Human chromosomal fragile site FRA16B is an amplified AT-rich minisatellite repeat

Fragile sites are nonstaining gaps in chromosomes induced by specific tissue culture conditions. They vary both in population frequency and in the culture conditions required for induction. Folate-sensitive fragile sites are due to expansion of p(CCG)(n) trinucleotide repeats; however, the relationship between sequence composition and the chemistry of induction of fragile sites is unclear. To clarify this relationship, the distamycin A-sensitive fragile site FRA16B was isolated by positional cloning and found to be an expanded 33 bp AT-rich minisatellite repeat, p(ATATATTATATATTATATCTAATAATATAT(C)/(A)TA)(n) (consistent with DNA sequence binding preferences of chemicals that induce its cytogenetic expression). Therefore the mutation mechanism associated with trinucleotide repeats is also a property of minisatellite repeats (variable number tandem repeats).

Complete DNA sequence and gene organization of the mitochondrial genome of the liverfluke, Fasciola hepatica L. (Platyhelminthes; Trematoda)

The complete nucleotide sequence of the mitochondrial (mt) DNA molecule of the liverfluke, Fasciola hepatica (phylum Platyhelminthes, class Trematoda, family Fasciolidae), was determined, It comprises 14462 bp, contains 12 protein-encoding, 2 ribosomal and 22 transfer RNA genes, and is the second complete flatworm (and the first trematode) mitochondrial sequence to be described in detail. All of the genes are transcribed from the same strand. Of the genes typically found in mitochondrial genomes of eumetazoans, only atp8 is absent. The nad4L and nad4 genes overlap by 40 nt. Most intergenic sequences are very short. Two larger non-coding regions are present. The longer one (817 nt) is located between trnG and cox3 and consists of 8 identical tandem repeats of 85 nt, rich in G and C, followed by 1 imperfect repeat. The shorter non-coding region (187 nt) exhibits no special features and is separated from the longer region by trnG. The gene arrangement resembles that of some other trematodes including the eastern Asian Schistosoma species (and cyclophyllidean cestode species) but it is strikingly different from that of the African schistosomes, represented by Schistosoma mansoni. The genetic code is as inferred previously for flatworms. Transfer RNA genes range in length from 58 to 70 nt, their products producing characteristic 'clover leaf' structures, except for tRNA(S-VON) and tRNA(S-AGN) lacking the DHU arm.

Autosomal dominant hypocalcemia: A novel activating mutation (E604K) in the cysteine-rich domain of the calcium-sensing receptor

We report a novel activating mutation (E604K) of the calcium-sensing receptor in a family with autosomal dominant hypocalcemia. Whereas all affected individuals exhibited marked hypocalcemia, some cases with untreated hypocalcemia exhibited seizures in infancy, whereas others were largely asymptomatic from birth into adulthood. The missense mutation E604K (G2182A, GenBank accession no. U20759), which affects an amino acid residue in the C terminus of the cysteine-rich domain of the extracellular head, co-segregated with hypocalcemia in all seven individuals for whom DNA was available. Two unaffected, normocalcemic members of the family did not exhibit the mutation. The molecular impact of the mutation on two key components of the signaling response was assessed in HEK-293 cells transiently transfected with cDNA corresponding to either the wild-type calcium-sensing receptor or the E604K mutation derived by site-directed mutagenesis. There was a significant leftward shift in the concentration response curves for the effects of extracellular Ca2+ on both intracellular Ca2+ mobilization (determined by aequorin luminescence) and MAPK activity (determined by luciferase expression). The C terminus of the cysteine-rich domain of the extracellular head may normally act to suppress receptor activity in the presence of low extracellular Ca2+ concentrations.

