminuent aussi le phénotype moteur de ces vers. Finalement, des huit molécules qui diminent la toxicité causée par la perte de fonction de C9orf72 et la toxicité de l’ARN, deux restaurent aussi l’expression anormale de plusieurs transcrits d’ARN observée dans des cellules dérivées de patient C9orf72. Avec ce projet, nous voulons identifier des molécules pouvant affecter tous les modes de toxicité de C9orf72 et possiblement ouvrir de nouvelles avenues thérapeutiques
Resumo:
Background: Friedreich ataxia (FRDA) is a progressive inherited neurodegenerative disorder caused by mutation of the FXN gene, resulting in decreased frataxin expression, mitochondrial dysfunction and oxidative stress. A recent study has identified shorter telomeres in FRDA patient leukocytes as a possible disease biomarker. Results: Here we aimed to investigate both telomere structure and function in FRDA cells. Our results confirmed telomere shortening in FRDA patient leukocytes and identified similar telomere shortening in FRDA patient autopsy cerebellar tissues. However, FRDA fibroblasts showed significantly longer telomeres at early passage, occurring in the absence of telomerase activity, but with activation of an alternative lengthening of telomeres (ALT)-like mechanism. These cells also showed accelerated telomere shortening as population doubling increases. Furthermore, telomere dysfunction-induced foci (TIF) analysis revealed that FRDA fibroblasts have dysfunctional telomeres. Conclusions: Our finding of dysfunctional telomeres in FRDA cells provides further insight into FRDA molecular disease mechanisms, which may have implications for future FRDA therapy.
Resumo:
Expansion of a CTG trinucleotide repeat in the 3′ untranslated region (UTR) of DMPK, the gene encoding myotonic dystrophy protein kinase, induces the dominantly inherited neuromuscular disorder myotonic dystrophy (DM). Transcripts containing the expanded trinucleotide are abundant in differentiated cultured myoblasts, and they are spliced and polyadenylylated normally. However, mutant transcripts never reach the cytoplasm in these nonmitotic cells; instead, they form stable clusters that are tightly linked to the nuclear matrix, which can prevent effective biochemical purification of these transcripts. In DM patients, reduced DMPK protein levels, consequent to nuclear retention of mutant transcripts, are probably a cause of disease development. Formation of nuclear foci is a novel mechanism for preventing transcript export and effecting a loss of gene function.
Resumo:
Huntington's disease (HD) is an inherited neurodegenerative disorder associated with expansion of a CAG repeat in the IT15 gene. The IT15 gene is translated to a protein product termed huntingtin that contains a polyglutamine (polyGln) tract. Recent investigations indicate that the cause of HD is expansion of the polyGln tract. However, the function of huntingtin and how the expanded polyGln tract causes HD is not known. We investigate potential protein-protein interactions of huntingtin using affinity resins. Huntingtin from brain extracts is retained on calmodulin(CAM)-Sepharose in a calcium-dependent fashion. We purify rat huntingtin to apparent homogeneity using a combination of DEAE-cellulose column chromatography, ammonium sulfate precipitation, and preparative SDS/PAGE. Purified rat huntingtin does not interact with CAM directly as revealed by 125I-CAM overlay. Huntingtin forms a large CAM-containing complex of over 1,000 kDa in the presence of calcium, which partially disassociates in the absence of calcium. Furthermore, an increased amount of mutant huntingtin from HD patient brains is retained on CAM-Sepharose compared to normal huntingtin from control patient brains, and the mutant allele is preferentially retained on CAM-Sepharose in the absence of calcium. These results suggest that huntingtin interacts with other proteins including CAM and that the expansion of polyGln alters this interaction.
Resumo:
Fragile sites are nonstaining gaps in chromosomes induced by specific tissue culture conditions. They vary both in population frequency and in the culture conditions required for induction. Folate-sensitive fragile sites are due to expansion of p(CCG)(n) trinucleotide repeats; however, the relationship between sequence composition and the chemistry of induction of fragile sites is unclear. To clarify this relationship, the distamycin A-sensitive fragile site FRA16B was isolated by positional cloning and found to be an expanded 33 bp AT-rich minisatellite repeat, p(ATATATTATATATTATATCTAATAATATAT(C)/(A)TA)(n) (consistent with DNA sequence binding preferences of chemicals that induce its cytogenetic expression). Therefore the mutation mechanism associated with trinucleotide repeats is also a property of minisatellite repeats (variable number tandem repeats).