A long-range regulatory element of Hoxc8 identified by using the pClasper vector.

Hox genes are located in highly conserved clusters. The significance of this organization is unclear, but one possibility is that regulatory regions for individual genes are dispersed throughout the cluster and shared with other Hox genes. This hypothesis is supported by studies on several Hox genes in which even large genomic regions immediately surrounding the gene fail to direct the complete expression pattern in transgenic mice. In particular, previous studies have identified proximal regulatory regions that are primarily responsible for early phases of mouse Hoxc8 expression. To locate additional regulatory regions governing expression during the later periods of development, a yeast homologous recombination-based strategy utilizing the pClasper vector was employed. Using homologous recombination into pClasper, we cloned a 27-kb region around the Hoxc8 gene from a yeast artificial chromosome. A reporter gene was introduced into the coding region of the isolated gene by homologous recombination in yeast. This large fragment recapitulates critical aspects of Hoxc8 expression in transgenic mice. We show that the regulatory elements that maintain the anterior boundaries of expression in the neural tube and paraxial mesoderm are located between 11 and 19 kb downstream of the gene.

Sterol regulatory element binding protein binds to a cis element in the promoter of the farnesyl diphosphate synthase gene.

Sterol-regulated transcription of the gene for rat farnesyl diphosphate (FPP) synthase (geranyl-diphosphate:isopentenyl-diphosphate geranyltranstransferase, EC 2.5.1.10) is dependent in part on the binding of the ubiquitous transcription factor NF-Y to a 6-bp element within the proximal promoter. Current studies identify a second element in this promoter that is also required for sterol-regulated transcription in vivo. Mutation of three nucleotides (CAC) within this element blocks the 8-fold induction of FPP synthase promoter-reporter genes that normally occurs when the transfected cells are incubated in medium deprived of sterols. Gel mobility-shift assays demonstrate that the transcriptionally active 68-kDa fragment of the sterol regulatory element (SRE-1)-binding protein assays (SREBP-1) binds to an oligonucleotide containing the wild-type sequence but not to an oligonucleotide in which the CAC has been mutated. DNase 1 protection pattern (footprint) analysis indicates that SREBP-1 binds to nucleotides that include the CAC. Both the in vivo and in vitro assays are affected by mutagenesis of nucleotides adjacent to the CAC. Coexpression of SREBP with a wild-type FPP synthase promoter-reporter gene in CV-1 cells results in very high levels of reporter activity that is sterol-independent. In contrast, the reporter activity remained low when the promoter contained a mutation in the CAC trinucleotide. We conclude that sterol-regulated transcription of FPP synthase is controlled in part by the interaction of SREBP with a binding site that we have termed SRE-3. Identification of this element may prove useful in the identification of other genes that are both regulated by SREBP and involved in lipid biosynthesis.

Domains with transcriptional regulatory activity within the ALL1 and AF4 proteins involved in acute leukemia.

The ALLI gene, located at chromosome band 11q23, is involved in acute leukemia through a series of chromosome translocations and fusion to a variety of genes, most frequently to A4 and AF9. The fused genes encode chimeric proteins proteins. Because the Drosophila homologue of ALL1, trithorax, is a positive regulator of homeotic genes and acts at the level of transcription, it is conceivable that alterations in ALL1 transcriptional activity may underlie its action in malignant transformation. To begin studying this, we examined the All1, AF4, AF9, and AF17 proteins for the presence of potential transcriptional regulatory domains. This was done by fusing regions of the proteins to the yeast GAL4 DNA binding domain and assaying their effect on transcription of a reporter gene. A domain of 55 residues positioned at amino acids 2829-2883 of ALL1 was identified as a very strong activator. Further analysis of this domain by in vitro mutagenesis pointed to a core of hydrophobic and acidic residues as critical for the activity. An ALL1 domain that repressed transcription of the reporter gene coincided with the sequence homologous to a segment of DNA methyltransferase. An AF4 polypeptide containing residues 480-560 showed strong activation potential. The C-terminal segment of AF9 spanning amino acids 478-568 transactivated transcription of the reporter gene in HeLa but not in NIH 3T3 cells. These results suggest that ALL1, AF4, and probably AF9 interact with the transcriptional machinery of the cell.

