987 resultados para Genomic library
Resumo:
Evolution through natural selection suggests unnecessary genes are lost. We observed that the yeast Candida glabrata lost the gene encoding a phosphate-repressible acid phosphatase (PHO5) present in many yeasts including Saccharomyces cerevisiae. However, C. glabrata still had phosphate starvation-inducible phosphatase activity. Screening a C. glabrata genomic library, we identified CgPMU2, a member of a three-gene family that contains a phosphomutase-like domain. This small-scale gene duplication event could allow for sub- or neofunctionalization. On the basis of phylogenetic and biochemical characterizations, CgPMU2 has neofunctionalized to become a broad range, phosphate starvation-regulated acid phosphatase, which functionally replaces PHO5 in this pathogenic yeast. We determined that CgPmu2, unlike ScPho5, is not able to hydrolyze phytic acid (inositol hexakisphosphate). Phytic acid is present in fruits and seeds where S. cerevisiae grows, but is not abundant in mammalian tissues where C. glabrata grows. We demonstrated that C. glabrata is limited from an environment where phytic acid is the only source of phosphate. Our work suggests that during evolutionary time, the selection for the ancestral PHO5 was lost and that C. glabrata neofunctionalized a weak phosphatase to replace PHO5. Convergent evolution of a phosphate starvation-inducible acid phosphatase in C. glabrata relative to most yeast species provides an example of how small changes in signal transduction pathways can mediate genetic isolation and uncovers a potential speciation gene.
Resumo:
GC-rich molecular minisatellite probes isolated from the human genome have presented a poor ability for individualization in horses. In this study new DNA sequences were isolated which could be used in paternity tests in horses. Genomic DNA from "Mangalarga-Marchador" horses was treated with restriction enzymes that preferentially digest non-repetitive sequences, so preserving the structure where mini and microsatellites are located. Four clones (S01, S05, S07 and S09) selected from a genomic library screened with a (TG)n oligonucleotide showed similar hybridization profiles generating bands of DNA-fingerprinting type. Using these probes the individualization power obtained was 10-8, which is 10(5)fold higher than that obtained with M13, another GC-rich type probe. All clones were efficient in parentage detection in crossbreedings and presented a 27 bp consensus sequence, GTTTCATTTATTATTCTTTGGAAGAAA, which was repeated 12, 18, 11 and 21 times in clones S01, S05, S07 and S09, respectively.
Resumo:
Pseudomonas fluorescens CHA0 and the related strain Pf-5 are well-characterized representatives of rhizosphere bacteria that have the capacity to protect crop plants from fungal root diseases, mainly by releasing a variety of exoproducts that are toxic to plant pathogenic fungi. Here, we report that the two plant-beneficial pseudomonads also exhibit potent insecticidal activity. Anti-insect activity is linked to a novel genomic locus encoding a large protein toxin termed Fit (for P. fluorescensinsecticidal toxin) that is related to the insect toxin Mcf (Makes caterpillars floppy) of the entomopathogen Photorhabdus luminescens, a mutualist of insect-invading nematodes. When injected into the haemocoel, even low doses of P. fluorescens CHA0 or Pf-5 killed larvae of the tobacco hornworm Manduca sexta and the greater wax moth Galleria mellonella. In contrast, mutants of CHA0 or Pf-5 with deletions in the Fit toxin gene were significantly less virulent to the larvae. When expressed from an inducible promoter in a non-toxic Escherichia coli host, the Fit toxin gene was sufficient to render the bacterium toxic to both insect hosts. Our findings establish the Fit gene products of P. fluorescens CHA0 and Pf-5 as potent insect toxins that define previously unappreciated anti-insect properties of these plant-colonizing bacteria
Resumo:
The mutants of Saccharomyces cerevisiae assigned to complementation group G199 are deficient in mitochondrial respiration and lack a functional cytochrome oxidase complex. Recombinant plasmids capable of restoring respiration were cloned by transformation of mutants of this group with a yeast genomic library. Sequencing indicated that a 2.1-kb subclone encompasses the very end (last 11 amino acids) of the PET111 gene, the COX7 gene and a new gene (YMR255W) of unknown function that potentially codes for a polypeptide of 188 amino acids (about 21.5 kDa) without significant homology to any known protein. We have shown that the respiratory defect corresponding to group G199 is complemented by plasmids carrying only the COX7 gene. The gene YMR255W was inactivated by one-step gene replacement and the disrupted strain was viable and unaffected in its ability to grow in a variety of different test media such as minimal or complete media using eight distinct carbon sources at three pH values and temperatures. Inactivation of this gene also did not affect mating or sporulation
Resumo:
A spontaneous fluoroquinolone-resistant mutant (STM1) was isolated from its parent Salmonella enterica serovar Typhi (S. Typhi) clinical isolate. Unlike its parent isolate, this mutant has selective resistance to fluoroquinolones without any change in its sensitivity to various other antibiotics. DNA gyrase assays revealed that the fluoroquinolone resistance phenotype of the STM1 mutant did not result from alteration of the fluoroquinolone sensitivity of the DNA gyrase isolated from it. To study the mechanism of fluoroquinolone resistance, a genomic library from the STM1 mutant was constructed in Escherichia coli DH5α and two recombinant plasmids were obtained. Only one of these plasmids (STM1-A) conferred the selective fluoroquinolone resistance phenotype to E. coli DH5α. The chromosomal insert from STM1-A, digested with EcoRI and HindIII restriction endonucleases, produced two DNA fragments and these were cloned separately into pUC19 thereby generating two new plasmids, STM1-A1 and STM1-A2. Only STM1-A1 conferred the selective fluoroquinolone resistance phenotype to E. coli DH5α. Sequence and subcloning analyses of STM1-A1 showed the presence of an intact RecA open reading frame. Unlike that of the wild-type E. coli DH5α, protein analysis of a crude STM1-A1 extract showed overexpression of a 40 kDa protein. Western blotting confirmed the 40 kDa protein band to be RecA. When a RecA PCR product was cloned into pGEM-T and introduced into E. coli DH5α, the STM1-A11 subclone retained fluoroquinolone resistance. These results suggest that overexpression of RecA causes selective fluoroquinolone resistance in E. coli DH5α.
Resumo:
Cashew (Anacardium occidentale L.) is the most economically important tropical nut crop in the world, and yet there are no sequence tagged site (STS) markers available for its study. Here we use an automated, high-throughput system to isolate cashew microsatellites from a non-enriched genomic library blotted onto membranes at high density for screening. Sixty-five sequences contained a microsatellite array, of which 21 proved polymorphic among a closely related seed garden population of 49 genotypes. Twelve markers were suitable for multiplex analysis. Of these, 10 amplified in all three related tropical tree species tested: Anacardium microcarpum, Anacardium pumilum and Anacardium nanum.
Resumo:
A genomic library of Bifidobacterium bifidum (NCIMB 41171) DNA was constructed in Escherichia coli RA11r (melA(-)B(+)) and one alpha-galactosidase encoding gene was isolated. Conceptual translation combined with insertional mutagenesis analysis indicated an open reading frame (ORF) of 759 amino acid (aa) residues encoding an alpha-galactosidase (named as MelA) of 82.8 kDa. Partial purification and characterisation showed that the enzyme had an apparent native molecular mass of a parts per thousand 243 kDa and a subunit size of a parts per thousand 85 kDa. The enzyme belongs to glycosyl hydrolases 36 family with high aa sequence similarities (a parts per thousand 73%) to other known alpha-galactosidases of bifidobacterial origin. Under optimum pH conditions for activity (pH 6.0) and high melibiose concentration (40% w/v), the enzyme was able to form oligosaccharides with degree of polymerisation (DP) a parts per thousand yen3 at higher concentration than DP = 2, with a total yield of 20.5% (w/w).
