O papel do polimorfismo funcional VNTR da região promotora do gene MAOA nos transtornos psiquiátricos

INTRODUÇÃO: Muitos estudos têm investigado a associação do polimorfismo VNTR (número variável de repetições em série) localizado na região promotora do gene da enzima monoamina oxidase A (MAOA) com alterações no comportamento humano e em diversos transtornos psiquiátricos. OBJETIVO: O objetivo do presente trabalho foi revisar a literatura sobre a participação desse polimorfismo funcional na modulação do comportamento humano para o desenvolvimento dos transtornos psiquiátricos. MÉTODO: A pesquisa foi realizada na literatura em inglês, de janeiro de 1998 a junho de 2009, disponível no Medline, Embase, Web of Science e na base de dados PsycInfo, utilizando os seguintes termos: "MAOA e comportamento humano" e "MAOA e psiquiatria". RESULTADOS: Foram encontrados 3.873 estudos. Desses, 109 foram selecionados e incluídos na revisão. Encontrou-se associação de alelos de baixa atividade do VNTR com transtorno de personalidade antissocial, transtorno de conduta, transtorno de déficit de atenção e hiperatividade, jogo patológico e dependência de substâncias. Alelos da alta atividade da MAOA foram associados a depressão, ansiedade, neuroticismo e anorexia nervosa. Não se encontrou associação entre polimorfismos da MAOA e esquizofrenia e transtorno bipolar. CONCLUSÃO: Os principais achados dão suporte ao papel do polimorfismo VNTR da região promotora do gene da MAOA em alguns transtornos psiquiátricos, apesar das divergências encontradas devidas às dificuldades metodológicas de estudos em genética. De modo geral, os estudos associam os alelos de baixa atividade da MAOA com comportamentos impulsivos e agressivos ("comportamentos hiperativos"), enquanto os alelos de alta atividade do gene são mais associados a "comportamentos hipoativos".

Endothelial Nitric Oxide Synthase Haplotypes Associated with Hypertension Do Not Predispose to Cardiac Hypertrophy

Left ventricular hypertrophy (LVH) is a complication that may result from chronic hypertension. While nitric oxide (NO) deficiency has been associated with LVH, inconsistent results have been reported with regards to the association of endothelial NO synthase (eNOS) polymorphisms and LVH in hypertensive patients. This study aims to assess whether eNOS haplotypes are associated with LVH in hypertensive patients. This study included 101 healthy controls and 173 hypertensive patients submitted to echocardiography examination. Genotypes for three eNOS polymorphisms were determined: a single-nucleotide polymorphism in the promoter region (T-786C) and in exon 7 (Glu298Asp), and variable number of tandem repeats in intron 4. We found no significant association between eNOS genotypes and hypertension or with LVH (all p>0.05). However, while we found two eNOS haplotypes associated with variable risk of hypertension (all p<0.05), we found no significant associations between eNOS haplotypes and LVH (all p>0.05), even after adjustment in multiple linear regression analysis. These findings suggest that eNOS haplotypes that have been associated with variable susceptibility to hypertension were not associated with LVH in hypertensive patients. Further studies are necessary to examine whether other genes downstream may interact with eNOS polymorphisms and predispose to LVH in hypertensive patients.

Endothelial Nitric Oxide Synthase Polymorphisms and Haplotypes in Amerindians

Interethnic disparities in the distribution of endothelial nitric oxide synthase (eNOS) polymorphisms may affect nitric oxide (NO)-mediated effects of and responses to drugs. While there are differences between black and white subjects there is no information regarding the distribution of eNOS gene alleles and haplotypes in Amerindians. We studied three clinically relevant eNOS polymorphisms (T(-786) C in the promoter, a variable number of tandem repeats in intron 4, and the Glu298Asp in exon 7) and eNOS haplotypes in 170 Amerindians from three tribes of the Brazilian Amazon. The results were compared with previous findings for black and white Brazilians. The Asp298, C(-786), and 4a alleles were much less common in Amerindians (5.0%, 3.2%, and 4.1%, respectively) than in blacks (15.1%, 19.5%, and 32.0%, respectively) or whites (32.8%, 41.9%, and 17.9%, respectively) (p<0.001). The haplotype including the most common alleles for each polymorphism was much more common in Amerindians (89%) than in blacks (45%) or whites (41%). Our findings are consistent with a lower genetic diversity in Amerindians compared with blacks and whites. These striking differences may be of major relevance for case-control association studies focusing on eNOS gene polymorphisms and may explain, at least in part, differences in the responses to cardiovascular drugs.

