Influence of sire breed (Bos indicus versus Bos taurus) and interval from slaughter to oocyte aspiration on heat stress tolerance of in vitro-produced bovine embryos

Based on in vitro experiments, Bos indicus embryos were more resistant to heat stress (HS) than Bos taurus embryos. To increase knowledge regarding differences between Bos indicus and Bos taurus in resistance to HS, the primary objective of this study was to determine if tolerance to HS is due to the breed, origin of the oocyte, sperm, or both. Additionally, the influence of the interval between ovary acquisition (in the abattoir) and oocyte aspiration in the laboratory, on early embryo development was ascertained. Oocytes were collected from Nelore and Holstein cows in an abattoir; 4.0 or 6.5 h later, oocytes were aspired in the laboratory, and then matured and fertilized using semen from Nelore (N), Gir (GIR), or Holstein (H) bulls. Ninety-six h post insemination (hpi), embryos with >= 16 cells were divided in two groups: control and HS. In the control group, embryos were cultured at 39 degrees C, whereas in the HS group, embryos were subjected to 41 degrees C for 12 h, and then returned to 39 degrees C. Rates of cleavage, and formation of morula and blastocysts were higher (P < 0.05) for oocytes aspirated at 4.0 versus 6.5 h after ovaries were acquired. Heat stress decreased rates of blastocyst formation for all breeds (N X N; H x H; and H X GIR) and in both time intervals (4.0 and 6.5 h). However, N X N had higher cleavage rate (P < 0.05) in both time intervals when compared with H X H and H X GIR. In addition, Nelore oocytes fertilized with Nelore semen (N X N) had higher blastocyst yields (P < 0.05) in the control and HS group, when compared with the other two breeds (H X H and H X GIR). We concluded that the breed of origin of the oocyte was more important than that of the sperm for development of thermotolerance, because bull breed did not influence embryo development after HS, and in vitro early embryonic development was impaired by increasing (from 4 to 6.5 h) the interval between ovary acquisition and oocyte aspiration. (C) 2011 Elsevier B.V. All rights reserved.

Influence of the breed of bull (Bos taurus indicus vs. Bos taurus taurus) and the breed of cow (Bos taurus indicus, Bos taurus taurus and crossbred) on the resistance of bovine embryos to heat

Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)

Effects of bovine Herpesvirus Type 5 on development of in vitro-produced bovine embryos

Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)

Evaluation of developmental changes in bovine in vitro produced embryos following exposure to bovine Herpesvirus type 5

Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)

Cryopreservation of dog spermatozoa: Effect of bovine serum albumin on acrosomal integrity and pregnancy rates after artificial insemination

The objective of the present study was to compare the in vitro and in vivo profile of frozen dog semen with Tris-bovine serum albumin (TB) and Tris-egg yolk (TE) extenders. Twenty dogs were used as donors. Each dog was stimulated by penile massage and only the sperm-rich fraction was collected weekly until 40 ejaculates were obtained. After macroscopic and microscopic analysis, equal parts of each ejaculate were diluted with TB and TE by the one-step method at 37 °C. The semen was added to 0.5-mL French straws which presented normal characteristics before freezing and after thawing. Acrosomal integrity was evaluated by double Trypan blue-Giemsa staining, in which alive intact (LI), alive reacted (LR), dead intact (DI) and dead reacted (DR) spermatozoa, were identified by the time of thawing and up to 4 h of incubation at 39 °C, the TE being significantly superior to TB (P<0,01) in the LI and LR variables. The TB being significantly superior to TE (P<0,01) in the DR variable. Female dogs in natural heat were submitted to artificial insemination, 20 receiving TE-semen and 20 receiving TB-semen with the Osiris probe (IMV, L'Aigle, France) and the numbers indicate that TE was significantly better than TB (P<0,01) to pregnancy rate and number of puppies/delivery. We concluded from this study, that TE was better than TB, because this, induced an eady acrossome reaction in dog's sperm.