Conservation and function of the transcriptional regulatory protein Runt.

A phylogenetic approach was used to identify conserved regions of the transcriptional regulator Runt. Alignment of the deduced protein sequences from Drosophila melanogaster, Drosophila pseudoobscura, and Drosophila virilis revealed eight blocks of high sequence homology separated by regions with little or no homology. The largest conserved block contains the Runt domain, a DNA and protein binding domain conserved in a small family of mammalian transcription factors. The functional properties of the Runt domain from the D. melanogaster gene and the human AML1 (acute myeloid leukemia 1) gene were compared in vitro and in vivo. Electrophoretic mobility-shift assays with Runt/AML1 chimeras demonstrated that the different DNA binding properties of Runt and AML1 are due to differences within their respective Runt domains. Ectopic expression experiments indicated that proteins containing the AML1 Runt domain function in Drosophila embryos and that sequences outside of this domain are important in vivo.

Gut-specific transcriptional regulatory elements of the carboxypeptidase gene are conserved between black flies and Drosophila.

Millions of people die every year in the tropical world from diseases transmitted by hematophagous insects. Failure of conventional containment measures emphasizes the need for additional approaches, such as transformation of vector insects with genes that restrict vectorial capacity. The availability of an efficient promoter to drive foreign genes in transgenic insects is a necessary tool to test the feasibility of such approach. Here we characterize the putative promoter region of a black fly midgut carboxypeptidase gene and show that these sequences correctly direct the expression of a beta-glucuronidase reporter in Drosophila melanogaster. By histochemical staining and mRNA analysis, we found that the gene is expressed strongly and gut-specifically in the transgenic Drosophila. This gut-specific black fly carboxypeptidase promoter provides a valuable tool for the study of disease vectors.

A regulatory element in the promoter of the human granulocyte-macrophage colony-stimulating factor gene that has related sequences in other T-cell-expressed cytokine genes.

Granulocyte-macrophage colony-stimulating factor (GM-CSF) is a cytokine with a broad spectrum of cell-differentiating and colony-stimulating activities. It is expressed by several undifferentiated (bone marrow stromal cells, fibroblasts) and fully differentiated (T cells, macrophages, and endothelial cells) cells. Its expression in T cells is activation dependent. We have found a regulatory element in the promoter of the GM-CSF gene which contains two symmetrically nested inverted repeats (-192 CTTGGAAAGGTTCATTAATGAAAACCCCCAAG -161). In transfection assays with the human GM-CSF promoter, this element has a strong positive effect on the expression of a reporter gene by the human T-cell line Jurkat J6 upon stimulation with phorbol dibutyrate and ionomycin or anti-CD3 antibody. This element also acts as an enhancer when inserted into a minimal promoter vector. In DNA band-retardation assays this sequence produces six specific bands that involve one or the other of the inverted repeats. We have also shown that a DNA-protein complex can be formed involving both repeats and probably more than one protein. The external inverted repeat contains a core sequence CTTGG...CCAAG, which is also present in the promoters of several other T-cell-expressed human cytokines (interleukins 4, 5, and 13). The corresponding elements in GM-CSF and interleukin 5 promoters compete for the same proteins in band-retardation assays. The palindromic elements in these genes are larger than the core sequence, suggesting that some of the interacting proteins may be different for different genes. Considering the strong positive regulatory effect and their presence in several T-cell-expressed cytokine genes, these elements may be involved in the coordinated expression of these cytokines in T-helper cells.