DNA-based biosensor for the electrocatalytic determination of antioxidant capacity in beverages

Reactive oxygen species (ROS) are produced as a consequence of normal aerobic metabolism and are able to induce DNA oxidative damage. At the cellular level, the evaluation of the protective effect of antioxidants can be achieved by examining the integrity of the DNA nucleobases using electrochemical techniques. Herein, the use of an adenine-rich oligonucleotide (dA21) adsorbed on carbon paste electrodes for the assessment of the antioxidant capacity is proposed. The method was based on the partial damage of a DNA layer adsorbed on the electrode surface by OH• radicals generated by Fenton reaction and the subsequent electrochemical oxidation of the intact adenine bases to generate an oxidation product that was able to catalyze the oxidation of NADH. The presence of antioxidant compounds scavenged hydroxyl radicals leaving more adenines unoxidized, and thus, increasing the electrocatalytic current of NADHmeasured by differential pulse voltammetry (DPV). Using ascorbic acid (AA) as a model antioxidant species, the detection of as low as 50nMof AA in aqueous solution was possible. The protection efficiency was evaluated for several antioxidant compounds. The biosensor was applied to the determination of the total antioxidant capacity (TAC) in beverages.

Electrocatalytic evaluation of DNA damage by superoxide radical for antioxidant capacity assessment

The integrity of DNA purine bases was herein used to evaluate the antioxidant capacity. Unlike other DNA-based antioxidant sensors reported so far, the damaging agent chosen was the O 2 radical enzymatically generated by the xanthine/xanthine oxidase system. An adenine-rich oligonucleotide was adsorbed on carbon paste electrodes and subjected to radical damage in the presence/absence of several antioxidant compounds. As a result, partial damage on DNA was observed. A minor product of the radical oxidation was identified by cyclic voltammetry as a diimine adenine derivative also formed during the electrochemical oxidation of adenine/guanine bases. The protective efficiency of several antioxidant compounds was evaluated after electrochemical oxidation of the remaining unoxidized adenine bases, by measuring the electrocatalytic current of NADH mediated by the adsorbed catalyst species generated. A comparison between O 2 and OH radicals as a source of DNA lesions and the scavenging efficiency of various antioxidant compounds against both of them is discussed. Finally, the antioxidant capacity of beverages was evaluated and compared with the results obtained with an optical method.

Electrochemical characterization of Dps, a DNA-protecting protein

Dissertação para obtenção do Grau de Mestre em Biotecnologia

Comparison among three polymerase chain reaction assays on detection of DNA from Leishmania in biological samples from patients with american cutaneous leishmaniasis

INTRODUCTION: The study analyzed positivity of polymerase chain reaction (PCR) on detection of DNA from Leishmania in patients' samples. METHODS: Extracted DNA was submitted to L150/L152, 13Y/13Z, and seminested PCR (snPCR). RESULTS: Results were evidenced by bands of approximately 120, 720, and 670 bp for L150/L152, 13Y/13Z, and snPCR, respectively. L150/L152, 13Y/13Z, and snPCR positivity indexes were 76.9, 56.4, and 9.2 (p>0.05), respectively, for suspected and 93.7, 68.7, and 84.4 (p<0.05), respectively, for confirmed. CONCLUSIONS: Preliminary results showed that these assays, mainly L150/L152 and snPCR, can detect Leishmania DNA and carry potential on laboratory diagnosis of leishmaniasis.

A glycine-arginine domain in control of the human MRE11 DNA repair protein.

Human MRE11 is a key enzyme in DNA double-strand break repair and genome stability. Human MRE11 bears a glycine-arginine-rich (GAR) motif that is conserved among multicellular eukaryotic species. We investigated how this motif influences MRE11 function. Human MRE11 alone or a complex of MRE11, RAD50, and NBS1 (MRN) was methylated in insect cells, suggesting that this modification is conserved during evolution. We demonstrate that PRMT1 interacts with MRE11 but not with the MRN complex, suggesting that MRE11 arginine methylation occurs prior to the binding of NBS1 and RAD50. Moreover, the first six methylated arginines are essential for the regulation of MRE11 DNA binding and nuclease activity. The inhibition of arginine methylation leads to a reduction in MRE11 and RAD51 focus formation on a unique double-strand break in vivo. Furthermore, the MRE11-methylated GAR domain is sufficient for its targeting to DNA damage foci and colocalization with gamma-H2AX. These studies highlight an important role for the GAR domain in regulating MRE11 function at the biochemical and cellular levels during DNA double-strand break repair.

