Effect of surgical treatment on the cellular immune response of gastric cancer patients

Patients with gastric cancer have a variety of immunological abnormalities. In the present study the lymphocytes and their subsets were determined in the peripheral blood of patients with gastric cancer (N = 41) both before and after surgical treatment. The percent of helper/inducer CD4 T cells (43.6 ± 8.9) was not different after tumor resection (43.6 ± 8.2). The percent of the cytotoxic CD8+ T cell population decreased significantly, whether patients were treated surgically (27.2 ± 5.8%, N = 20) or not (27.3 ± 7.3%, N = 20) compared to individuals with inflammatory disease (30.9 ± 7.5%) or to healthy individuals (33.2 ± 7.6%). The CD4/CD8 ratio consequently increased in the group of cancer patients. The peripheral blood lymphocytes of gastric cancer patients showed reduced responsiveness to mitogens. The defective blastogenic response of the lymphocytes was not associated with the production of transforming growth factor beta (TGF-ß) since the patients with cancer had reduced production of TGF-ß1 (269 ± 239 pg/ml, N = 20) in comparison to the normal individuals (884 ± 175 pg/ml, N = 20). These results indicate that the immune response of gastric cancer patients was not significantly modified by surgical treatment when evaluated four weeks after surgery and that the immunosuppression observed was not due to an increase in TGF-ß1 production by peripheral leukocytes.

Filaggrin silencing by shRNA directly impairs the skin barrier function of normal human epidermal keratinocytes and then induces an immune response

The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.

Mapping the immune response to the outer domain of a human immunodeficiency virus-1 clade C gp120

The outer domain (OD) of human immunodeficiency virus (HIV)-1 gp120 represents an attractive, if difficult, target for a beneficial immune response to HIV infection. Unlike the entire gp120, the OD is structurally stable and contains the surfaces that interact with both the primary and secondary cellular receptors. The primary strain-specific neutralizing target, the V3 loop, lies within the OD, as do epitopes for two cross-reactive neutralizing monoclonal antibodies (mAbs), b12 and 2G12, and the contact sites for a number of inhibitory lectins. The OD is poorly immunogenic, at least in the context of complete gp120, but purposeful OD immunization can lead to a substantial antibody response. Here, we map the antibody generated following immunization with a clade C OD. In contrast to published data for the clade B OD, the majority of the polyclonal response to the complete clade C OD is to the V3 loop; deletion of the loop substantially reduces immunogenicity. When the loop sequence was substituted for the epitope for 2F5, a well-characterized human cross-neutralizing mAb, a polyclonal response to the epitope was generated. A panel of mAbs against the clade C OD identified two mAbs that reacted with the loop and were neutralizing for clade C but not B isolates. Other mAbs recognized both linear and conformational epitopes in the OD. We conclude that, as for complete gp120, V3 immunodominance is a property of OD immunogens, that the responses can be neutralizing and that it could be exploited for the presentation of other epitopes.

Relation of pretreatment sequence diversity in NS5A region of HCV genotype 1 with immune response between pegylated-INF/ribavirin therapy outcomes

Hepatitis C virus (HCV) infection frequently persists despite substantial virus-specific immune responses and the combination of pegylated interferon (INF)-alpha and ribavirin therapy. Major histocompatibility complex class I restricted CD8+ T cells are responsible for the control of viraemia in HCV infection, and several studies suggest protection against viral infection associated with specific HLAs. The reason for low rates of sustained viral response (SVR) in HCV patients remains unknown. Escape mutations in response to cytotoxic T lymphocyte are widely described; however, its influence in the treatment outcome is ill understood. Here, we investigate the differences in CD8 epitopes frequencies from the Los Alamos database between groups of patients that showed distinct response to pegylated alpha-INF with ribavirin therapy and test evidence of natural selection on the virus in those who failed treatment, using five maximum likelihood evolutionary models from PAML package. The group of sustained virological responders showed three epitopes with frequencies higher than Non-responders group, all had statistical support, and we observed evidence of selection pressure in the last group. No escape mutation was observed. Interestingly, the epitope VLSDFKTWL was 100% conserved in SVR group. These results suggest that the response to treatment can be explained by the increase in immune pressure, induced by interferon therapy, and the presence of those epitopes may represent an important factor in determining the outcome of therapy.