Identification of two evolutionarily conserved and functional regulatory elements in intron 2 of the human BRCA1 gene

Cross-species comparative genomics is a powerful strategy for identifying functional regulatory elements within noncoding DNA. In this paper, comparative analysis of human and mouse intronic sequences in the breast cancer susceptibility gene (BRCA1) revealed two evolutionarily conserved noncoding sequences (CNS) in intron 2, 5 kb downstream of the core BRCA1 promoter. The functionality of these elements was examined using homologous-recombination-based mutagenesis of reporter gene-tagged cosmids incorporating these regions and flanking sequences from the BRCA1 locus. This showed that CNS-1 and CNS-2 have differential transcriptional regulatory activity in epithelial cell lines. Mutation of CNS-1 significantly reduced reporter gene expression to 30% of control levels. Conversely mutation of CNS-2 increased expression to 200% of control levels. Regulation is at the level of transcription and shows promoter specificity. Both elements also specifically bind nuclear proteins in vitro. These studies demonstrate that the combination of comparative genomics and functional analysis is a successful strategy to identify novel regulatory elements and provide the first direct evidence that conserved noncoding sequences in BRCA1 regulate gene expression. (c) 2005 Elsevier Inc. All rights reserved.

Pseudomonas aeruginosa AMPR transcriptional regulatory network

In Enterobacteriaceae, the transcriptional regulator AmpR, a member of the LysR family, regulates the expression of a chromosomal β-lactamase AmpC. The regulatory repertoire of AmpR is broader in Pseudomonas aeruginosa, an opportunistic pathogen responsible for numerous acute and chronic infections including cystic fibrosis. Previous studies showed that in addition to regulating ampC, P. aeruginosa AmpR regulates the sigma factor AlgT/U and production of some quorum sensing (QS)-regulated virulence factors. In order to better understand the ampR regulon, the transcriptional profiles generated using DNA microarrays and RNA-Seq of the prototypic P. aeruginosa PAO1 strain with its isogenic ampR deletion mutant, PAOΔampR were analyzed. Transcriptome analysis demonstrates that the AmpR regulon is much more extensive than previously thought influencing the differential expression of over 500 genes. In addition to regulating resistance to β-lactam antibiotics via AmpC, AmpR also regulates non-β-lactam antibiotic resistance by modulating the MexEF-OprN efflux pump. Virulence mechanisms including biofilm formation, QS-regulated acute virulence, and diverse physiological processes such as oxidative stress response, heat-shock response and iron uptake are AmpR-regulated. Real-time PCR and phenotypic assays confirmed the transcriptome data. Further, Caenorhabditis elegans model demonstrates that a functional AmpR is required for full pathogenicity of P. aeruginosa. AmpR, a member of the core genome, also regulates genes in the regions of genome plasticity that are acquired by horizontal gene transfer. The extensive AmpR regulon included other transcriptional regulators and sigma factors, accounting for the extensive AmpR regulon. Gene expression studies demonstrate AmpR-dependent expression of the QS master regulator LasR that controls expression of many virulence factors. Using a chromosomally tagged AmpR, ChIP-Seq studies show direct AmpR binding to the lasR promoter. The data demonstrates that AmpR functions as a global regulator in P. aeruginosa and is a positive regulator of acute virulence while negatively regulating chronic infection phenotypes. In summary, my dissertation sheds light on the complex regulatory circuit in P. aeruginosa to provide a better understanding of the bacterial response to antibiotics and how the organism coordinately regulates a myriad of virulence factors.

