940 resultados para RU(II) COMPLEXES
Resumo:
The synthesis and characterisation of a new bifunctional Ru(II) complex are presented. This compound contains a metallic unit, photo-reactive versus the guanines of DNA, and a new bifunctional ligand. An intramolecular luminescence quenching makes this complex an attractive candidate for photoprobing DNA where the intramolecular quenching process is inhibited with restoration of luminescence. © 1998 Elsevier Science S.A. All rights reserved.
Resumo:
Novel bifunctional ruthenium(n) complexes, [Ru(TAP)2(POQ-Nmet)]2+ and [Ru(BPY)2(POQ-Nmet)]2+(la, 2a), containing a metallic and an organic moiety, have been prepared as photoprobes and photoreagents of DNA(TAP = 1,4,5,8-tetraazaphenanthrene, POQ-Nmet = 5-[6-(7-chloroquinolin-4-yl)-3-thia-6-azaheptanamido]-l,10phenanthroline). The ES mass spectrometry and 'H NMR data in organic solvents indicate that the quinoline moiety exists in both the protonated and non-protonated form. Moreover, the comparison of the NMR data with those of the corresponding monofunctional complexes(without quinoline) evidences that [Ru(TAP).2(POQ-Nmet)]2+ and [Ru(BPY)J(POQ-Nmet)]2+ are unfolded when the quinoline unit is protonated whereas deprotonation permits folding of the molecule. In the folded state the spatial proximity of the electron donor(the organic moiety) and electron acceptor(the metallic moiety) in [Ru(TAP)2(POQ-Nmet)]2+ favours intramolecular photo-induced electron transfer, which has been shown in a previous study to be responsible for the very low luminescence of la in non-protonating solutions. The restoration of the luminescence by protonation of the quinoline moiety as observed previously is in agreement with the unfolding of the molecule demonstrated in this work. The existence of such folding-unfolding processes related to protonation is crucial for studies of la with DNA. © The Royal Society of Chemistry 2000.
Resumo:
The two enantiomers of [Ru(bpy)2(bbtb)]2+ {bpy = 2,2'-bipyridine; bbtb = 4,4'-bis(benzothiazol-2-yl)-2,2'-bipyridine} have been isolated and fully characterised. Both enantiomers have been shown to have a strong association with calf thymus DNA by UV/visible absorption, emission and CD spectroscopy, with the lambda enantiomer having the greater affinity. The binding of both enantiomeric forms of [Ru(bpy)2(Me2bpy)]2+ and [Ru(bpy)2(bbtb)]2+ {Me2bpy = 4,4'-dimethyl-2,2'-bipyridine} to a range of oligonucleotides, including an octadecanucleotide and an icosanucleotide which contain hairpin-sequences, have been studied using a fluorescent intercalator displacement (FID) assay. The complex [Ru(bpy)2(bbtb)]2+ exhibited an interesting association to hairpin oligonucleotides, again with the lambda enantiomer binding more strongly. A 1H NMR spectroscopic study of the binding of both enantiomers of [Ru(bpy)2(bbtb)]2+ to the icosanucleotide d(CACTGGTCTCTCTACCAGTG) was conducted. This sequence contains a seven-base-pair duplex stem and a six-base hairpin-loop. The investigation gave an indication of the relative binding of the complexes between the two different regions (duplex and secondary structure) of the oligonucleotide. The results suggest that both enantiomers bind at the hairpin, with the ruthenium centre located at the stem-loop interface. NOE studies indicate that one of the two benzothiazole substituents of the bbtb ligand projects into the loop-region. A simple model of the metal complex/oligonucleotide adduct was obtained by means of molecular modelling simulations. The results from this study suggest that benzothiazole complexes derived from inert polypyridine ruthenium(II) complexes could lead to the development of new fluorescent DNA hairpin binding agents.
