Detection of live and antibiotic-killed bacteria by quantitative real-time PCR of specific fragments of ribosomal RNA

RÉSUMÉ Le but d'un traitement antimicrobien est d'éradiquer une infection bactérienne. Cependant, il est souvent difficile d'en évaluer rapidement l'efficacité en utilisant les techniques standard. L'estimation de la viabilité bactérienne par marqueurs moléculaires permettrait d'accélérer le processus. Ce travail étudie donc la possibilité d'utiliser le RNA ribosomal (rRNA) à cet effet. Des cultures de Streptococcus gordonii sensibles (parent Wt) et tolérants (mutant Tol 1) à l'action bactéricide de la pénicilline ont été exposées à différents antibiotiques. La survie bactérienne au cours du temps a été déterminée en comparant deux méthodes. La méthode de référence par compte viable a été comparée à une méthode moléculaire consistant à amplifier par PCR quantitative en temps réel une partie du génome bactérien. La cible choisie devait refléter la viabilité cellulaire et par conséquent être synthétisée de manière constitutive lors de la vie de la bactérie et être détruite rapidement lors de la mort cellulaire. Le choix s'est porté sur un fragment du gène 16S-rRNA. Ce travail a permis de valider ce choix en corrélant ce marqueur moléculaire à la viabilité bactérienne au cours d'un traitement antibiotique bactéricide. De manière attendue, les S. gordonii sensibles à la pénicilline ont perdu ≥ 4 log10 CFU/ml après 48 heures de traitement par pénicilline alors que le mutant tolérant Tol1 en a perdu ≥ 1 log10 CFU/ml. De manière intéressant, la quantité de marqueur a augmenté proportionnellement au compte viable durant la phase de croissance bactérienne. Après administration du traitement antibiotique, l'évolution du marqueur dépendait de la capacité de la bactérie à survivre à l'action de l'antibiotique. Stable lors du traitement des souches tolérantes, la quantité de marqueur détectée diminuait de manière proportionnelle au compte viable lors du traitement des souches sensibles. Cette corrélation s'est confirmée lors de l'utilisation d'autres antibiotiques bactéricides. En conclusion, l'amplification par PCR du RNA ribosomal 16S permet d'évaluer rapidement la viabilité bactérienne au cours d'un traitement antibiotique en évitant le recours à la mise en culture dont les résultats ne sont obtenus qu'après plus de 24 heures. Cette méthode offre donc au clinicien une évaluation rapide de l'efficacité du traitement, particulièrement dans les situations, comme le choc septique, où l'initiation sans délai d'un traitement efficace est une des conditions essentielles du succès thérapeutique. ABSTRACT Assessing bacterial viability by molecular markers might help accelerate the measurement of antibiotic-induced killing. This study investigated whether ribosomal RNA (rRNA) could be suitable for this purpose. Cultures of penicillin-susceptible and penicillin-tolerant (Tol1 mutant) Streptococcus gordonii were exposed to mechanistically different penicillin and levofloxacin. Bacterial survival was assessed by viable counts, and compared to quantitative real-time PCR amplification of either the 16S-rRNA genes (rDNA) or the 16S rRNA, following reverse transcription. Penicillin-susceptible S. gordonii lost ≥ 4 log10 CFU/ml of viability over 48 h of penicillin treatment. In comparison, the Toll mutant lost ≤ 1 log10 CFU/ml. Amplification of a 427-base fragment of 16S rDNA yielded amplicons that increased proportionally to viable counts during bacterial growth, but did not decrease during drug-induced killing. In contrast, the same 427-base fragment amplified from 16S rDNA paralleled both bacterial growth and drug-induced killing. It also differentiated between penicillin-induced killing of the parent and the Toll mutant (≥4 log10 CFU/ml and ≤1 lo10 CFU/ml, respectively), and detected killing by mechanistically unrelated levofloxacin. Since large fragments of polynucleotides might be degraded faster than smaller fragments the experiments were repeated by amplifying a 119-base region internal to the origina1 427-base fragment. The amount of 119-base amplicons increased proportionally to viability during growth, but remained stable during drug treatment. Thus, 16S rRNA was a marker of antibiotic-induced killing, but the size of the amplified fragment was critical to differentiate between live and dead bacteria.