Use of cooled bull semen as a strategy to increase the pregnancy rate in fixed-time artificial insemination programs-case report

Semen cryopreservation is still considered suboptimal due to lower fertility when compared to fresh semen. The reasons for the loss of fertility are various and related to irreversible damage caused to the cells during the freeze-thaw process. An alternative to conventional cryopreservation represents the use of chilled bull semen, preventing the damage associated with freezing, thereby guaranteeing greater sperm viability. The aim of this study was to describe the use of cooled bull semen as a strategy to increase the pregnancy for Fixed-Time Artificial Insemination (FTAI) of Nellore (Bos indicus) cows. One ejaculate of a select Nellore bull obtained by electroejaculation was used; the semen sample was fractioned into two aliquots: one diluted in Botu-Bov® extender containing 6.4% glycerol for cryopreservation (BB-F, frozen group) and one diluted in the same extender, free from cryoprotectants and used for cooling (BB-C, cooled semen group). The samples in the BB-C group were chilled to 5°C using an isothermic box and maintained for 24 h prior to use. A total of 349 lactating Nellore cows (70-90 days after birth) were synchronized by the insertion of a progesterone releasing device (1.0 g) and estradiol benzoate (2.0 mg i.m.) on a random day of the estrous cycle (Day 0); FTAI was performed 44-48 h after the removal of the device. The pregnancy rates were 45.71 and 61.49% (P<0.05), respectively, for the cryopreserved or chilled bovine semen groups. In conclusion, the use of bull semen cooled for 24 h represents an alternative to conventionally cryopreserved semen, as determined by the increase the pregnancy per artificial insemination in bovine herds. © 2012 Science Publication.

Seasonal effects on semen and testosterone in zebu and taurine bulls

Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq)

PCR fluorescente associada à eletroforese capilar como ferramenta de diagnóstico de bactérias no semen

This study was performed in order to evaluate the detection limit of PCR with fluorescent capillary electrophoresis for Brucella abortus diagnosis in bovine semen. Negative bovine semen samples were artificially contaminated with B. abortus (10(0) to 10(7) bacteria/mL) and DNA was extracted by phenol/chloroform protocol. DNA was amplified by PCR with oligonucleotides previously described BF-5'gcgctcaggctgccgacgcaa3' (6-FAM labeled) and BR-5'accagccattgcggtcggta3' for B. abortus. Oligonucleotides generated DNA fragments of 193 bp. DNA fragments visualization was done under UV light at silver stained 8% poliacrylamide gel, and fluorescent capillary electrophoresis performed in an automatic DNA fragment analyzer. The detection limit of capillary electrophoresis for B. abortus was 10³ bacteria/mL, while for silver stained 8% poliacrylamide gel it was 10(5) bacteria/mL. PCR with fluorescent capillary electrophoresis is fast, efficient and highly sensitive test for DNA detection of Brucella in bovine semen, and itcan be an important tool for health evaluation of the herd and semen sanitary control in artificial insemination centers.

Isolate((R)) and Optiprep((R)) minigradients as alternatives for sperm selection in bovine in vitro embryo production

The objective of this study was to evaluate alternatives in small volumes to conventional gradient of Percoll((R)) on semen quality, in vitro embryo production, sex ratio and embryo survival after vitrification. Thawed semen was randomly allocated to one of four density gradient selection methods: (1) conventional Percoll((R)) (P), (2) MiniPercoll (MP), (3) MiniIsolate (MI), and (4) MiniOptiprep (MO). Sperm kinetics and quality were evaluated. Use of P, MP and MI gradients did not affect sperm motility (P > 0.05). However, there was a decrease in total and progressive sperm motility in MO (70.8 and 51.3% vs. 87.3 and 69.5% for P; 87.3 and 73% for MP; 92.3 and 78.8% for MI; P < 0.05). The MO had lower membrane integrity compared with P, MP and MI (39.7 vs. 70.5, 72.3, 63.8%, respectively, P < 0.05). The percentage of blastocysts produced was higher in MI than in MP and MO (21.1 vs. 16.1 and 16.9%, P < 0.05) and similar to P (18.4%; P > 0.05). Sex ratio and embryo survival after vitrification were similar among groups (P > 0.05). Semen selected by Isolate and Optiprep gradient, at the concentrations and small volumes used, demonstrated similar characteristics and in vitro embryo production to conventional Percoll((R)) gradient.