Endothelial Nitric Oxide Synthase Haplotypes Associated with Aura in Patients with Migraine

There is strong evidence implicating nitric oxide (NO) in the pathophysiology of migraine and aura. Therefore, genetic polymorphisms in the endothelial NO synthase (eNOS) gene have been studied as candidate markers for migraine susceptibility. We compared for the first time the distribution of eNOS haplotypes including the three clinically relevant eNOS polymorphisms (T(-786)C in the promoter, rs2070744; Glu298Asp in exon 7, rs1799983; and a 27 bp variable number of tandem repeats in intron 4) and two additional tagging single-nucleotide polymorphisms (rs3918226 and rs743506) in 178 women with migraine (134 without aura and 44 with aura) and 117 healthy controls (control group). Genotypes were determined by TaqMan allele discrimination assay, real-time polymerase chain reaction, and polymerase chain reaction followed by fragment separation by electrophoresis. The GA (rs743506) genotype was more common in the control group than in women with migraine (odds ratio = 0.47, 95% confidence interval [CI] 0.29-0.78, p<0.01). No significant differences were found in allele distributions for the five eNOS polymorphisms. However, the haplotypes including the variants ""C C a Glu G"" and the variants ""C C b Glu G"" were more common in women with migraine with aura than in women with migraine without aura (odds ratio = 30.71, 95% CI = 1.61-586.4 and odds ratio = 17.26, 95% CI = 1.94-153.4, respectively; both p<0.0015625). These findings suggest that these two eNOS haplotypes affect the susceptibility to the presence of aura in patients with migraine.

Genetic population data of 12 STR loci of the PowerPlex (R) Y system in the state of Sao Paulo population (Southeast of Brazil)

Allele frequency distributions and population data for 12 Y-chromosomal short tandem repeats (STRs) included in the PowerPlex (R) Y Systems (Promega) were obtained for a sample of 200 healthy unrelated males living in S (a) over tildeo Paulo State (Southeast of Brazil). A total of 192 haplotypes were identified, of which 184 were unique and 8 were found in 2 individuals. The average gene diversity of the 12 Y-STR was 0.6746 and the haplotype diversity was 0.9996. Pairwise analysis confirmed that our population is more similar with the Italy, North Portugal and Spain, being more distant of the Japan. (c) 2007 Elsevier Ireland Ltd. All rights reserved.

Association between dopamine transporter (DATI) genotype, left-sided inattention, and an enhanced response to methylphenidate in attention-deficit hyperactivity disorder

A polymorphism of the dopamine transporter gene (DAT1, 10-repeat) is associated with attention-deficit hyperactivity disorder (ADHD) and has been linked to an enhanced response to methylphenidate (MPH). One aspect of the attention deficit in ADHD includes a subtle inattention to left space, resembling that seen after right cerebral hemisphere damage. Since left-sided inattention in ADHD may resolve when treated with MPH, we asked whether left-sided inattention in ADHD was related to DAT1 genotype and the therapeutic efficacy of MPH. A total of 43 ADHD children and their parents were genotyped for the DAT1 30 variable number of tandem repeats polymorphism. The children performed the Landmark Test, a well-validated measure yielding a spatial attentional asymmetry index ( leftward to rightward attentional bias). Parents rated their child's response to MPH retrospectively using a three-point scale ( no, mediocre or very good response). Additionally, parents used a symptom checklist to rate behavior while on and off medication. A within-family control design determined whether asymmetry indices predicted biased transmission of 10-repeat parental DAT1 alleles and/or response to MPH. It was found that left-sided inattention predicted transmission of the 10-repeat allele from parents to probands and was associated with the severity of ADHD symptomatology. Children rated as achieving a very good response to MPH displayed left-sided inattention, while those rated as achieving a poorer response did not. Our results suggest a subgroup of children with ADHD for whom the 10-repeat DAT1 allele is associated with left-sided inattention. MPH may be most efficacious in this group because it ameliorates a DAT1-mediated hypodopaminergic state.