Functional interferences in host inflammatory immune response by airway allergic inflammation restrain experimental periodontitis development in mice

Aims Periodontal disease (PD) and airway allergic inflammation (AL) present opposing inflammatory immunological features and clinically present an inverse correlation. However, the putative mechanisms underlying such opposite association are unknown. Material and Methods Balb/C mice were submitted to the co-induction of experimental PD (induced by Actinobacillus actinomycetemcomitans oral inoculation) and AL [induced by sensitization with ovalbumin (OVA) and the subsequent OVA challenges], and evaluated regarding PD and AL severity, immune response [cytokine production at periodontal tissues, and T-helper transcription factors in submandibular lymph nodes (LNs)] and infection parameters. Results PD/AL co-induction decreased PD alveolar bone loss and periodontal inflammation while experimental AL parameters were unaltered. An active functional interference was verified, because independent OVA sensitization and challenge not modulate PD outcome. PD+AL group presented decreased tumour necrosis factor-alpha (TNF-alpha), interleukin (IL)-1 beta, -gamma, IL-17A, receptor activator of nuclear factor kappa-light-chain-enhancer of activated B cells ligand and matrix metalloproteinase (MMP)-13 levels in periodontal tissues, while IL-4 and IL-10 levels were unaltered by AL co-induction. AL co-induction also resulted in upregulated T-bet and related orphan receptor gamma and downregulated GATA3 levels expression in submandibular LNs when compared with PD group. Conclusion Our results demonstrate that the interaction between experimental periodontitis and allergy involves functional immunological interferences, which restrains experimental periodontitis development by means of a skewed immune response.

Relation of pretreatment sequence diversity in NS5A region of HCV genotype 1 with immune response between pegylated-INF/ribavirin therapy outcomes

Coordenação de Aperfeiçoamento de Pessoal de Nível Superior (CAPES)

Evaluation of the Naturally Acquired Antibody Immune Response to the Pv200L N-terminal Fragment of Plasmodium vivax Merozoite Surface Protein-1 in Four Areas of the Amazon Region of Brazil

Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)

Maternal LAMP/p55gagHIV-1 DNA Immunization Induces In Utero Priming and a Long-Lasting Immune Response in Vaccinated Neonates

Infants born to HIV-infected mothers are at high risk of becoming infected during gestation or the breastfeeding period. A search is thus warranted for vaccine formulations that will prevent mother-to-child HIV transmission. The LAMP/gag DNA chimeric vaccine encodes the HIV-1 p55gag fused to the lysosome-associated membrane protein-1 (LAMP-1) and has been shown to enhance anti-Gag antibody (Ab) and cellular immune responses in adult and neonatal mice; such a vaccine represents a new concept in antigen presentation. In this study, we evaluated the effect of LAMP/gag DNA immunization on neonates either before conception or during pregnancy. LAMP/gag immunization of BALB/c mice before conception by the intradermal route led to the transfer of anti-Gag IgG1 Ab through the placenta and via breastfeeding. Furthermore, there were an increased percentage of CD4+ CD25+ Foxp3+ T cells in the spleens of neonates. When offspring were immunized with LAMP/gag DNA, the anti-Gag Ab response and the Gag-specific IFN-gamma-secreting cells were decreased. Inhibition of anti-Gag Ab production and cellular responses were not observed six months after immunization, indicating that maternal immunization did not interfere with the long-lasting memory response in offspring. Injection of purified IgG in conjunction with LAMP/gag DNA immunization decreased humoral and cytotoxic T-cell responses. LAMP/gag DNA immunization by intradermal injection prior to conception promoted the transfer of Ab, leading to a diminished response to Gag without interfering with the development of anti-Gag T- and B-cell memory. Finally, we assessed responses after one intravenous injection of LAMP/gag DNA during the last five days of pregnancy. The intravenous injection led to in utero immunization. In conclusion, DNA vaccine enconding LAMP-1 with Gag and other HIV-1 antigens should be considered in the development of a protective vaccine for the maternal/fetal and newborn periods.

Vaccination with the recombinant chimeric antigen recNcMIC3-1-R induces a non-protective Th2-type immune response in the pregnant mouse model for N. caninum infection

The major route of transmission of Neospora caninum in cattle is transplacentally from an infected cow to its progeny. Therefore, a vaccine should be able to prevent both the horizontal transmission from contaminated food or water and the vertical transmission. We have previously shown that a chimeric vaccine composed of predicted immunogenic epitopes of NcMIC3, NcMIC1 and NcROP2 (recNcMIC3-1-R) significantly reduced the cerebral infection in BALB/c mice. In this study, mice were first vaccinated, then mated and pregnant mice were challenged with 2×10(6)N. caninum tachyzoites at day 7-9 of pregnancy. Partial protection was only observed in the mice vaccinated with a tachyzoite crude protein extract but no protection against vertical transmission or cerebral infection in the dams was observed in the group vaccinated with recNcMIC3-1-R. Serological and cytokine analysis showed an overall lower cytokine level in sera associated with a dominant IL-4 expression and high IgG1 titers. Thus, the Th2-type immune response observed in the pregnant mice was not protective against experimental neosporosis, in contrary to the mixed Th1-/Th2-type immune response observed in the non-pregnant mouse model. These results demonstrate that the immunomodulation that occurs during pregnancy was not favorable for the protection against N. caninum infection conferred by vaccination with recNcMIC3-1-R.