The influence of insemination dose on pregnancy per fixed-time artificial insemination in beef cows is affected by semen extender

Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)

Assessment of in vitro sperm characteristics and their importance in the prediction of conception rate in a bovine timed-AI program

Coordenação de Aperfeiçoamento de Pessoal de Nível Superior (CAPES)

Different extenders in the cryopreservation of bovine epididymal spermatozoa

Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)

Effect of sequence of insemination after simultaneous thawing of multiple semen straws on conception rate to timed AI in suckled multiparous Nelore cows

The objective was to determine the effect of sequence of insemination after simultaneous thawing of multiple 0.5 mL semen straws on conception rate in suckled multiparous Nelore cows. The effect of this thawing procedure on in vitro sperm characteristics was also evaluated. All cows (N = 944) received the same timed AI protocol. Ten straws (0.5 mL) of frozen semen from the same batch were simultaneously thawed at 36 degrees C, for a minimum of 30 sec. One straw per cow was used for timed AI. Frozen semen from three Angus bulls was used. Timed AI records included sequence of insemination (first to tenth) and time of semen removal from thawing bath. For laboratory analyses, the same semen batches used in the field experiment were evaluated. Ten frozen straws from the same batch were thawed simultaneously in a thawing unit identical to that used in the field experiment. The following sperm characteristics were analyzed: sperm motility parameters, sperm thermal resistance, plasma and acrosomal membrane integrity, lipid peroxidation, chromatin structure, and sperm morphometry. Based on logistic regression, there were no significant effects of breeding group, body condition score, AI technician, and sire on conception rate, but there was an interaction between sire and straw group (P = 0.002). Semen from only one bull had decreased (P < 0.05) field fertility for the group of straws associated with the longest interval from thawing to AI. However, the results of the laboratory experiment were unable to explain the findings of the field experiment. Sperm width:length ratio of morphometric analysis was the single sperm characteristic with a significant interaction between sire and straw group (P = 0.02). It was concluded that sequence of insemination after simultaneous thawing of 10 semen straws can differently affect conception rates at timed AI, depending on the sire used. Nevertheless, the effects of this thawing environment on in vitro sperm characteristics, remain to be further investigated. (C) 2012 Elsevier Inc. All rights reserved.

Effects of bovine sperm cryopreservation using different freezing techniques and cryoprotective agents on plasma, acrosomal and mitochondrial membranes

The success of semen cryopreservation is influenced by several factors, such as freezing curves and cryoprotectants. These two factors are of special interest once they may lead to many important physical-chemical changes resulting in different degrees of damage in spermatozoa structure. This experiment was designed to compare the effect of bull semen cryopreservation using two freezing techniques: conventional (CT cooling rate of -0.55 degrees C min-1 and freezing rate of -19.1 degrees C min-1) and automated (AT cooling rate of -0.23 degrees C min-1 and freezing rate of -15 degrees C min-1), performed with different curves, and with three cryoprotectants (glycerol, ethylene glycol and dimethyl formamide) on bovine sperm motility and integrity of plasma, acrosomal and mitochondrial membranes. These variables were simultaneously evaluated using the fluorescence probes propidium iodide, fluorescein-conjugated Pisum sativum agglutinin and MitoTracker Green FM. The effects of freezing techniques, as well as of different cryoprotectants were analysed by the analysis of variance. The means were compared by Fishers test. There were no significant differences between freezing techniques (P > 0.05). Glycerol showed higher percentages of motility, vigour and integrity of plasma, acrosomal and mitochondrial membranes than other two cryoprotectants (P < 0.05). Ethylene glycol preserved higher motility and integrity of plasma and mitochondrial membranes than dimethyl formamide (P < 0.05). Sperm motility with glycerol was 30.67 +/- 1.41% and 30.50 +/- 1.06%, with ethylene glycol was 21.17 +/- 1.66% and 21.67 +/- 1.13% and with dimethyl formamide was 8.33 +/- 0.65% and 9.17 +/- 0.72% to CT and AT curves, respectively. The percentage of spermatozoa with simultaneously intact plasma membrane, intact acrosome and mitochondrial function (IPIAH) was 14.82 +/- 1.49% (CT) and 15.83 +/- 1.26% (AT) to glycerol, 9.20 +/- 1.31% (CT) and 9.92 +/- 1.29% (AT) to ethylene glycol 4.65 +/- 0.93% (CT) and 5.17 +/- 0.87% (AT) to dimethyl formamide. Glycerol provided the best results, although nearly 85% of spermatozoa showed some degree of injury in their membranes, suggesting that further studies are required to improve the results of cryopreservation of bovine semen.