Human chromosomal fragile site FRA16B is an amplified AT-rich minisatellite repeat

Fragile sites are nonstaining gaps in chromosomes induced by specific tissue culture conditions. They vary both in population frequency and in the culture conditions required for induction. Folate-sensitive fragile sites are due to expansion of p(CCG)(n) trinucleotide repeats; however, the relationship between sequence composition and the chemistry of induction of fragile sites is unclear. To clarify this relationship, the distamycin A-sensitive fragile site FRA16B was isolated by positional cloning and found to be an expanded 33 bp AT-rich minisatellite repeat, p(ATATATTATATATTATATCTAATAATATAT(C)/(A)TA)(n) (consistent with DNA sequence binding preferences of chemicals that induce its cytogenetic expression). Therefore the mutation mechanism associated with trinucleotide repeats is also a property of minisatellite repeats (variable number tandem repeats).

Interleukin-1 receptor antagonist gene (IL1RN) polymorphism possibly associated to severity of rheumatic carditis in a Brazilian cohort

Aims: To evaluate the IL1RN polymorphism as a possible marker for Rheumatic Fever (RF) susceptibility or disease severity. Methods: The genotypes of 84 RF patients (Jones criteria) and 84 normal race-matched controls were determined through the analysis of the number of 86-bp tandem repeats in the second intron of IL1RN. The DNA was extracted from peripheral-blood leukocytes and amplified with specific primers. Clinical manifestations of RF were obtained through a standardized questionnaire and an extensive chart review. Carditis was defined as new onset cardiac murmur that was perceived by a trained physician with corresponding valvae regurgitation or stenosis on echocardiogram. Carditis was classified as severe in the presence of congestive heart failure or upon the indication for cardiac surgery. The statistical association among the genotypes, RF and its clinical variations was determined. Results: The presence of allele I and the genotype A1/A1 were found less frequently among patients with severe carditis when compared to patients without this manifestation (OR = 0.11, p = 0.031; OR = 0.092, p = 0.017). Neither allele I nor allele 2 were associated with the presence of RF (p = 0.188 and p = 0.106), overall carditis (p = 0.578 and p = 0.767), polyarthritis (p = 0.343 and p = 0.313) and chorea (p = 0.654 and p = 0.633). Conclusion: In the Brazilian population, the polymorphism of the IL-1ra gene is a relevant factor for rheumatic heart disease severity. (C) 2009 Elsevier Ltd. All rights reserved.

Candidate-Gene Approach in Posttraumatic Stress Disorder After Urban Violence: Association Analysis of the Genes Encoding Serotonin Transporter, Dopamine Transporter, and BDNF

Posttraumatic stress disorder (PTSD) is a prevalent, disabling anxiety disorder marked by behavioral and physiologic alterations which commonly follows a chronic course. Exposure to a traumatic event constitutes a necessary, but not sufficient, factor. There is evidence from twin studies supporting a significant genetic predisposition to PTSD. However, the precise genetic loci still remain unclear. The objective of the present study was to identify, in a case-control study, whether the brain-derived neurotrophic factor (BDNF) val66met polymorphism (rs6265), the dopamine transporter (DAT1) three prime untranslated region (3`UTR) variable number of tandem repeats (VNTR), and the serotonin transporter (5-HTTPRL) short/long variants are associated with the development of PTSD in a group of victims of urban violence. All polymorphisms were genotyped in 65 PTSD patients as well as in 34 victims of violence without PTSD and in a community control group (n = 335). We did not find a statistical significant difference between the BDNF val66met and 5-HTTPRL polymorphism and the traumatic phenotype. However, a statistical association was found between DAT1 3`UTR VNTR nine repeats and PTSD (OR = 1.82; 95% CI, 1.20-2.76). This preliminary result confirms previous reports supporting a susceptibility role for allele 9 and PTSD.