Pseudomonas Aeruginosa AmpR Transcriptional Regulatory Network

In Enterobacteriaceae, the transcriptional regulator AmpR, a member of the LysR family, regulates the expression of a chromosomal β-lactamase AmpC. The regulatory repertoire of AmpR is broader in Pseudomonas aeruginosa, an opportunistic pathogen responsible for numerous acute and chronic infections including cystic fibrosis. Previous studies showed that in addition to regulating ampC, P. aeruginosa AmpR regulates the sigma factor AlgT/U and production of some quorum sensing (QS)-regulated virulence factors. In order to better understand the ampR regulon, the transcriptional profiles generated using DNA microarrays and RNA-Seq of the prototypic P. aeruginosa PAO1 strain with its isogenic ampR deletion mutant, PAO∆ampR were analyzed. Transcriptome analysis demonstrates that the AmpR regulon is much more extensive than previously thought influencing the differential expression of over 500 genes. In addition to regulating resistance to β-lactam antibiotics via AmpC, AmpR also regulates non-β-lactam antibiotic resistance by modulating the MexEF-OprN efflux pump. Virulence mechanisms including biofilm formation, QS-regulated acute virulence, and diverse physiological processes such as oxidative stress response, heat-shock response and iron uptake are AmpR-regulated. Real-time PCR and phenotypic assays confirmed the transcriptome data. Further, Caenorhabditis elegans model demonstrates that a functional AmpR is required for full pathogenicity of P. aeruginosa. AmpR, a member of the core genome, also regulates genes in the regions of genome plasticity that are acquired by horizontal gene transfer. The extensive AmpR regulon included other transcriptional regulators and sigma factors, accounting for the extensive AmpR regulon. Gene expression studies demonstrate AmpR-dependent expression of the QS master regulator LasR that controls expression of many virulence factors. Using a chromosomally tagged AmpR, ChIP-Seq studies show direct AmpR binding to the lasR promoter. The data demonstrates that AmpR functions as a global regulator in P. aeruginosa and is a positive regulator of acute virulence while negatively regulating chronic infection phenotypes. In summary, my dissertation sheds light on the complex regulatory circuit in P. aeruginosa to provide a better understanding of the bacterial response to antibiotics and how the organism coordinately regulates a myriad of virulence factors.

Chromatin accessibility mapping identifies mediators of basal transcription and retinoid-induced repression of OTX2 in medulloblastoma.

Despite an emerging understanding of the genetic alterations giving rise to various tumors, the mechanisms whereby most oncogenes are overexpressed remain unclear. Here we have utilized an integrated approach of genomewide regulatory element mapping via DNase-seq followed by conventional reporter assays and transcription factor binding site discovery to characterize the transcriptional regulation of the medulloblastoma oncogene Orthodenticle Homeobox 2 (OTX2). Through these studies we have revealed that OTX2 is differentially regulated in medulloblastoma at the level of chromatin accessibility, which is in part mediated by DNA methylation. In cell lines exhibiting chromatin accessibility of OTX2 regulatory regions, we found that autoregulation maintains OTX2 expression. Comparison of medulloblastoma regulatory elements with those of the developing brain reveals that these tumors engage a developmental regulatory program to drive OTX2 transcription. Finally, we have identified a transcriptional regulatory element mediating retinoid-induced OTX2 repression in these tumors. This work characterizes for the first time the mechanisms of OTX2 overexpression in medulloblastoma. Furthermore, this study establishes proof of principle for applying ENCODE datasets towards the characterization of upstream trans-acting factors mediating expression of individual genes.

Host factors LR1 and Sp1 regulate the Fp promoter of Epstein-Barr virus.

The Epstein-Barr virus EBNA-1 gene product is essential for latent replication of the virus. In transformed cells characterized by the most restricted patterns of viral latent gene expression, EBNA-1 transcription is driven from the Fp promoter. We have used genetic and biochemical techniques to study the promoter-proximal elements that regulate Fp expression in B cells. We show that a 114-bp fragment of DNA spanning the Fp "TATA" box functions as a remarkably active transcriptional regulatory element in B cells. Two host factors, Sp1 and LR1, regulate Fp transcription from the promoter-proximal region. Sp1 binds a single site just downstream of the TATA box, and LR1 binds two sites just upstream of the TATA box. Transcripts from both the viral genome and the minimal promoter initiate at the same unique site, and one function of LR1 at Fp is to direct initiation to this unique start site. In contrast to Sp1, which is ubiquitous, LR1 is present only in activated B cells and may contribute to cell-type-specific transformation by Epstein-Barr virus.