CTCF-T, a paralogue of CTCF, directs sequence specific DNA methylation of the imprinting control region of Igf2/H19

SUMMARY Genomic imprinting is an epigenetic mechanism of transcriptional regulation that ensures restriction of expression of a subset of mammalian genes to a single parental allele. The best studied example of imprinted gene regulation is the Igf2/H19 locus, which is also the most commonly altered by loss of imprinting (LOT) in cancer. LOT is associated with numerous hereditary diseases and several childhood, and adult cancers. Differential expression of reciprocal H19 and 1gf2 alleles in somatic cells depends on the methylation status of the imprinting control region (ICR) which regulates binding of CTCF, an ubiquitously expressed 11-zinc finger protein that binds specifically to non-methylated maternal ICR and thereby attenuates expression of Igf2, while it does not bind to methylated paternal ICR, which enables Igf2 expression. Initial ICR methylation occurs during gametogenesis by an as yet unknown mechanism. The accepted hypothesis is that the event of differential maternal and paternal DNA methylation depends on germ-line specific proteins. Our Laboratory identified a novel 11-zinc-finger protein CTCF-T (also known as CTCFL and BORIS) that is uniquely expressed in the male germ-line and is highly homologous within its zinc-finger region with CTCF. The amino-acid sequences flanking the zinc-finger regions of CTCF and CTCF-T have widely diverged, suggesting that though they could bind to the same DNA targets (ICRs) they are likely to have different functions. Interestingly, expression of CTCF-T and CTCF is mutually exclusive; CTCF-T-positive (CTCF-negative) cells occur in the stage of spermatogenesis that coincides with epigenetic reprogramming, including de novo DNA methylation. In our study we demonstrate the role that CTCF-T plays in genomic imprinting. Here we show that CTCF-T binds in vivo to the ICRs of Igf2/H19 and Dlk/Gt12 imprinted genes. In addition, we identified two novel proteins interacting with CTCF-T: a protein arginine methyltransferase PRMT7 and an arginine-rich histone H2A variant that we named trH2A. These interactions were confirmed and show that the two proteins interact with the amino-teiminal region of CTCF-T. Additionally, we show interaction of the amino- terminal region of CTCF-T with histones H1, H2A and H3. These results suggest that CTCF-T is a sequence-specific DNA (ICR) binding protein that associates with histones and recruits PRMT7. Interestingly, PRMT7 has a histone-methyltransferase activity. It has been shown that histone methylation can mark chromatin regions thereby directing DNA-methylation; thus, our hypothesis is that the CTCF-T protein-scaffold directs PRMT7 to methylate histone(s) assembled on ICRs, which marks chromatin for the recruitment of the de novo DNA methyltransferases to methylate DNA. To test this hypothesis, we developed an in vivo DNA-methylation assay using Xenopus laevis' oocytes, where H19 ICR and different expression cDNAs, including CTCF-T, PRMT7 and the de novo DNA methyltransferases (Dnmt3a, Dnmt3b and Dnmt3L) are microinjected into the nucleus. The methylation status of CpGs within the H19 ICR was analysed 48 or 72 hours after injection. Here we demonstrate that CpGs in the ICR are methylated in the presence of both CTCF-T and PRMT7, while control oocytes injected only with ICR did not show any methylation. Additionally, we showed for the first time that Dnmt3L is crucial for the establishment of the imprinting marks on H19 ICR. Moreover, we confirmed that Dnmt3a and Dnmt3b activities are complementary. Our data indicate that all three Dnmt3s are important for efficient de novo DNA methylation. In conclusion, we propose a mechanism for the establishment of de novo imprinting marks during spermatogenesis: the CTCF-T/PRMT7 protein complex directs histone methylation leading to sequence-specific de novo DNA methylation of H19 ICR. RESUME L'empreinte génomique parentale est un mécanisme épigénétique de régulation transcriptionelle qui se traduit par une expression différentielle des deux allèles de certains gènes, en fonction de leur origine parentale. L'exemple le mieux caractérisé de gènes soumis à l'empreinte génomique parentale est le locus Igf2/H19, qui est aussi le