994 resultados para Loop Region
Resumo:
In the present paper, nucleotide sequences (925-929 bases) of the mitochondrial D-loop region and complete cytochrome b gene (1140 bases) were determined and analysed to investigate the systematic status of the genus Distoechodon . CSB1, CSB2, CSB3, CSB-D and ETAS were successfully identified in the D-loop region. The sequence variations among different samples suggest that Distoechodon compressus is a valid species and has its distribution in Taiwan, and that D. tumirostris multispinnis does not seem to be a valid species.
Resumo:
C-type lectins are a superfamily of carbohydrate-recognition proteins which play crucial roles in the innate immunity. In this study, a novel multidomain C-type lectin gene from scallop Chlamys farreri (designated as Cflec-4) was cloned by RACE approach based on EST analysis. The full-length cDNA of Cflec-4 was of 2086 bp. The open reading frame was of 1830 bp and encoded a polypeptide of 609 amino acids, including a signal sequence and four dissimilar carbohydrate-recognition domains (CRDs). The deduced amino acid sequence of CflecA shared high similarities to other C-type lectin family members. The phylogenetic analysis revealed the divergence between the three N-terminal CRDs and the C-terminal one, suggesting that the four CRDs in Cflec-4 originated by repeated duplication of different primordial CRD. The potential tertiary structure of each CRD in Cflec-4 was typical double-loop structure with Ca2+-binding site 2 in the long loop region and two conserved disulfide bridges at the bases of the loops. The tissue distribution of Cflec-4 mRNA was examined by fluorescent quantitative real-time PCR. In the healthy scallops, the Cflec-4 transcripts could be only detected in gonad and hepatopancreas, whereas in the Listonella anguillarum challenged scallops, it could be also detected in hemocytes. These results collectively suggested that CflecA was involved in the immune defense of scallop against pathogen infection and provided new insight into the evolution of C-type lectin superfamily. (C) 2009 Elsevier Ltd. All rights reserved.
Resumo:
The two enantiomers of [Ru(bpy)2(bbtb)]2+ {bpy = 2,2'-bipyridine; bbtb = 4,4'-bis(benzothiazol-2-yl)-2,2'-bipyridine} have been isolated and fully characterised. Both enantiomers have been shown to have a strong association with calf thymus DNA by UV/visible absorption, emission and CD spectroscopy, with the lambda enantiomer having the greater affinity. The binding of both enantiomeric forms of [Ru(bpy)2(Me2bpy)]2+ and [Ru(bpy)2(bbtb)]2+ {Me2bpy = 4,4'-dimethyl-2,2'-bipyridine} to a range of oligonucleotides, including an octadecanucleotide and an icosanucleotide which contain hairpin-sequences, have been studied using a fluorescent intercalator displacement (FID) assay. The complex [Ru(bpy)2(bbtb)]2+ exhibited an interesting association to hairpin oligonucleotides, again with the lambda enantiomer binding more strongly. A 1H NMR spectroscopic study of the binding of both enantiomers of [Ru(bpy)2(bbtb)]2+ to the icosanucleotide d(CACTGGTCTCTCTACCAGTG) was conducted. This sequence contains a seven-base-pair duplex stem and a six-base hairpin-loop. The investigation gave an indication of the relative binding of the complexes between the two different regions (duplex and secondary structure) of the oligonucleotide. The results suggest that both enantiomers bind at the hairpin, with the ruthenium centre located at the stem-loop interface. NOE studies indicate that one of the two benzothiazole substituents of the bbtb ligand projects into the loop-region. A simple model of the metal complex/oligonucleotide adduct was obtained by means of molecular modelling simulations. The results from this study suggest that benzothiazole complexes derived from inert polypyridine ruthenium(II) complexes could lead to the development of new fluorescent DNA hairpin binding agents.
Resumo:
An octadecapeptide was isolated from the skin secretions of the dusky gopher frog (Rana sevosa) on the basis of histamine release from rat peritoneal mast cells. This peptide was purified to homogeneity by HPLC and found to have the following primary structure, YLKGCWTKSYPPKPCFSR, using both Edman degradation chemistry and peptide sequencing using high-resolution mass spectrometry (Q-TOF MS). The peptide, named peptide Tyrosine Arginine (pYR) shares 77.8% homology with peptide Leucine Arginine (pLR). The effects of the natural amidated peptide, non-amidated peptide and C-loop region of pYR on granulopoiesis and neutrophil apoptosis were investigated. All three analogues inhibited the early development of granulocyte macrophage colonies from bone marrow stem cells but did not induce apoptosis of the end stage granulocytes, the mature neutrophil. Thus, pYR is a novel member of an important and emerging new class of amphibian peptides with hemopoietic actions. (c) 2004 Elsevier Inc. All rights reserved.