Resumo:
Zinc (Zn) and cadmium (Cd) hyperaccumulation may have evolved twice in the Brassicaceae, in Arabidopsis halleri and in the Noccaea genus. Tandem gene duplication and deregulated expression of the Zn transporter, HMA4, has previously been linked to Zn/Cd hyperaccumulation in A. halleri. Here, we tested the hypothesis that tandem duplication and deregulation of HMA4 expression also occurs in Noccaea. A Noccaea caerulescens genomic library was generated, containing 36,864 fosmid pCC1FOS (TM) clones with insert sizes similar to 20-40 kbp, and screened with a PCR-generated HMA4 genomic probe. Gene copy number within the genome was estimated through DNA fingerprinting and pooled fosmid pyrosequencing. Gene copy numbers within individual clones was determined by PCR analyses with novel locus specific primers. Entire fosmids were then sequenced individually and reads equivalent to 20-fold coverage were assembled to generate complete whole contigs. Four tandem HMA4 repeats were identified in a contiguous sequence of 101,480 bp based on sequence overlap identities. These were flanked by regions syntenous with up and downstream regions of AtHMA4 in Arabidopsis thaliana. Promoter-reporter beta-glucuronidase (GUS) fusion analysis of a NcHMA4 in A. thaliana revealed deregulated expression in roots and shoots, analogous to AhHMA4 promoters, but distinct from AtHMA4 expression which localised to the root vascular tissue. This remarkable consistency in tandem duplication and deregulated expression of metal transport genes between N. caerulescens and A. halleri, which last shared a common ancestor > 40 mya, provides intriguing evidence that parallel evolutionary pathways may underlie Zn/Cd hyperaccumulation in Brassicaceae.
Resumo:
The characterisation of sequences at chromosome ends of Rhynchosciara americana was continued with the screening of a genomic library using as a probe a short repeat identified in a previous report (M-22, 22 bp) which was found to be specific for noncentromeric termini of this species. Simple repeats, complex tandem and apparently dispersed repeats were present in the genomic clones analysed. Repetitive sequences do not define individual chromosome tips as they were found in all noncentromeric ends. A novel and unusually short tandem repeat type for dipteran chromosome ends (named M-16) composed of 16 nucleotides and frequently associated with M-22 arrays was characterised in this work. Islands of M-16 and M-22 tandem repeats were found in all the genomic clones analysed. Individual probes representative of each repetitive element hybridised not only to all noncentromeric ends of R. americana chromosomes but also to inter-telomeric bridges. This contrasted with the other repeat types which displayed sub-telomeric localisation as seen by double detection of hybridised probe and telomeric reverse transcriptase. Some stretches composed of M-16 and M-22 tandem repeats localised in different regions of the analysed genomic clones were either identical or showed sequence similarity that was unexpectedly higher than the mean sequence similarity observed among repeats within each of their tandem arrays. The occurrence of segmental duplications, as deduced by sequence analyses involving the two repeats that appeared to reach chromosome ends, might indicate the involvement of this type of duplication process in the chromosome end maintenance in this species.
Resumo:
In Drosophila, telomere retrotransposons counterbalance the loss of telomeric DNA. The exceptional mechanism of telomere recovery characterized in Drosophila has not been found in lower dipterans (Nematocera). However, a retroelement resembling a telomere transposon and termed ""RaTART"" has been described in the nematoceran Rhynchosciara americana. In this work, DNA and protein sequence analyses, DNA cloning, and chromosomal localization of probes obtained either by PCR or by screening a genomic library were carried out in order to examine additional features of this retroelement. The analyses performed raise the possibility that RaTART represents a genomic clone composed of distinct repetitive elements, one of which is likely to be responsible for its apparent enrichment at chromosome ends. RaTART sequence in addition allowed to assess a novel subtelomeric region of R. americana chromosomes that was analyzed in this work after subcloning a DNA fragment from a phage insert. It contains a complex repeat that is located in the vicinity of simple and complex tandem repeats characterized previously. Quantification data suggest that the copy number of the repeat is significantly lower than that observed for the ribosomal DNA in the salivary gland of R. americana. A short insertion of the RaTART was identified in the cloned segment, which hybridized preferentially to subtelomeres. Like RaTART, it displays truncated sequences related to distinct retrotransposons, one of which has a conceptual translation product with significant identity with an endonuclease from a lepidopteran retrotransposon. The composite structure of this DNA stretch probably reflects mobile element activity in the subtelomeric region analyzed in this work.