plus fréquemment altéré par relaxation d'empreinte (en anglais: loss of imprinting, LOI) dans les cancers. Cette relaxation d'empreinte est aussi associée à de nombreuses maladies héréditaires, ainsi qu'à de nombreux cancers chez l'enfant et l'adulte. Dans les cellules somatiques, les différences d'expression des allèles réciproques H19 et Ig12 est sous le contrôle d'une région ICR (Imprinting Control Region). La méthylation de cette région ICR régule l'ancrage de la protéine à douze doigts de zinc CTCF, qui se lie spécifiquement à l'ICR maternel non-méthylé, atténuant ainsi l'expression de Igf2, alors qu'elle ne s'ancre pas à l'ICR paternel méthyle. Le mécanisme qui accompagne la méthylation initiale de la région ICR durant la gamétogenèse n'a toujours pas été élucidé. L'hypothèse actuelle propose que la différence de méthylation entre l'ADN maternel et paternel résulte de l'expression de protéines propres aux zones germinales. Notre laboratoire a récemment identifié une nouvelle protéine à douze doigts de zinc, CTCF-T (aussi dénommée CTCFL et BORRIS), qui est exprimée uniquement dans les cellules germinales mâles, dont la partie à douze doigts de zinc est fortement homologue à la protéine CTCF. La séquence d'acides aminés de part et d'autre de cette région est quant à elle très divergente, ce qui implique que CTCF-T se lie sans doute au même ADN cible que CTCF, mais possède des fonctions différentes. De plus, l'expression de CTCF-T et de CTCF s'oppose mutuellement; l'expression de la protéine CTCF-T (cellules CTCF-T positives, CTCF negatives) qui a lieu pendant la spermatogenèse coïncide avec la reprogrammation épigénétique, notamment la méthylation de novo de l'ADN. La présente étude démontre le rôle essentiel joué par la protéine CTCF-T dans l'acquisition de l'empreinte génomique parentale. Nous montrons ici que CTCF-T s'associe in vivo avec les régions ICR des loci Igf2/H19 et Dlk/Gt12. Nous avons également identifié deux nouvelles protéines qui interagissent avec CTCF-T : une protéine arginine méthyl transférase PRMT7, et un variant de l'histone H2A, riche en arginine, que nous avons dénommé trH2A. Ces interactions ont été analysées plus en détail, et confinnent que ces deux protéines s'associent avec la région N-terminale de CTCF-T. Aussi, nous présentons une interaction de la région N-terminale de CTCF-T avec les histones H1, H2, et H3. Ces résultats suggèrent que CTCF-T est une protéine qui se lie spécifiquement aux régions ICR, qui s'associe avec différents histones et qui recrute PRMT7. PRMT7 possède une activité méthyl-tansférase envers les histones. Il a été montré que la méthylation des histones marque certains endroits de la chromatine, dirigeant ainsi la méthylation de l'ADN. Notre hypothèse est donc la suivante : la protéine CTCF-T sert de base qui dirige la méthylation des histones par PRMT7 dans les régions ICR, ce qui contribue à marquer la chromatine pour le recrutement de nouvelles méthyl transférases pour méthyler l'ADN. Afin de valider cette hypothèse, nous avons développé un système de méthylation de l'ADN in vivo, dans des oeufs de Xenopus laevis, dans le noyau desquels nous avons mico-injecté la région ICR du locus H19, ainsi que différents vecteurs d'expression pour CTCF-T, PRMT7, et les de novo méthyl transférases (Dnmt3a, Dnmt3b et Dnmt3L). Les CpGs méthyles de la région ICR du locus H19 ont été analysé 48 et 72 heures après l'injection. Cette technique nous a permis de démontrer que les CpGs de la région ICR sont méthyles en présence de CTCF-T et de PRMT7, tandis que les contrôles injectés seulement avec la région ICR ne présentent aucun signe de méthylation. De plus, nous démontrons pour la première fois que la protéine méthyl transférase Dnmt3L est déterminant pour l'établissement de l'empreinte génomique parentale au niveau de la région ICR du locus H19. Aussi, nous confirmons que les activités méthyl transférases de Dnmt3a et Dnmt3b sont complémentaires. Nos données indiquent que les trois protéines Dnmt3 sont impliquées dans la méthylation de l'ADN. En conclusion, nous proposons un mécanisme responsable de la mise en place de nouvelles empreintes génomiques pendant la spermatogenèse : le complexe protéique CTCF-T/PRMT7 dirige la méthylation des histones aboutissant à la méthylation de novo de l'ADN au locus H19.