Multiple roles of complement MASP-1 at the interface of innate immune response and coagulation

MASP-1 is a versatile serine protease that cleaves a number of substrates in human blood. In recent years it became evident that besides playing a crucial role in complement activation MASP-1 also triggers other cascade systems and even cells to mount a more powerful innate immune response. In this review we summarize the latest discoveries about the diverse functions of this multi-faceted protease. Recent studies revealed that among MBL-associated serine proteases, MASP-1 is the one responsible for triggering the lectin pathway via its ability to rapidly autoactivate then cleave MASP-2, and possibly MASP-3. The crystal structure of MASP-1 explains its more relaxed substrate specificity compared to the related complement enzymes. Due to the relaxed specificity, MASP-1 interacts with the coagulation cascade and the kinin generating system, and it can also activate endothelial cells eliciting pro-inflammatory signaling.

Preferential induction of a Th1 immune response and inhibition of specific IgE antibody formation by plasmid DNA immunization.

We compared the antigen-specific antibody isotypes and lymphokine secretion by CD4+ T cells in BALB/c mice immunized intradermally with either Escherichia coli beta-galactosidase (beta-gal) or plasmid DNA (pDNA) encoding beta-gal in a cytomegalovirus-based expression vector (pCMV-LacZ). pCMV-LacZ induced mainly IgG2a, whereas beta-gal in saline or alum induced IgG1 and IgE beta-gal-specific antibodies. In addition, splenic CD4+ T helper (Th) cells isolated from pDNA-immunized mice secreted interferon-gamma but not interleukin (IL)-4 and IL-5, whereas Th cells from beta-gal-injected mice secreted IL-4 and IL-5 but not interferon-gamma after in vitro stimulation with antigen. Together these data demonstrate that pDNA immunization induced a T helper type 1 (Th1) response, whereas protein immunization induced a T helper type 2 (Th2) response to the same antigen. Interestingly, priming of mice with pCMV-LacZ prevented IgE antibody formation to a subsequent i.p. beta-gal in alum injection. This effect was antigen-specific, because priming with pCMV-LacZ did not inhibit IgE anti-ovalbumin antibody formation. Most importantly, intradermal immunization with pCMV-LacZ (but not pCMV-OVA) of beta-gal in alum-primed mice caused a 66-75% reduction of the IgE anti-beta-gal titer in 6 weeks. Also, pCMV-LacZ induced specific IgG2a antibody titers and interferon-gamma secretion by Th cells in the beta-gal in alum-primed mice. The data demonstrate that gene immunization induces a Th1 response that dominates over an ongoing protein-induced Th2 response in an antigen-specific manner. This suggests that immunization with pDNA encoding for allergens may provide a novel type of immunotherapy for allergic diseases.

Markedly impaired humoral immune response in mice deficient in complement receptors 1 and 2.

Complement receptor 1 (CR1, CD35) and complement receptor 2 (CR2, CD21) have been implicated as regulators of B-cell activation. We explored the role of these receptors in the development of humoral immunity by generating CR1- and CR2-deficient mice using gene-targeting techniques. These mice have normal basal levels of IgM and of IgG isotypes. B- and T-cell development are overtly normal. Nevertheless, B-cell responses to low and high doses of a T-cell-dependent antigen are impaired with decreased titers of antigen-specific IgM and IgG isotypes. This defect is not complete because there is still partial activation of B lymphocytes during the primary immune response, with generation of splenic germinal centers and a detectable, although reduced, secondary antibody response. These data suggest that certain T-dependent antigens manifest an absolute dependence on complement receptors for the initiation of a normally robust immune response.

N-terminal fusion of a toll-like receptor 2-ligand to a Neospora caninum chimeric antigen efficiently modifies the properties of the specific immune response

Immunoprophylactic products against neosporosis during pregnancy should induce an appropriately balanced immune response. In this respect, OprI, a bacterial lipoprotein targeting toll like receptor (TLR)2, provides promising adjuvant properties. We report on the manipulation of the innate and the T-cell immune response through the fusion of OprI with the Neospora caninum chimeric protein Mic3-1-R. In contrast to Mic3-1-R, OprI-MIC3-1-R significantly activated bone-marrow dendritic cells from naïve mice. Mice immunized with OprI-Mic3-1-R induced an immune response with mixed T helper (Th)1 and Th2 properties (high levels of both immunoglobulin (Ig)G1 and IgG2a and of interleukin (IL)-10, IL-12(p70) and interferon-γ responses) whereas Mic3-1-R+saponin induced a clear Th2-biased response (low IgG2a and high IL-4 and IL-10). After mating and challenge with N. caninum, increased expression of interferon-γ was only found in placentas from OprI-Mic3-1-R immunized dams. However, no protection against vertical transmission and neonatal mortality was observed in either of the two groups. These results indicated that more exhaustive studies must be done to elucidate the immune mechanisms associated with transplacental transmission. Antigen linkage to TLR2-ligands, such as OprI, is a useful tool to investigate this enigma by reorienting the innate and adaptive immune responses against other candidate antigens in future studies.