Effects of eNOS polymorphisms on nitric oxide formation in healthy pregnancy and in pre-eclampsia

Pre-eclampsia (PE) is associated with decreased nitric oxide (NO) formation. However, no previous study has examined whether genetic variations in the endothelial NO synthase (eNOS) affect this alteration. We hypothesized that PE decreases NO formation depending on eNOS polymorphisms. We examined how three eNOS polymorphisms [T-786C, rs2070744; Glu298Asp, rs1799983; 27 bp variable number of tandem repeats (VNTR) in intron 4] affect plasma nitrite concentrations in 205 pregnant women [107 healthy pregnant (HP) and 98 PE]. Genotypes were determined and eNOS haplotypes were inferred using the PHASE 2.1 program. The plasma nitrite concentrations were determined using an ozone-based chemiluminescence assay. The Glu298Asp polymorphism had no effects on the plasma nitrite concentrations. Higher nitrite levels were found in HP women with the CC versus TT genotype for the T-786C polymorphism (277.9 +/- 19.5 versus 140.6 +/- 8.2 nM; P < 0.05). Lower nitrite levels were found in healthy women with the 4a4a versus 4b4b genotype for the VNTR polymorphism (95.1 +/- 3.3 versus 216.1 +/- 16.8 nM; P < 0.05). No effects of genotypes were found in PE women (all P > 0.05). The `C Glu b` haplotype was more frequent in the HP group than in the PE group (20 versus 5; P = 0.0044). This haplotype was associated with higher nitrite concentrations than the other haplotypes in healthy pregnancies (P < 0.05). No differences in nitrite concentrations were found among PE women with different eNOS haplotypes (P > 0.05). These findings indicate that eNOS polymorphisms affect endogenous NO formation in normal pregnancy, but not in PE, and that the `C Glu b` haplotype may protect against the development of PE by increasing endogenous NO formation.

Analysis of five polymorphic DNA markers for indirect genetic diagnosis of haemophilia A in the Brazilian population

Hemophilia A is an X-linked, inherited, bleeding disorder caused by the partial or total inactivity of the coagulation factor VIII (FVIII). Due to difficulties in the direct recognition of the disease-associated mutation in the F8 gene, indirect diagnosis using polymorphic markers located inside or close to the gene is used as an alternative for determining the segregation of the mutant gene within families and thus for detecting carrier individuals and/or assisting in prenatal diagnosis. This study characterizes the allelic and haplotype frequencies, genetic diversity, population differentiation and linkage disequilibrium of five microsatellites (F8Int1, F8Int13, F8Int22, F8Int25.3 and IKBKG) in samples of healthy individuals from Sao Paulo, Rio Grande do Sul and Pernambuco and of patients from Sao Paulo with haemophilia A to determine the degree of informativeness of these microsatellites for diagnostic purposes. The interpopulational diversity parameters highlight the differences among the analyzed population samples. Regional differences in allelic frequencies must be taken into account when conducting indirect diagnosis of haemophilia A. With the exception of IKBKG, all of the microsatellites presented high heterozygosity levels. Using the markers described, diagnosis was possible in 10 of 11 families. The F8Int22, F8Int1, F8Int13, F8Int25.3 and IKBKG microsatellites were informative in seven, six, five and two of the cases, respectively, demonstrating the effectiveness of using these microsatellites in prenatal diagnosis and in carrier identification in the Brazilian population.

Transcripts of the MHM region on the chicken Z chromosome accumulate as non-coding RNA in the nucleus of female cells adjacent to the DMRT1 locus

The male hypermethylated (MHM) region, located near the middle of the short arm of the Z chromosome of chickens, consists of approximately 210 tandem repeats of a BamHI 2.2-kb sequence unit. Cytosines of the CpG dinucleotides of this region are extensively methylated on the two Z chromosomes in the male but much less methylated on the single Z chromosome in the female. The state of methylation of the MHM region is established after fertilization by about the 1-day embryonic stage. The MHM region is transcribed only in the female from the particular strand into heterogeneous, high molecular-mass, non-coding RNA, which is accumulated at the site of transcription, adjacent to the DMRT1 locus, in the nucleus. The transcriptional silence of the MHM region in the male is most likely caused by the CpG methylation, since treatment of the male embryonic fibroblasts with 5-azacytidine results in hypo-methylation and active transcription of this region. In ZZW triploid chickens, MHM regions are hypomethylated and transcribed on the two Z chromosomes, whereas MHM regions are hypermethylated and transcriptionally inactive on the three Z chromosomes in ZZZ triploid chickens, suggesting a possible role of the W chromosome on the state of the MHM region.