Resumo:
The substituted tris(bipyridine)ruthenium(II) complexes {[Ru(bpy)(2)(4,4'-bbob)](2+) and [Ru(bpy)(2)(5,5'-bbob)](2+) [where bpy = 2,2'-bipyridine and bbob = bis(benzoxazol-2-yl)-2,2'-bipyridine] have been prepared and compared to the previously studied complex [Ru(bpy)(2)(4,4'-bbtb)](2+) [where bbtb = bis(benzothiazol-2-yl)-2,2'-bipyridine]. From the UV/VIS titration studies, Delta-[Ru(bpy)(2)(4,4'bbob)](2+) displays a stronger association than the Lambda-isomer with calf-thymus DNA (ct-DNA). For [Ru(bpy)(2)(5,5'-bbob)](2+), there appears to be minimal interaction with ct-DNA. The results of fluorescence titration studies suggest that [Ru(bpy)(2)(4,4'-bbob)](2+) gives an increase in emission intensity with increasing ct-DNA concentrations, with an enantiopreference for the A isomer, confirmed by membrane dialysis studies. The fluorescent intercalation displacement studies revealed that [Ru(bpy)(2)(4,4'-bbob)](2+) and [Ru.(bpy)(2)(5,5'bbob)](2+) display a preference for more open DNA structures such as bulge and hairpin sequences. While Delta-[Ru(bpy)(2)(4,4'-bbtb)](2+) has shown the most significant affinity for all the oligonucleotides sequences screened in previous studies, it is the A isomer of the comparable benzoxazole ruthenium(II) complex (Delta-[Ru(bpy)(2)(4,4'-bbob)](2+)) that preferentially binds to DNA.
Resumo:
The novel ligand 4'-diferrocenylallcyne-2,2':6',2 ''-terpyridine (7; Fc-C C-Fc-tpy; tpy = terpyridyl; Fc = ferrocenyl) and its Ru2+ complexes 8-10 have been synthesized and characterized by single-crystal X-ray diffraction, cyclic voltammetry, and UV-vis and luminescence spectroscopy. Electrochemical data and UV absorption and emission spectra indicate that the insertion of an ethynyl group causes delocalization of electrons in the extended pi* orbitals. Cyclic voltammetric measurements of 7 show two successive reversible one-electron-oxidation processes with half-wave potentials of 0.53 and 0.78 V. The small variations of the E-1/2 values for the Fe2+/Fe3+ redox couples after the coordination of the Ru2+ ion suggest a weak interaction between the Ru2+ and Fe2+ centers. After insertion of an ethynyl group, UV-vis absorption spectra show a red shift of the absorption peak of the (1)[(d(pi)(Fe))(6)]->(1)[(d(pi)(Fe))(5)(pi*(Ru)(tpy))(1)] MMLCT of the Ru2+ complexes. The Ru2+ complex 8 exhibits the strongest luminescence intensity (lambda(em)(max) 712 nm, Phi(em) = 2.63 x 10(-4), tau = 323 ns) relative to analogous ferrocene-based terpyridine Ru(II) complexes in H2O/CH3CN (4/1 v/v) solution.
Resumo:
Two novel alkynyl-bridged symmetric bis-tridentate ligands 1,2-bis(1'-[4'-(2,2':6', 2 ''-terpyridinyl)]-ferrocenyl)ethyne (3a; tpy-Fc-C C-Fc-tpy; Fc = ferrocenyl; tpy = terpyridyl) and 1,4-bis(1'-[4'-(2,2':6', 2 ''-terpyridinyl)]ferrocenyl)-1,3-butadiyne (3b; tpy-Fc-C C-C C-Fc-tpy) and their Ru2+ complexes 6a and 6b have been synthesized and characterized by cyclic voltammetry, UV-vis and luminescence spectroscopy, and in the case of 3b by single-crystal X-ray diffraction. Cyclic voltammograms of both compounds, 3a and 3b, display two severely overlapping ferrocene-based oxidative peaks with only one reductive peak. The redox behavior of 6a and 6b is dominated by the Ru2+/Ru3+ redox couple (E-1/2 from 1.33 to 1.34 V), the Fe2+/Fe3+ redox couples (E-1/2 from 0.46 to 0.80 V), and the tpy/tpy(-)/tpy(2-)redox couples (E-1/2 from -1.19 to -1.48 V). The UV-vis spectra of 6a and 6b show absorption bands assigned to the (1)[(d(pi)(Fe))(6)] -> (1)[(d(pi)(Fe))(5)(pi*(Ru)(tpy))(1)] MMLCT transition at similar to 555 nm. Complexes 6a and 6b are luminescent in H2O-CH3CN (4 : 1, v/v) solution at room temperature, and 6b exhibits the strongest luminescence intensity (lambda(em)(max): 710 nm, Phi(em): 2.28 x 10(-4), tau: 358 ns) relative to analogous ferrocene-based bis(terpyridine) Ru(II) complexes reported so far.