Non-invasive prenatal diagnosis of multiple endocrine neoplasia type 2A using COLD-PCR combined with HRM genotyping analysis from maternal serum.

The multiple endocrine neoplasia type 2A (MEN2A) is a monogenic disorder characterized by an autosomal dominant pattern of inheritance which is characterized by high risk of medullary thyroid carcinoma in all mutation carriers. Although this disorder is classified as a rare disease, the patients affected have a low life quality and a very expensive and continuous treatment. At present, MEN2A is diagnosed by gene sequencing after birth, thus trying to start an early treatment and by reduction of morbidity and mortality. We first evaluated the presence of MEN2A mutation (C634Y) in serum of 25 patients, previously diagnosed by sequencing in peripheral blood leucocytes, using HRM genotyping analysis. In a second step, we used a COLD-PCR approach followed by HRM genotyping analysis for non-invasive prenatal diagnosis of a pregnant woman carrying a fetus with a C634Y mutation. HRM analysis revealed differences in melting curve shapes that correlated with patients diagnosed for MEN2A by gene sequencing analysis with 100% accuracy. Moreover, the pregnant woman carrying the fetus with the C634Y mutation revealed a melting curve shape in agreement with the positive controls in the COLD-PCR study. The mutation was confirmed by sequencing of the COLD-PCR amplification product. In conclusion, we have established a HRM analysis in serum samples as a new primary diagnosis method suitable for the detection of C634Y mutations in MEN2A patients. Simultaneously, we have applied the increase of sensitivity of COLD-PCR assay approach combined with HRM analysis for the non-invasive prenatal diagnosis of C634Y fetal mutations using pregnant women serum.

Detection of live and antibiotic-killed bacteria by quantitative real-time PCR of specific fragments of rRNA.

Assessing bacterial viability by molecular markers might help accelerate the measurement of antibiotic-induced killing. This study investigated whether rRNA could be suitable for this purpose. Cultures of penicillin-susceptible and penicillin-tolerant (Tol1 mutant) Streptococcus gordonii were exposed to mechanistically different penicillin and levofloxacin. Bacterial survival was assessed by viable counts and compared to quantitative real-time PCR amplification of either the 16S rRNA genes or the 16S rRNA, following reverse transcription. Penicillin-susceptible S. gordonii lost > or =4 log(10) CFU/ml of viability over 48 h of penicillin treatment. In comparison, the Tol1 mutant lost < or =1 log(10) CFU/ml. Amplification of a 427-bp fragment of 16S rRNA genes yielded amplicons that increased proportionally to viable counts during bacterial growth but did not decrease during drug-induced killing. In contrast, the same 427-bp fragment amplified from 16S rRNA paralleled both bacterial growth and drug-induced killing. It also differentiated between penicillin-induced killing of the parent and the Tol1 mutant (> or =4 log(10) CFU/ml and < or =1 log(10) CFU/ml, respectively) and detected killing by mechanistically unrelated levofloxacin. Since large fragments of polynucleotides might be degraded faster than smaller fragments, the experiments were repeated by amplifying a 119-bp region internal to the original 427-bp fragment. The amount of 119-bp amplicons increased proportionally to viability during growth but remained stable during drug treatment. Thus, 16S rRNA was a marker of antibiotic-induced killing, but the size of the amplified fragment was critical for differentiation between live and dead bacteria.

Combining RT-PCR-seq and RNA-seq to catalog all genic elements encoded in the human genome.