Complete DNA sequence and gene organization of the mitochondrial genome of the liverfluke, Fasciola hepatica L. (Platyhelminthes; Trematoda)

The complete nucleotide sequence of the mitochondrial (mt) DNA molecule of the liverfluke, Fasciola hepatica (phylum Platyhelminthes, class Trematoda, family Fasciolidae), was determined, It comprises 14462 bp, contains 12 protein-encoding, 2 ribosomal and 22 transfer RNA genes, and is the second complete flatworm (and the first trematode) mitochondrial sequence to be described in detail. All of the genes are transcribed from the same strand. Of the genes typically found in mitochondrial genomes of eumetazoans, only atp8 is absent. The nad4L and nad4 genes overlap by 40 nt. Most intergenic sequences are very short. Two larger non-coding regions are present. The longer one (817 nt) is located between trnG and cox3 and consists of 8 identical tandem repeats of 85 nt, rich in G and C, followed by 1 imperfect repeat. The shorter non-coding region (187 nt) exhibits no special features and is separated from the longer region by trnG. The gene arrangement resembles that of some other trematodes including the eastern Asian Schistosoma species (and cyclophyllidean cestode species) but it is strikingly different from that of the African schistosomes, represented by Schistosoma mansoni. The genetic code is as inferred previously for flatworms. Transfer RNA genes range in length from 58 to 70 nt, their products producing characteristic 'clover leaf' structures, except for tRNA(S-VON) and tRNA(S-AGN) lacking the DHU arm.

Characterization of mouse profilaggrin: Evidence for nuclear engulfment and translocation of the profilaggrin B-domain during epidermal differentiation

Filaggrin is a keratin filament associated protein that is expressed in granular layer keratinocytes and derived by sequential proteolysis from a polyprotein precursor termed profilaggrin. Depending on the species, each profilaggrin molecule contains between 10 and 20 filaggrin subunits organized as tandem repeats with a calcium-binding domain at the N-terminal end. We now report the characterization of the complete mouse gene. The structural organization of the mouse gene is identical to the human profilaggrin gene and consists of three exons with a 4 kb intron within the 5' noncoding region and a 1.7 kb intron separating the sequences encoding the calcium-binding EF-hand motifs. A processed pseudogene was found embedded within the second intron. The third and largest exon encodes the second EF-hand, a basic domain (designated the B-domain) followed by 12 filaggrin repeats and a unique C-terminal tail domain. A polyclonal anti-body raised against the conceptually translated sequence of the B-domain specifically stained keratohyalin granules and colocalized with a filaggrin antibody in granular layer cells. In upper granular layer cells, B-domain containing keratohyalin granules were in close apposition to the nucleus and, in some cells, appeared to be completely engulfed by the nucleus. In transition layer cells, B-domain staining was evident in the nucleus whereas filaggrin staining remained cytoplasmic. Nuclear staining of the B-domain was also observed in primary mouse keratinocytes induced to differentiate. This study has also revealed significant sequence homology between the mouse and human promoter sequences and in the calcium-binding domain but the remainder of the protein-coding region shows substantial divergence.

A STR mutation in a heteropaternal twin case

A heteropaternal male twin case with two men being alleged fathers was investigated as requested by the Court. Up to 37 PCR-based polymorphic DNA systems were studied in this case which was complicated by a paternal ACTBP2 mutation detected in one twin. This is the first report on a STR mutation in a double paternity case where both biological fathers were indisputably identified. The STR systems enable the resolution of these complex genetic relationships even in a case where a mutation in one STR locus was encountered.