Resumo:
Os únicos complexos metálicos presentemente utilizados em quimioterapia compreendem exclusivamente compostos de platina, com as desvantagens de apresentarem um leque de acção restrito e de provocarem sérios efeitos secundários. Na constante procura por novos fármacos antineoplásicos metálicos, os complexos de ruténio têm sido apresentados como uma alternativa adequada e existem já dois complexos de Ru(III) em ensaios clínicos. Estes são descritos como pró-fármacos, postulando-se que o seu mecanismo de acção envolva redução in vivo para originar complexos de Ru(II) activos. Assim, o actual desenvolvimento de fármacos antitumorais baseados em ruténio passará por criar novos complexos de Ru(II). O trabalho aqui descrito enquadra-se neste objectivo, tendo sido sintetizados complexos de ruténio(II)-tritiaciclononano com ligandos biologicamente activos, e avaliada a sua actividade antitumoral in vitro. Os ligandos utilizados compreendem um hidroxifenilpirazole, aminoácidos e derivados, flavonóides e quinonas. No primeiro capítulo do trabalho são apresentados os actuais desafios no desenvolvimento de complexos metálicos para quimioterapia e é ilustrada a importância dos complexos de Ru(II) aqui descritos no panorama actual de investigação. No capítulo dois, é apresentada uma descrição pormenorizada dos procedimentos experimentais, materiais e equipamentos utilizados na síntese, caracterização e ensaios biológicos. O capítulo três é dividido em duas sub-secções, a primeira analisando os resultados das sínteses e a caracterização estrutural dos complexos, e a segunda apresentando os resultados da sua actividade antiproliferativa. Foram obtidos onze novos complexos de ruténio(II)-tritiaciclononano, com rendimentos razoáveis. São apresentadas propostas das suas estruturas moleculares, sendo que estas mostram uma variedade interessante de modos de coordenação de acordo com os diferentes ligandos, ou seja, N, N,O, O,O e O. A actividade antiproliferativa dos complexos e dos respectivos ligandos foi avaliada em quatro linhas celulares tumorais, representativas de três tipos de cancro: osso (MG-63), próstata (PC-3) e mama (MCF-7 e MDA-MB-231). Quatro dos novos complexos demonstraram uma actividade antiproliferativa promissora, ou seja, aqueles que apresentam um hidroxifenilpirazole, a 3,7-dihidroxiflavona, a plumbagina ou a juglona na sua esfera de coordenação. Entre estes resultados, destacam-se os valores de IC50 para a linha celular MDA-MB-231 por se apresentarem inferiores ao apresentado pelo complexo de Ru(II)-tritiaciclononano mais activo descrito na literatura.
Resumo:
A series of mono(eta(5)-cyclopentadienyl)metal-(II) complexes with nitro-substituted thienyl acetylide ligands of general formula [M(eta(5)-C5H5)(L)(C C{C4H2S}(n)NO2)] (M = Fe, L = kappa(2)-DPPE, n = 1,2; M = Ru, L = kappa(2)-DPPE, 2 PPh3, n = 1, 2; M = Ni, L = PPh3, n = 1, 2) has been synthesized and fully characterized by NMR, FT-IR, and UV-Vis spectroscopy. The electrochemical behavior of the complexes was explored by cyclic voltammetry. Quadratic hyperpolarizabilities (beta) of the complexes have been determined by hyper-Rayleigh scattering (HRS) measurements at 1500 nm. The effect of donor abilities of different organometallic fragments on the quadratic hyperpolarizabilities was studied and correlated with spectroscopic and electrochemical data. Density functional theory (DFT) and time-dependent DFT (TDDFT) calculations were employed to get a better understanding of the second-order nonlinear optical properties in these complexes. In this series, the complexity of the push pull systems is revealed; even so, several trends in the second-order hyperpolarizability can still be recognized. In particular, the overall data seem to indicate that the existence of other electronic transitions in addition to the main MLCT clearly controls the effectiveness of the organometallic donor ability on the second-order NLO properties of these push pull systems.