Within the ENCODE Consortium, GENCODE aimed to accurately annotate all protein-coding genes, pseudogenes, and noncoding transcribed loci in the human genome through manual curation and computational methods. Annotated transcript structures were assessed, and less well-supported loci were systematically, experimentally validated. Predicted exon-exon junctions were evaluated by RT-PCR amplification followed by highly multiplexed sequencing readout, a method we called RT-PCR-seq. Seventy-nine percent of all assessed junctions are confirmed by this evaluation procedure, demonstrating the high quality of the GENCODE gene set. RT-PCR-seq was also efficient to screen gene models predicted using the Human Body Map (HBM) RNA-seq data. We validated 73% of these predictions, thus confirming 1168 novel genes, mostly noncoding, which will further complement the GENCODE annotation. Our novel experimental validation pipeline is extremely sensitive, far more than unbiased transcriptome profiling through RNA sequencing, which is becoming the norm. For example, exon-exon junctions unique to GENCODE annotated transcripts are five times more likely to be corroborated with our targeted approach than with extensive large human transcriptome profiling. Data sets such as the HBM and ENCODE RNA-seq data fail sampling of low-expressed transcripts. Our RT-PCR-seq targeted approach also has the advantage of identifying novel exons of known genes, as we discovered unannotated exons in ~11% of assessed introns. We thus estimate that at least 18% of known loci have yet-unannotated exons. Our work demonstrates that the cataloging of all of the genic elements encoded in the human genome will necessitate a coordinated effort between unbiased and targeted approaches, like RNA-seq and RT-PCR-seq.

Statistical significance of quantitative PCR.

BACKGROUND: PCR has the potential to detect and precisely quantify specific DNA sequences, but it is not yet often used as a fully quantitative method. A number of data collection and processing strategies have been described for the implementation of quantitative PCR. However, they can be experimentally cumbersome, their relative performances have not been evaluated systematically, and they often remain poorly validated statistically and/or experimentally. In this study, we evaluated the performance of known methods, and compared them with newly developed data processing strategies in terms of resolution, precision and robustness. RESULTS: Our results indicate that simple methods that do not rely on the estimation of the efficiency of the PCR amplification may provide reproducible and sensitive data, but that they do not quantify DNA with precision. Other evaluated methods based on sigmoidal or exponential curve fitting were generally of both poor resolution and precision. A statistical analysis of the parameters that influence efficiency indicated that it depends mostly on the selected amplicon and to a lesser extent on the particular biological sample analyzed. Thus, we devised various strategies based on individual or averaged efficiency values, which were used to assess the regulated expression of several genes in response to a growth factor. CONCLUSION: Overall, qPCR data analysis methods differ significantly in their performance, and this analysis identifies methods that provide DNA quantification estimates of high precision, robustness and reliability. These methods allow reliable estimations of relative expression ratio of two-fold or higher, and our analysis provides an estimation of the number of biological samples that have to be analyzed to achieve a given precision.

Real-time quantitative PCR assay for measurement of bird telomeres

We present the application of a real-time quantitative PCR assay, previously developed to measure relative telomere length in humans and mice, to two bird species, the zebra finch Taeniopygia guttata and the Alpine swift Apus melba. This technique is based on the PCR amplification of telomeric (TTAGGG)(n) sequences using specific oligonucleotide primers. Relative telomere length is expressed as the ratio (T/S) of telomere repeat copy number (T) to control single gene copy number (S). This method is particularly useful for comparisons of individuals within species, or where the same individuals are followed longitudinally. We used glyceraldehyde-3-phosphate dehydrogenase (GAPDH) as a single control gene. In both species, we validated our PCR measurements of relative telomere length against absolute measurements of telomere length determined by the conventional method of quantifying telomere terminal restriction fragment (TRF) lengths using both the traditional Southern blot analysis (Alpine swifts) and in gel hybridization (zebra finches). As found in humans and mice, telomere lengths in the same sample measured by TRF and PCR were well correlated in both the Alpine swift and the zebra finch.. Hence, this PCR assay for measurement of bird telomeres, which is fast and requires only small amounts of genomic DNA, should open new avenues in the study of environmental factors influencing variation in telomere length, and how this variation translates into variation in cellular and whole organism senescence.