Relocalization of telomeric Ku and SIR proteins in response to DNA strand breaks in yeast.

Telomeric TG-rich repeats and their associated proteins protect the termini of eukaryotic chromosomes from end-to-end fusions. Associated with the cap structure at yeast telomeres is a subtelomeric domain of heterochromatin, containing the silent information regulator (SIR) complex. The Ku70/80 heterodimer (yKu) is associated both with the chromosome end and with subtelomeric chromatin. Surprisingly, both yKu and the chromatin-associated Rap1 and SIR proteins are released from telomeres in a RAD9-dependent response to DNA damage. yKu is recruited rapidly to double-strand cuts, while low levels of SIR proteins are detected near cleavage sites at later time points. Consistently, yKu- or SIR-deficient strains are hypersensitive to DNA-damaging agents. The release of yKu from telomeric chromatin may allow efficient scanning of the genome for DNA strand breaks.

Genomics of the divergence continuum in an African plant biodiversity hotspot, I: drivers of population divergence in Restio capensis (Restionaceae).

Understanding the drivers of population divergence, speciation and species persistence is of great interest to molecular ecology, especially for species-rich radiations inhabiting the world's biodiversity hotspots. The toolbox of population genomics holds great promise for addressing these key issues, especially if genomic data are analysed within a spatially and ecologically explicit context. We have studied the earliest stages of the divergence continuum in the Restionaceae, a species-rich and ecologically important plant family of the Cape Floristic Region (CFR) of South Africa, using the widespread CFR endemic Restio capensis (L.) H.P. Linder & C.R. Hardy as an example. We studied diverging populations of this morphotaxon for plastid DNA sequences and >14 400 nuclear DNA polymorphisms from Restriction site Associated DNA (RAD) sequencing and analysed the results jointly with spatial, climatic and phytogeographic data, using a Bayesian generalized linear mixed modelling (GLMM) approach. The results indicate that population divergence across the extreme environmental mosaic of the CFR is mostly driven by isolation by environment (IBE) rather than isolation by distance (IBD) for both neutral and non-neutral markers, consistent with genome hitchhiking or coupling effects during early stages of divergence. Mixed modelling of plastid DNA and single divergent outlier loci from a Bayesian genome scan confirmed the predominant role of climate and pointed to additional drivers of divergence, such as drift and ecological agents of selection captured by phytogeographic zones. Our study demonstrates the usefulness of population genomics for disentangling the effects of IBD and IBE along the divergence continuum often found in species radiations across heterogeneous ecological landscapes.

Mutational analysis of cysteine-rich domains of the epithelium sodium channel (ENaC). Identification of cysteines essential for channel expression at the cell surface.

One of the characteristic features of the structure of the epithelial sodium channel family (ENaC) is the presence of two highly conserved cysteine-rich domains (CRD1 and CRD2) in the large extracellular loops of the proteins. We have studied the role of CRDs in the functional expression of rat alphabetagamma ENaC subunits by systematically mutating cysteine residues (singly or in combinations) into either serine or alanine. In the Xenopus oocyte expression system, mutations of two cysteines in CRD1 of alpha, beta, or gamma ENaC subunits led to a temperature-dependent inactivation of the channel. In CRD1, one of the cysteines of the rat alphaENaC subunit (Cys158) is homologous to Cys133 of the corresponding human subunit causing, when mutated to tyrosine (C133Y), pseudohypoaldosteronism type 1, a severe salt-loosing syndrome in neonates. In CRD2, mutation of two cysteines in alpha and beta but not in the gamma subunit also produced a temperature-dependent inactivation of the channel. The main features of the mutant cysteine channels are: (i) a decrease in cell surface expression of channel molecules that parallels the decrease in channel activity and (ii) a normal assembly or rate of degradation as assessed by nondenaturing co-immunoprecipitation of [35S]methionine-labeled channel protein. These data indicate that the two cysteines in CRD1 and CRD2 are not a prerequisite for subunit assembly and/or intrinsic channel activity. We propose that they play an essential role in the efficient transport of assembled channels to the plasma membrane.

Liposome-mediated transfection of fetal lung epithelial cells: DNA degradation and enhanced superoxide toxicity.