Resumo:
New cationic ruthenium(II) complexes with the formula [Ru(eta(5)-C5H5)(LL)(1-BuIm)] [Z], with (LL) = 2PPh(3) or DPPE, and Z = CF3SO3-, PF6-, BPh4-, have been synthesized and fully characterized. Spectroscopic and electrochemical studies revealed that the electronic properties of the coordinated 1-butylimidazole were clearly influenced by the nature of the phosphane coligands (LL) and also by the different counter ions. The solid state structures of the six complexes determined by X-ray crystallographic studies, confirmed the expected distorted three-legged piano stool structure. However the geometry of the 1-butylimidazole ligand was found considerably different in all six compounds, being governed by the stereochemistry of the mono and bidentate coligands (PPh3 or DPPE).
Resumo:
[Ru(2,2'-bipyridine)(2)(Hdpa)](BF4)(2) center dot 2H(2)O (1), [Ru(1,10-phenanthroline)(2)(Hdpa)] (PF6)(2) center dot CH2Cl2 (2) and [Ru(4,4,4',4'-tetramethyl-2,2'- bisoxazoline)(2)(Hdpa)] (PF6)(2) (3) are synthesized where Hdpa is 2,2'-dipyridylamine. The X-ray crystal structures of 1 and 2 have been determined. Hdpa in 1 and 2 is found to bind the metal via the two pyridyl N ends. Comparing the NMR spectra in DMSO-d(6), it is concluded that 3 has a similar structure. The pK(a) values (for the dissociation of the NH proton in Hdpa) of free Hdpa and its complexes are determined in acetonitrile by exploiting molar conductance. These correlate linearly with the chemical shift of the NH proton in the respective entities. (C) 2007 Elsevier B.V. All rights reserved.
Resumo:
Reaction of cis-Ru(bisox)(2)Cl-2, where bisox is 4,4,4',4'-tetramethyl-2,2'-bisoxazoline, with excess of pyridine-2-carboxaldehyde (py-2-al) in 1:1 (v/v) methanol-water mixture under nitrogen atmosphere and subsequent addition of excess of NH4PF6 give [Ru(bisox)(2)(py-2-al)](PF6)(2)center dot H2O (1). Refluxing of 1 in dehydrated methanol in presence of triethylamine yields the corresponding hemiacetalate complex: [Ru(bisox)(2) (pyridine-2-(alpha-methoxymethanolato))] PF6 center dot 1.5H(2)O (2). Both the complexes have been characterised by single crystal X-ray crystallography, FTIR and NMR. In cyclic voltammetry in acetonitrile at a glassy carbon electrode, 2 displays a quasireversible Ru(II/III) couple at 1.08 V versus NHE which is not observed in 1. A tentative mechanism is proposed for the conversion of 1 to 2. DFT calculations with the LanL2DZ basis set have been performed to investigate these observations theoretically. (C) 2008 Elsevier B.V. All rights reserved.
Resumo:
Starting from previously reported cis-Ru(MeL)(2)Cl-2, where MeL is 4,4,4',4'-tetramethyl-2,2'-bisoxazoline, cis-Ru(MeL)(2)Br-2 (1), cis-Ru( MeL)(2)I-2 (2), cis-Ru(MeL)(2)(NCS)(2) center dot H2O (3), cis-Ru(MeL)(2)(N-3)(2) (4) and cis-[Ru(MeL)(2)(MeCN)(2)](PF6)(2) center dot (CH3)(2)CO (5) are synthesised. The X-ray crystal structures of complexes 1, 2, 3 and 5 have been determined. All the five new complexes have been characterized by FTIR, ESIMS and H-1 NMR. In cyclic voltammetry in acetonitrile at a glassy carbon electrode, the complexes display a quasireversible Ru(II/III) couple in the range 0.32-1.71 V versus NHE. The Ru(II/III) potentials yield a satisfactorily linear correlation with Chatt's ligand constants P-L for the monodantate ligands. From the intercept and by comparing the known situation in Ru(2,2'-bipyridine)(2)L-2, it is concluded that MeL, a non-aromatic diimine, is significantly more pi-acidic than 2,2'-bipyridine. (c) 2008 Elsevier B.V. All rights reserved.