Resumo:
The present study investigated promoter hypermethylation of TP53 regulatory pathways providing a potential link between epigenetic changes and mitochondrial DNA (mtDNA) alterations in breast cancer patients lacking a TP53 mutation. The possibility of using the cancer-specific alterations in serum samples as a blood-based test was also explored. Triple-matched samples (cancerous tissues, matched adjacent normal tissues and serum samples) from breast cancer patients were screened for TP53 mutations, and the promoter methylation profile of P14(ARF), MDM2, TP53 and PTEN genes was analyzed as well as mtDNA alterations, including D-loop mutations and mtDNA content. In the studied cohort, no mutation was found in TP53 (DNA-binding domain). Comparison of P14(ARF) and PTEN methylation patterns showed significant hypermethylation levels in tumor tissues (P < 0.05 and <0.01, respectively) whereas the TP53 tumor suppressor gene was not hypermethylated (P < 0.511). The proportion of PTEN methylation was significantly higher in serum than in the normal tissues and it has a significant correlation to tumor tissues (P < 0.05). mtDNA analysis revealed 36.36% somatic and 90.91% germline mutations in the D-loop region and also significant mtDNA depletion in tumor tissues (P < 0.01). In addition, the mtDNA content in matched serum was significantly lower than in the normal tissues (P < 0.05). These data can provide an insight into the management of a therapeutic approach based on the reversal of epigenetic silencing of the crucial genes involved in regulatory pathways of the tumor suppressor TP53. Additionally, release of significant aberrant methylated PTEN in matched serum samples might represent a promising biomarker for breast cancer.
Resumo:
The endemic pink pigeon has recovered from less than 20 birds in the mid-1970s to 355 free-living individuals in 2003. A major concern for the species' recovery has been the potential genetic problem of inbreeding. Captive pink pigeons bred for reintroduction were managed to maximise founder representation and minimise inbreeding. In this paper, we quantify the effect of inbreeding on survival and reproductive parameters in captive and wild populations and quantify DNA sequence variation in the mitochondrial d-loop region for pink pigeon founders. Inbreeding affected egg fertility, squab, juvenile and adult survival, but effects were strongest in highly inbred birds (F≥0.25). Inbreeding depression was more apparent in free-living birds where even moderate levels of inbreeding affected survival, although highly inbred birds were equally compromised in both captive and wild populations. Mitochondrial DNA haplotypic diversity in pink pigeon founders is low, suggesting that background inbreeding is contributing to low fertility and depressed productivity in this species, as well as comparable survival of some groups of non-inbred and nominally inbred birds. Management of wild populations has boosted population growth and may be required long-term to offset the negative effects of inbreeding depression and enhance the species' survival.
Resumo:
Estrogen Receptor (ER) is an important target for pharmaceutical design. Like other ligand-dependent transcription factors, hormone binding regulates ER transcriptional activity. Nevertheless, the mechanisms by which ligands enter and leave ERs and other nuclear receptors remain poorly understood. Here, we report results of locally enhanced sampling molecular dynamics simulations to identify dissociation pathways of two ER ligands [the natural hormone 17 beta-estradiol (E-2) and the selective ER modulator raloxifene (RAL)] from the human ER alpha ligand-binding domain in monomeric and dimeric forms. E-2 dissociation occurs via three different pathways in ER monomers. One resembles the mousetrap mechanism (Path I), involving repositioning of helix 12 (H12), others involve the separation of H8 and H11 (Path II), and a variant of this pathway at the bottom of the ligand-binding domain (Path II`). RAL leaves the receptor through Path I and a Path I variant in which the ligand leaves the receptor through the loop region between H11 and H12 (Path I`). Remarkably, ER dimerization strongly suppresses Paths II and II` for E-2 dissociation and modifies RAL escape routes. We propose that differences in ligand release pathways detected in the simulations for ER monomers and dimers provide an explanation for previously observed effects of ER quaternary state on ligand dissociation rates and suggest that dimerization may play an important, and hitherto unexpected, role in regulation of ligand dissociation rates throughout the nuclear receptor family.