Cationic liposomes, 1:1 (mol/mol) 1,2-dioleoyldimethylammonium chloride-1,2-dioleoyl-sn-glycero-3-phosphoethanolamine, were used to transfect primary cultures of distal rat fetal lung epithelial cells with pCMV4-based plasmids. A DNA-to-lipid ratio of 1:10 to 1:15 (wt/wt) optimized DNA uptake over a 24-h exposure. At a fixed DNA-to-lipid ratio of 1:15, chloramphenicol acetyltransferase (CAT) reporter gene expression declined at lipid concentrations > 2.5 nmol/cm2 cell surface area, whereas DNA uptake remained concentration dependent. CAT expression peaked 48 h after removal of the liposome-DNA complex, declining thereafter. Reporter gene expression was increased, and supercoiled cDNA degradation was reduced by the addition of 0.2 mM nicotinamide and 10 microM chloroquine. Rat fetal lung epithelial cells transfected with two different expression cassettes had an increased susceptibility to superoxide-mediated cytotoxicity. This could be attributed to a nonspecific delivery of exogenous DNA or some other copurified factor. The DNA-dependent increase in superoxide-mediated cytotoxicity, but not basal levels of cytotoxicity, was inhibited by the addition of 0.2 mM nicotinamide and 10 microM chloroquine.

A novel role for proline- and acid-rich basic region leucine zipper (PAR bZIP) proteins in the transcriptional regulation of a BH3-only proapoptotic gene.

Proline- and acid-rich (PAR) basic region leucine zipper (bZIP) proteins thyrotroph embryonic factor (TEF), D-site-binding protein (DBP), and hepatic leukemia factor have been involved in neurotransmitter homeostasis and amino acid metabolism. Here we demonstrate a novel role for these proteins in the transcriptional control of a BH3-only gene. PAR bZIP proteins are able to transactivate the promoter of bcl-gS. This promoter is particularly responsive to TEF activation and is silenced by NFIL3, a repressor that shares the consensus binding site with PAR bZIP proteins. Consistently, transfection of TEF induces the expression of endogenous bcl-gS in cancer cells, and this induction is independent of p53. A naturally occurring variant of DBP (tDBP), lacking the transactivation domain, has been identified and shown to impede the formation of active TEF dimers in a competitive manner and to reduce the TEF-dependent induction of bcl-gS. Of note, treatment of cancer cells with etoposide induces TEF activation and promotes the expression of bcl-gS. Furthermore, blockade of bcl-gS or TEF expression by a small interfering RNA strategy or transfection with tDBP significantly reduces the etoposide-mediated apoptotic cell death. These findings represent the first described role for PAR bZIP proteins in the regulation of a gene involved in the execution of apoptosis.

A proline-rich TGF-beta-responsive transcriptional activator interacts with histone H3.

The molecular mechanisms involved in the regulation of gene expression by transforming growth factor-beta (TGF-beta) have been analyzed. We show that TGF-beta specifically induces the activity of the proline-rich trans-activation domain of CTF-1, a member of the CTF/NF-I family of transcription factors. A TGF-beta-responsive domain (TRD) in the proline-rich transcriptional activation sequence of CTF-1 was shown to mediate TGF-beta induction in NIH-3T3 cells. Mutagenesis studies indicated that this domain is not the primary target of regulatory phosphorylations, suggesting that the growth factor may regulate a CTF-1-interacting protein. A two-hybrid screening assay identified a nucleosome component, histone H3, as a specific CTF-1-interacting protein in yeast. Furthermore, the CTF-1 trans-activation domain was shown to interact with histone H3 in both transiently and stably transfected mammalian cells. This interaction requires the TRD, and it appears to be upregulated by TGF-beta in vivo. Moreover, point mutations in the TRD that inhibit TGF-beta induction also reduce interaction with histone H3. In vitro, the trans-activation domain of CTF-1 specifically contacts histone H3 and oligomers of histones H3 and H4, and full-length CTF-1 was shown to alter the interaction of reconstituted nucleosomal cores with DNA. Thus, the growth factor-regulated trans-activation domain of CTF-1 can interact with chromatin components through histone H3. These findings suggest that such interactions may regulate chromatin dynamics in response to growth factor signaling.