Delineation of a slow-twitch-myofiber-specific transcriptional element by using in vivo somatic gene transfer.

Contractile proteins are encoded by multigene families, most of whose members are differentially expressed in fast- versus slow-twitch myofibers. This fiber-type-specific gene regulation occurs by unknown mechanisms and does not occur within cultured myocytes. We have developed a transient, whole-animal assay using somatic gene transfer to study this phenomenon and have identified a fiber-type-specific regulatory element within the promoter region of a slow myofiber-specific gene. A plasmid-borne luciferase reporter gene fused to various muscle-specific contractile gene promoters was differentially expressed when injected into slow- versus fast-twitch rat muscle: the luciferase gene was preferentially expressed in slow muscle when fused to a slow troponin I promoter, and conversely, was preferentially expressed in fast muscle when fused to a fast troponin C promoter. In contrast, the luciferase gene was equally well expressed by both muscle types when fused to a nonfiber-type-specific skeletal actin promoter. Deletion analysis of the troponin I promoter region revealed that a 157-bp enhancer conferred slow-muscle-preferential activity upon a minimal thymidine kinase promoter. Transgenic analysis confirmed the role of this enhancer in restricting gene expression to slow-twitch myofibers. Hence, somatic gene transfer may be used to rapidly define elements that direct myofiber-type-specific gene expression prior to the generation of transgenic mice.

Computational Methods for Locating and Analyzing Conserved Gene Regulatory DNA Elements

This thesis presents methods for locating and analyzing cis-regulatory DNA elements involved with the regulation of gene expression in multicellular organisms. The regulation of gene expression is carried out by the combined effort of several transcription factor proteins collectively binding the DNA on the cis-regulatory elements. Only sparse knowledge of the 'genetic code' of these elements exists today. An automatic tool for discovery of putative cis-regulatory elements could help their experimental analysis, which would result in a more detailed view of the cis-regulatory element structure and function. We have developed a computational model for the evolutionary conservation of cis-regulatory elements. The elements are modeled as evolutionarily conserved clusters of sequence-specific transcription factor binding sites. We give an efficient dynamic programming algorithm that locates the putative cis-regulatory elements and scores them according to the conservation model. A notable proportion of the high-scoring DNA sequences show transcriptional enhancer activity in transgenic mouse embryos. The conservation model includes four parameters whose optimal values are estimated with simulated annealing. With good parameter values the model discriminates well between the DNA sequences with evolutionarily conserved cis-regulatory elements and the DNA sequences that have evolved neutrally. In further inquiry, the set of highest scoring putative cis-regulatory elements were found to be sensitive to small variations in the parameter values. The statistical significance of the putative cis-regulatory elements is estimated with the Two Component Extreme Value Distribution. The p-values grade the conservation of the cis-regulatory elements above the neutral expectation. The parameter values for the distribution are estimated by simulating the neutral DNA evolution. The conservation of the transcription factor binding sites can be used in the upstream analysis of regulatory interactions. This approach may provide mechanistic insight to the transcription level data from, e.g., microarray experiments. Here we give a method to predict shared transcriptional regulators for a set of co-expressed genes. The EEL (Enhancer Element Locator) software implements the method for locating putative cis-regulatory elements. The software facilitates both interactive use and distributed batch processing. We have used it to analyze the non-coding regions around all human genes with respect to the orthologous regions in various other species including mouse. The data from these genome-wide analyzes is stored in a relational database which is used in the publicly available web services for upstream analysis and visualization of the putative cis-regulatory elements in the human genome.