RT-PCR and Dot Blot hybridization methods for a universal detection of tospoviruses

Transcriptase reverse - polymerase chain reaction (RT-PCR) and dot blot hybridization with digoxigenin-labeled probes were applied for the universal detection of Tospovirus species. The virus species tested were Tomato spotted wilt virus, Tomato chlorotic spot virus, Groundnut ringspot virus, Chrysanthemum stem necrosis virus, Impatiens necrotic spot virus, Zucchini lethal chlorosis virus, Iris yellow spot virus. Primers for PCR amplification were designed to match conserved regions of the tospovirus genome. RT-PCR using distinct primer combinations was unable to simultaneously amplify all tospovirus species and consistently failed to detect ZLCV and IYSV in total RNA extracts. However, all tospovirus species were detected by RT-PCR when viral RNA was used as template. RNA-specific PCR products were used as probes for dot hybridization. This assay with a M probe (directed to the G1/G2 gene) detected at low stringency conditions all Tospovirus species, except IYSV. At low stringency conditions, the L non-radioactive probe detected the seven Tospovirus species in a single assay. This method for broad spectrum detection can be potentially employed in quarantine services for indexing in vitro germplasm.

Print-capture PCR for detection of tomato begomoviruses from plants and whiteflies

Print-capture (PC) Polymerase chain reaction (PCR) was evaluated as a novel detection method of plant viruses. Tomato (Lycopersicon esculentum) plants infected with begomovirus (fam. Geminiviridae, gen. Begomovirus) and viruliferous whiteflies were used to study the efficiency of the method. Print-capturing steps were carried out using non-charged nylon membrane or filter paper as the solid support for DNA printings. Amplified DNA fragments of expected size were consistently obtained by PCR from infected plants grown in a greenhouse, after direct application of printed materials to the PCR mix. However, virus detection from a single whitefly and from field-grown tomato samples required a high temperature treatment of printed material prior to PCR amplification. Comparison of nylon membrane and filter paper as the solid support revealed the higher efficiency of the nylon membrane. The application of print-capture PCR reduces the chances of false-positive amplification by reducing manipulation steps during preparation of the target DNA. This method maintains all the advantages of PCR diagnosis, such as the high sensitivity and no requirement of radioactive reagents.

HLA-DQA1 allele typing by nonisotopic PCR-LIS-SSCP

In the present study we used a simple and reliable method for HLA-DQA1 allele typing based on the single-stranded conformation polymorphism (SSCP) properties of DNA molecules obtained by PCR. The technique consists of PCR amplification of a DNA fragment comprising the second exon of the HLA-DQA1 gene, amplicon denaturation using a low ionic strength solution (LIS), and electrophoresis on a small native polyacrylamide gel, followed by a rapid silver staining procedure. In order to validate the technique and to obtain the allele patterns for the DQA1 gene, 50 cervical samples were typed using this methodology and the commercial Amplitype® HLA DQA1 Amplification and Typing kit. All the alleles detected with the kit were characterized by the LIS-SSCP approach. This procedure proved to be useful for population screening and typing of the DQA1 gene as well as for detecting new alleles or mutations in the donor-recipient molecular matching of HLA class II genes.

Detection and enumeration of sulphate-reducing bacteria in estuarine sediments by competitive PCR

The distribution of sulphate-reducing bacteria (SRB) in the sediments of the Colne River estuary, Essex, UK covering different saline concentrations of sediment porewater was investigated by the use of quantitative competitive PCR. Here, we show that a new PCR primer set and a new quantitative method using PCR are useful tools for the detection and the enumeration of SRB in natural environments. A PCR primer set selective for the dissimilatory sulphite reductase gene (dsr) of SRB was designed. PCR amplification using the single set of dsr-specific primers resulted in PCR products of the expected size from all 27 SRB strains tested, including Gram-negative and positive species. Sixty clones derived from sediment DNA using the primers were sequenced and all were closely related with the predicted dsr of SRB. These results indicate that PCR using the newly designed primer set are useful for the selective detection of SRB from a natural sample. This primer set was used to estimate cell numbers by dsr selective competitive PCR using a competitor, which was about 20% shorter than the targeted region of dsr. This procedure was applied to sediment samples from the River Colne estuary, Essex, UK together with simultaneous measurement of in situ rates of sulphate reduction. High densities of SRB ranging from 0.2 - 5.7 × 108 cells ml-1 wet sediment were estimated by the competitive PCR assuming that all SRB have a single copy of dsr. Using these estimates cell specific sulphate reduction rates of 10-17 to 10-15 mol of SO42- cell-1 day-1 were calculated, which is within the range of, or lower than, those previously reported for pure cultures of SRB. Our results show that the newly developed competitive PCR technique targeted to dsr is a powerful tool for rapid and reproducible estimation of SRB numbers in situ and is superior to the use of culture-dependent techniques.

