What best transfers knowledge? : capital, goods, and innovative labor in East Asia

This paper compares three knowledge carriers—trade, foreign direct investment (FDI), and inventors—as knowledge mediums, and investigates their effects on knowledge flow in East Asia from 1996 to 2010. Using patent citations as a proxy for knowledge flow, this paper shows that FDI and inventor mobility have positive effects on increasing patent citations in East Asia when the technological portfolios of two countries are less similar. While trade shows statistical significance, the effect is inconsistent according to the regression models.

Tabule ad diuersas huius operis magistri Guilhelmi de ockam sup[er] quattuor libros s[e]n[tent]iaru[m] a[n]notat[i]o[n]es et ad ce[n]tilogij theologici eiusdem co[n]clusiones facile reperiendas apprime conducibiles.

Pie de imp. tomado del colofón en X10r

A regulatory element in the promoter of the human granulocyte-macrophage colony-stimulating factor gene that has related sequences in other T-cell-expressed cytokine genes.

Granulocyte-macrophage colony-stimulating factor (GM-CSF) is a cytokine with a broad spectrum of cell-differentiating and colony-stimulating activities. It is expressed by several undifferentiated (bone marrow stromal cells, fibroblasts) and fully differentiated (T cells, macrophages, and endothelial cells) cells. Its expression in T cells is activation dependent. We have found a regulatory element in the promoter of the GM-CSF gene which contains two symmetrically nested inverted repeats (-192 CTTGGAAAGGTTCATTAATGAAAACCCCCAAG -161). In transfection assays with the human GM-CSF promoter, this element has a strong positive effect on the expression of a reporter gene by the human T-cell line Jurkat J6 upon stimulation with phorbol dibutyrate and ionomycin or anti-CD3 antibody. This element also acts as an enhancer when inserted into a minimal promoter vector. In DNA band-retardation assays this sequence produces six specific bands that involve one or the other of the inverted repeats. We have also shown that a DNA-protein complex can be formed involving both repeats and probably more than one protein. The external inverted repeat contains a core sequence CTTGG...CCAAG, which is also present in the promoters of several other T-cell-expressed human cytokines (interleukins 4, 5, and 13). The corresponding elements in GM-CSF and interleukin 5 promoters compete for the same proteins in band-retardation assays. The palindromic elements in these genes are larger than the core sequence, suggesting that some of the interacting proteins may be different for different genes. Considering the strong positive regulatory effect and their presence in several T-cell-expressed cytokine genes, these elements may be involved in the coordinated expression of these cytokines in T-helper cells.

Africae I Tab

[Gerardus Mercator].

Chronik der Stadt Mühlhausen in Thüringen /

Bd. 8 imprint: Bad Langensalza : Rockstuhl.

Studies in education

The following are in Thesis ed.:no. 2, 4, 7-10, 12-13, 17-18, 21-25

Joab : ein Heldenleben

von Elias Auerbach

Die heiligen Schriften der Israeliten : nach dem masoretischen Texte neu übersetzt

von J. Johlson

Die fünf Bücher Mose : nach dem masoretischen Texte worttreu übersetzt, mit Anmerkungen

von J. Johlson

Die Geschichtsbücher Josua, Richter, Samuel's und der Könige : nach dem masoretischen Texte worttreu übersetzt, mit Anmerkungen

von J. Johlson

Unemployed, Now What? The Effect of Immigration on Unemployment Transitions of Native-born Workers in the United States

Although one would expect the unemployed to be the population most likely affected by immigration, most of the studies have concentrated on investigating the effects immigration has on the employed population. Little is known of the effects of immigration on labor market transitions out of unemployment. Using the basic monthly Current Population Survey from 2001 and 2013 we match data for individuals who were interviewed in two consecutive months and identify workers who transition out of unemployment. We employ a multinomial model to examine the effects of immigration on the transition out of unemployment, using state-level immigration statistics. The results suggest that immigration does not affect the probabilities of native-born workers finding a job. Instead, we find that immigration is associated with smaller probabilities of remaining unemployed, but it is also associated with higher probabilities of workers leaving the labor force. This effect impacts mostly young and less educated people.