Resumo:
Except for the meat- and egg-type strains used in commercial poultry farms in Brazil, there are no scientific reports about the origin of birds from the genus Gallus that have been introduced in this country with domestication or fighting purposes. Therefore, the aim of this study was to identify the position of the Brazilian Game Bird in the phylogenetic tree of the genus Gallus by nucleotide sequence analysis of the mitochondrial DNA D-loop region. The results indicate that fighting roosters comprise two different clusters within the species Gallus gallus domesticus. One of the clusters is related to the wild ancestors, while the other one is more related to the birds raised by the poultry industry. In conclusion, Brazilian fighting roosters have originated from the red jungle fowl (Gallus gallus) and belong to the subspecies Gallus gallus domesticus.
Resumo:
Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)
Resumo:
The complete amino acid sequence of myotoxin II (godMT-II), a myotoxic phospholipase A( 2 )(PLA(2)) homologue from the venom of the Central American crotaline snake Cerrophidion (Bothrops) godmani, was determined by direct protein sequencing methods. GodMT-II is a class II PLA, showing a Lys instead of Asp at position 49. An additional substitution in the calcium binding loop region (Asn instead of Tyr at position 28) suggests the lack of enzymatic activity observed in this toxin is due to loss of its ability to bind the co-factor Ca2+, since the residues involved in forming the catalytic network of PLA(2)s (His-48, Tyr-52 and Asp-99) an conserved in godMT-II. This myotoxin shows highest sequence homology with other Lys-49 PLA(2)s from Bothrops, Agkistrodon and Trimeresurus species, suggesting that they constitute a conserved family of proteins, yet in contrast presents lower homology with Bothrops asper myotoxin III, a catalytically-active PLA(2). The C-terminal region of godMT-II, which is rich in cationic and hydrophobic residues, shares high sequence homology to the corresponding region in the myotoxin II from B. asper, which has been proposed to play an important role in the Ca2+-independent membrane damaging activity. (C) 1998 Elsevier B.V. B.V. All rights reserved.
Resumo:
Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)
Resumo:
Coordenação de Aperfeiçoamento de Pessoal de Nível Superior (CAPES)
Resumo:
Scomberomorus cavalla é uma espécie de peixe pelágico amplamente distribuído na costa oeste do Atlântico, e uma diminuição no seu nível de captura tem sido verificada nos E.U.A e Golfo do México, comparada com os níveis alcançados pela espécie no passado. Da mesma forma, em algumas áreas do Brasil, há indícios de sobre-exploração. Entretanto, não existem estudos moleculares que visam o manejo deste importante item. Desta forma, no presente estudo, foram seqüenciados 380 pares de bases nucleotídicas da região da Alça-D do DNA mitocondrial de amostras provenientes de desembarque em Macapá, Bragança e Fortaleza. As análises filogenéticas e populacionais revelaram que há apenas uma população panmítica e baixos níveis de variabilidade genética foram observados. Estes resultados, assim como a observada sobre-exploração de S. cavala, representam dados muito importantes para o estabelecimento do manejo deste estoque a fim de prevenir um colapso ou risco de extinção no futuro.
Resumo:
Pós-graduação em Biotecnologia - IQ
Resumo:
Background: The first stages of HIV-1 infection are essential to establish the diversity of virus population within host. It has been suggested that adaptation to host cells and antibody evasion are the leading forces driving HIV evolution at the initial stages of AIDS infection. In order to gain more insights on adaptive HIV-1 evolution, the genetic diversity was evaluated during the infection time in individuals contaminated by the same viral source in an epidemic cluster. Multiple sequences of V3 loop region of the HIV-1 were serially sampled from four individuals: comprising a single blood donor, two blood recipients, and another sexually infected by one of the blood recipients. The diversity of the viral population within each host was analyzed independently in distinct time points during HIV-1 infection. Results: Phylogenetic analysis identified multiple HIV-1 variants transmitted through blood transfusion but the establishing of new infections was initiated by a limited number of viruses. Positive selection (d(N)/d(S)>1) was detected in the viruses within each host in all time points. In the intra-host viruses of the blood donor and of one blood recipient, X4 variants appeared respectively in 1993 and 1989. In both patients X4 variants never reached high frequencies during infection time. The recipient, who X4 variants appeared, developed AIDS but kept narrow and constant immune response against HIV-1 during the infection time. Conclusion: Slowing rates of adaptive evolution and increasing diversity in HIV-1 are consequences of the CD4+ T cells depletion. The dynamic of R5 to X4 shift is not associated with the initial amplitude of humoral immune response or intensity of positive selection.