Resumo:
Six ruthenium(II) complexes have been prepared using the tridentate ligands 2,6-bis(benzimidazolyl) pyridine and bis(2-benzimidazolyl methyl) amine and having 2,2'-bipyridine, 2,2':6',2 ''-terpyridine, PPh3, MeCN and chloride as coligands. The crystal structures of three of the complexes trans-[Ru(bbpH(2))(PPh3)(2)(CH3CN)I(ClO4)(2) center dot 2H(2)O (2), [Ru(bbpH(2))(bpy)Cl]ClO4 (3) and [Ru(bbpH(2))(terpy)](ClO4)(2) (4) are also reported. The complexes show visible region absorption at 402-517 nm, indicating that it is possible to tune the visible region absorption by varying the ancillary ligand. Luminescence behavior of the complexes has been studied both at RT and at liquid nitrogen temperature (LNT). Luminescence of the complexes is found to be insensitive to the presence of dioxygen. Two of the complexes [Ru(bbpH(2))(bpy)Cl]ClO4 (3) and [Ru(bbpH(2))(terpy]ClO4)(2) (4) show RT emission in the NIR region, having lifetime, quantum yield and radiative constant values suitable for their application as NIR emitter in the solid state devices. The DFT calculations on these two complexes indicate that the metal t(2g) electrons are appreciably delocalized over the ligand backbone. (C) 2006 Elsevier B.V. All rights reserved.
Resumo:
Three new ruthenium complexes of the formulae cis-[Ru(PPh3)(2)(BzTscbz)(2)] (1a), [Ru-2(PPh3)(2)(BzTscbz)(4)] (1b) and [Ru(PPh3)(2)(BzTscHbz)(2)](ClO4)(2) (2) [BzTscHbz = 4-(phenyl) thiosemicarbazone of benzaldehyde] have been synthesized and characterized by various physicochemical methods including X-ray structure determinations for 1a and 1b. The relative stabilities of the four-membered versus five-membered chelate rings formed by the deprotonated ligand BzTscbz are discussed on the basis of the experimental results and some semi-empirical as well as DFT calculations. (c) 2005 Elsevier Ltd. All rights reserved.
Resumo:
The effects of isoelectronic replacement of a neutral nitrogen donor atom by an anionic carbon atom in terpyridine ruthenium(II) complexes on the electronic and photophysical properties of the resulting N,C,N'- and C,N,N'-cyclometalated aryl ruthenium(II) complexes were investigated. To this end, a series of complexes was prepared either with ligands containing exclusively nitrogen donor atoms, that is, [Ru(R-1-tpy)(R-2-tpy)](2+) (R-1, R-2 = H, CO2Et), or bearing either one N,C,N'- or C,N,N'-cyclometalated ligand and one tpy ligand, that is, [Ru(R-1-(NCN)-C-Lambda-N-Lambda)(R-2-tpy)](+) and [Ru(R-1-(CNN)-N-Lambda-N-Lambda)(R-2-tpy)](+), respectively. Single-crystal X-ray structure determinations showed that cyclometalation does not significantly alter the overall geometry of the complexes but does change the bond lengths around the ruthenium(II) center, especially the nitrogen-to-ruthenium bond length trans to the carbanion. Substitution of either of the ligands with electron-withdrawing ester functionalities fine-tuned the electronic properties and resulted in the presence of an IR probe. Using trends obtained from redox potentials, emission energies, IR spectroelectrochemical responses, and the character of the lowest unoccupied molecular orbitals from DFT studies, it is shown that the first reduction process and luminescence are associated with the ester-substituted C,N,N'-cyclometalated ligand in [Ru(EtO2C-(CNN)-N-Lambda-N-Lambda)(tpy)](+). Cyclometalation in an N,C,N'-bonding motif changed the energetic order of the ruthenium d(zx), d(yz), and d(xy) orbitals. The red-shifted absorption in the N,C,N'-cyclometalated complexes is assigned to MLCT transitions to the tpy ligand. The red shift observed upon introduction of the ester moiety is associated with an increase in intensity of low-energy transitions, rather than a red shift of the main transition. Cyclometalation in the C,N,N'-binding motif also red-shifts the absorption, but the corresponding transition is associated with both ligand types. Luminescence of the cyclometalated complexes is relatively independent of the mode of cyclometalation, obeying the energy gap law within each individual series.