Resumo:
The destruction of Brazilian natural habitats has reduced bee populations and negative impacts of native flora pollination have been noticed. This work describes the isolation and characterization of microsatellite loci and evaluates them as molecular markers to study genetic variability of the stingless bee Plebeia remota. A microsatellite enriched genomic library was constructed and 15 primer pairs were designed for this species. The survey was conducted by analyzing 21 unrelated individuals. Genetic diversity indexes were calculated. The mean allelic richness was 6.3, the observed heterozygosity was 0.568, and the percentage of polymorphic loci was 93.33%. Also the primers were tested in cross-species amplification and showed promising results for P. droryana, P. emerina, P. lucii, P. meridionalis, P. pugnax, and P. saiqui. The microsatellite loci described here will be useful to evaluate genetic variability of stingless bees, and certainly will improve our knowledge about population dynamics especially in threatened environments.
Resumo:
An enriched genomic library was constructed from Tetragonisca angustula, a stingless bee species widely distributed in Brazil. The library was screened using two simple-repeat oligonucleotide probes and 21 microsatellite primer pairs were designed flanking a selection of repeat sequences within positive clones. The polymorphism of the microsatellite loci was analyzed by screening a sample of 19 unrelated T. angustula workers. Fifteen out of 21 loci were shown to be polymorphic, with observed heterozygosity estimates ranging from 0.00 to 0.89. The primers were also successfully used to amplify microsatellite loci from other stingless bee species, Tetragonisca fiebrigi, Tetragonisca weyrauchi, Lestrimelitta maracaia and Schwarziana quadripunctata. The results from variability analyses suggest that the microsatellite loci isolated from T. angustula will be useful in further population studies for the species and also for other Meliponini.
Resumo:
An hsc70 homologue gene (Rahsc70) of the diptera Rhynchosciara americana was isolated and characterized. We were able to determine the mRNA sequence from an EST of salivary gland cDNA library, and a Rahsc70 cDNA cassette was used as a probe to isolate the genomic region from a genomic library. The mRNA expression of this gene parallels the 2B puff expansion, suggesting its involvement in protein processing, since this larval period corresponds to a high synthetic activity period. During heat shock stress conditions, hsc70 expression decreased. In situ hybridization of polytene chromosomes showed that the Rahsc70 gene is located near the C3 DNA puff. The cellular localization of Hsc70 protein showed this protein in the cytoplasm and in the nucleus.
Resumo:
Ribosomal RNA genes are encoded by large units clustered (18S, 5S, and 28S) in the nucleolar organizer region in several organisms. Sometimes additional insertions are present in the coding region for the 28S rDNA. These insertions are specific non-long terminal repeat retrotransposons that have very restricted integration targets within the genome. The retrotransposon present in the genome of Rhynchosciara americana, RaR2, was isolated by the screening of a genomic library. Sequence analysis showed the presence of conserved regions, such as a reverse transcriptase domain and a zinc finger motif in the amino terminal region. The insertion site was highly conserved in R. americana and a phylogenetic analysis showed that this element belongs to the R2 clade. The chromosomal localization confirmed that the RaR2 mobile element was inserted into a specific site in the rDNA gene. The expression level of RaR2 in salivary glands during larval development was determined by quantitative RT-PCR, and the increase of relative expression in the 3P of the fourth instar larval could be related to intense gene activity characteristic of this stage. 5`-Truncated elements were identified in different DNA samples. Additionally, in three other Rhynchosciara species, the R2 element was present as a full-length element.