Development of a PCR-based assay for rapid and reliable identification of pathogenic Fusaria

Identification of Fusarium species has always been difficult due to confusing phenotypic classification systems. We have developed a fluorescent-based polymerase chain reaction assay that allows for rapid and reliable identification of five toxigenic and pathogenic Fusarium species. The species includes Fusarium avenaceum, F. culmorum, F. equiseti, F. oxysporum and F. sambucinum. The method is based on the PCR amplification of species-specific DNA fragments using fluorescent oligonucleotide primers, which were designed based on sequence divergence within the internal transcribed spacer region of nuclear ribosomal DNA. Besides providing an accurate, reliable, and quick diagnosis of these Fusaria, another advantage with this method is that it reduces the potential for exposure to carcinogenic chemicals as it substitutes the use of fluorescent dyes in place of ethidium, bromide. Apart from its multidisciplinary importance and usefulness, it also obviates the need for gel electrophoresis. (C) 2002 Published by Elsevier Science B.V. on behalf of the Federation of European Microbiological Societies.

Padronização da metodologia do RT-PCR utilizado para identificação do mRNA da alfa-amilase em sementes de milho

Durante a germinação das sementes, os carboidratos de reserva são degradados pela atividade de a-amilase. A identificação de mRNA é uma ferramenta fundamental para a definição da cinética de síntese de alfa-amilase. Objetivou-se padronizar a metodologia do RT-PCR para identificar o mRNA do gene de a-amilase em sementes de milho. Após três dias de germinação das cultivares Saracura-BRS 4154 e CATI-AL34, extraiu-se o RNA total pelo método do tiocianato de guanidina-fenol-clorofórmio, com algumas modificações. A partir do RNA total extraído foi obtido cDNA com utilização de random primers. A amplificação por PCR de uma porção do gene da alfa-amilase foi realizada com os primers: sense - CGACATCGACCACCTCAAC; antisense - TTGACCAGCTCCTGCCTGTC; gelatina; DMSO e 1,25 unidades de Taq DNA polimerase por reação e completados com água tratada com DEPC. Os ciclos para a amplificação foram 94ºC durante 4 minutos, seguidos por 34 ciclos de 94ºC durante 1 minuto, 42ºC durante 1 minuto e 72ºC durante 1,5 minutos e, finalmente, 72ºC por 5 minutos. O produto do RT-PCR apresentou uma banda de 249 pares de base (pb) bem definida, para as duas cultivares estudadas, não ocorrendo bandas inespecíficas. A técnica do RT-PCR mostrou ser uma metodologia eficiente para a identificação da expressão de alfa-amilase durante a germinação das sementes e pode ser usado para estudo qualitativo e quantitativo da cinética de síntese dessa enzima em experimentos de germinação.

Avaliação de dois métodos de extração de DNA de material parafinado para amplificação em PCR

Coordenação de Aperfeiçoamento de Pessoal de Nível Superior (CAPES)

Real-time PCR assay targeting the actin gene for the detection of Cryptosporidium parvum in calf fecal samples

Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)

Detecção de Histophilus somni (Haemophilus somnus) no sêmen bovino mediante reação em cadeia pela polimerase (PCR)

The present study evaluated the use of PCR for Histophilus somni detection in bovine semen. Semen samples were experimentally infected with H. somni at dilutions ranging from 107 to 101 bacteria/mL and subjected to DNA extraction by the phenol/chloroform method, followed by PCR amplification. The amplification products were analyzed by electrophoresis in 8% acrylamide gel. The oligonucleotide primers used yielded an amplification fragment of 400 base pairs from the bacterial DNA. Positive amplification was obtained even for the 101 bacteria/mL dilution. PCR proved to be an efficient method for the detection of H. somni. The results obtained in this study have brought relevant information for the diagnosis of H. somni, justifying the need for the diagnosis of this bacterium in bulls, especially in semen samples that should be free of contamination. The PCR method has shown to be a useful tool for the quality control of semen produced in artificial insemination centers.