Functionally conserved cis-regulatory elements of COL18A1 identified through zebrafish transgenesis

Type XVIII collagen is a component of basement membranes, and expressed prominently in the eye, blood vessels, liver, and the central nervous system. Homozygous mutations in COL18A1 lead to Knobloch Syndrome, characterized by ocular defects and occipital encephalocele. However, relatively little has been described on the role of type XVIII collagen in development, and nothing is known about the regulation of its tissue-specific expression pattern. We have used zebrafish transgenesis to identify and characterize cis-regulatory sequences controlling expression of the human gene. Candidate enhancers were selected from non-coding sequence associated with COL18A1 based on sequence conservation among mammals. Although these displayed no overt conservation with orthologous zebrafish sequences, four regions nonetheless acted as tissue-specific transcriptional enhancers in the zebrafish embryo, and together recapitulated the major aspects of col18a1 expression. Additional post-hoc computational analysis on positive enhancer sequences revealed alignments between mammalian and teleost sequences, which we hypothesize predict the corresponding zebrafish enhancers; for one of these, we demonstrate functional overlap with the orthologous human enhancer sequence. Our results provide important insight into the biological function and regulation of COL18A1, and point to additional sequences that may contribute to complex diseases involving COL18A1. More generally, we show that combining functional data with targeted analyses for phylogenetic conservation can reveal conserved cis-regulatory elements in the large number of cases where computational alignment alone falls short. (C) 2009 Elsevier Inc. All rights reserved.

An interferon regulatory factor element controls the major immune modulator of murine cytomegalovirus

Immune modulation by herpesviruses, such as cytomegalovirus, is critical for the establishment of acute and persistent infection confronting a vigorous antiviral immune response of the host. Therefore, the action of immune-modulatory proteins has long been the subject of research, with the final goal to identify new strategies for antiviral therapy.rnIn the case of murine cytomegalovirus (mCMV), the viral m152 protein has been identified to play a major role in targeting components of both the innate and the adaptive immune system in terms of infected host-cell recognition in the effector phase of the antiviral immune response. On the one hand, it inhibits cell surface expression of RAE-1 and thereby prevents ligation of the activating natural killer (NK)-cell receptor NKG2D. On the other hand, it decreases cell surface expression of peptide-loaded MHC class I molecules thereby preventing antigen presentation to CD8 T cells. Ultimately, the outcome of CMV infection is determined by the interplay between viral and cellular factors.rnIn this context, the work presented here has revealed a novel and intriguing connection between viral m152 and cellular interferon (IFN), a key cytokine of the immune system: rnthe m152 promoter region contains an interferon regulatory factor element (IRFE) perfectly matching the consensus sequence of cellular IRFEs.rnThe biological relevance of this regulatory element was first suggested by sequence comparisons revealing its evolutionary conservation among various established laboratory strains of mCMV and more recent low-passage wild-derived virus isolates. Moreover, search of the mCMV genome revealed only three IRFE sites in the complete sequence. Importantly, the functionality of the IRFE in the m152 promoter was confirmed with the use of a mutant virus, representing a functional deletion of the IRFE, and its corresponding revertant virus. In particular, m152 gene expression was found to be inhibited in an IRFE-dependent manner in infected cells. Essentially, this inhibition proved to have a severe impact on the immune-modulatory function of m152, first demonstrated by a restored direct antigen presentation on infected cells for CD8 T-cell activation. Even more importantly, this effect of IRFE-mediated IFN signaling was validated in vivo by showing that the protective antiviral capacity of adoptively-transferred, antigen-specific CD8 T cells is also significantly restored by the IRFE-dependent inhibition of m152. Somewhat curious and surprising, the decrease in m152 protein simultaneously prevented an enhanced activation of NK cells in acute-infected mice, apparently independent of the RAE-1/NKG2D ligand/receptor interaction but rather due to reduced ‘missing-self’ recognition.rnTaken together, this work presents a so far unknown mechanism of IFN signaling to control mCMV immune modulation in acute infection.rnrn