996 resultados para DNA adduct
Resumo:
We have examined the capacity of calf thymus DNA polymerases alpha, beta, delta, and epsilon to perform in vitro translesion synthesis on a substrate containing a single d(GpG)-cisplatin adduct placed on codon 13 of the human HRAS gene. We found that DNA synthesis catalyzed by DNA polymerases alpha, delta, and epsilon was blocked at the base preceding the lesion. Addition of proliferating cell nuclear antigen to DNA polymerase delta and replication protein A to DNA polymerase alpha did not restore their capacity to elongate past the adduct. On the other hand, DNA polymerase beta efficiently bypassed the cisplatin adduct. Furthermore, we observed that DNA polymerase beta was the only polymerase capable of primer extension of a 3'-OH located opposite the base preceding the lesion. Likewise, DNA polymerase beta was able to elongate the arrested replication products of the other three DNA polymerases, thus showing its capacity to successfully compete with polymerases alpha, delta, and epsilon in the stalled replication complex. Our data suggest (i) a possible mechanism enabling DNA polymerase beta to bypass a d(GpG)-cisplatin adduct in vitro and (ii) a role for this enzyme in processing DNA damage in vivo.
Resumo:
Glyoxal, a reactive aldehyde, is a decomposition product of lipid hydroperoxides, oxidative deoxyribose breakdown, or autoxidation of sugars, such as glucose. It readily forms DNA adducts, generating potential carcinogens such as glyoxalated deoxycytidine (gdC). A major drawback in assessing gdC formation in cellular DNA has been methodologic sensitivity. We have developed an mAb that specifically recognizes gdC. Balb/c mice were immunized with DNA, oxidatively modified by UVC/hydrogen peroxide in the presence of endogenous metal ions. Although UVC is not normally considered an oxidizing agent, a UVC/hydrogen peroxide combination may lead to glyoxalated bases arising from hydroxyl radical damage to deoxyribose. This damaging system was used to induce numerous oxidative lesions including glyoxal DNA modifications, from which resulted a number of clones. Clone F3/9/H2/G5 showed increased reactivity toward glyoxal-modified DNA greater than that of the immunizing antigen. ELISA unequivocally showed Ab recognition toward gdC, which was confirmed by gas chromatography-mass spectrometry of the derivatized adduct after formic acid hydrolysis to the modified base. Binding of Ab F3/9 with glyoxalated and untreated oligomers containing deoxycytidine, deoxyguanosine, thymidine, and deoxyadenosine assessed by ELISA produced significant recognition (p 0.0001) of glyoxal-modified deoxycytidine greater than that of untreated oligomer. Additionally, inhibition ELISA studies using the glyoxalated and native deoxycytidine oligomer showed increased recognition for gdC with more than a 5-fold difference in IC50 values. DNA modified with increasing levels of iron (II)/EDTA produced a dose-dependent increase in Ab F3/9 binding. This was reduced in the presence of catalase or aminoguanidine. We have validated the potential of gdC as a marker of oxidative DNA damage and showed negligible cross-reactivity with 8-oxo-2'-deoxyguanosine or malondialdehyde-modified DNA as well as its utility in immunocytochemistry. Formation of the gdC adduct may involve intermediate structures; however, our results strongly suggest Ab F3/9 has major specificity for the predominant product, 5-hydroxyacetyl-dC.
Resumo:
Aflatoxin B1, a potently carcinogenic fungal metabolite, is converted to the biologically active form by chemical oxidation using dimethyldioxirane and enzymatically by cytochrome P450 mixed-function oxidases. Both processes give rise to mixtures of the exo- and endo-8,9-epoxides. Methanolysis studies reveal exclusive trans opening of both epoxides under neutral conditions in CH3OH and CH3OH/H2O mixtures; an SN2 mechanism is postulated. Under acidic conditions, the exo isomer gives mixtures of trans and cis solvolysis products, suggesting that the reaction is, at least in part, SN1; the endo isomer gives only the trans product. The exo isomer reacts with DNA by attack of the nitrogen atom at the 7 position of guanine on C8 of the epoxide to give the trans adduct; the endo epoxide fails to form an adduct at this or any other site in DNA. The exo isomer is strongly mutagenic in a base-pair reversion assay employing Salmonella typhimurium; the endo isomer is essentially nonmutagenic. Aflatoxin B1 and its derivatives intercalate in DNA. These results are consistent with a mechanism in which intercalation of the exo epoxide optimally orients the epoxide for an SN2 reaction with guanine but intercalation of the endo isomer places the epoxide in an orientation which precludes reaction. Thus, while the exo epoxide is a potent mutagen, the endo epoxide fails to react with DNA.
Resumo:
Radioactivity from S-adenosyl-L-[methyl-H-3] methionine ([methyl-H-3]AdoMet) was bound to the EcoP15 DNA methyltransferase (M.EcoP15) following short-wave ultraviolet (UV) irradiation. The labeled protein was subjected to polyacrylamide-gel electrophoresis in the presence of sodium dodecyl sulfate (SDS-PAGE), and detected by fluorography and autoradiography. Labeling was found to be dependent on the concentration of AdoMet and time of UV irradiation. The photolabeling by [methyl-H-3]AdoMet was specific and blocked by S-adenosyl-L-homocysteine (AdoHcy) and sinefungin which are known to function as competitive inhibitors. Limited digestion of the M EcoP15-AdoMet adduct by Staphylococcus aureus protease V8 generated three peptides of approx. 50, 32 and 30 kDa; Interestingly, only the 30-kDa peptide fragment contained radioactivity, as detected by SDS-PAGE, followed by fluorography and autoradiography. Further, sequencing of a few amino acids at the N-terminus of these peptides showed that the 30-kDa fragment was the N-terminal portion of M.EcoP15, These results suggest that photolabeling is at the AdoMet-binding site and that the N-terminal half of M.EcoP15 may be involved in substrate binding.
Resumo:
Green-lipped mussels (Perna viridis) were collected from a site in Hong Kong which is relatively free from polycyclic aromatic hydrocarbon (PAH) contamination, and maintained in situ at this and three other sites with different degrees of PAH contamination. The transplanted mussels were retrieved after a 30-day field exposure. DNA adducts in the gill tissues were quantified, and tissue concentrations of benzo[a]pyrene as well as total PAHs (with potential carcinogenicity) determined for individual mussels. Results indicate that (1) tissue concentration of PAHs and adduct levels in mussels collected from a single site can be highly variable; and (2) adduct levels were related to tissue concentrations of benzo[a]pyrene as well as total PAHs of individual animals.
Resumo:
The two enantiomers of [Ru(bpy)2(bbtb)]2+ {bpy = 2,2'-bipyridine; bbtb = 4,4'-bis(benzothiazol-2-yl)-2,2'-bipyridine} have been isolated and fully characterised. Both enantiomers have been shown to have a strong association with calf thymus DNA by UV/visible absorption, emission and CD spectroscopy, with the lambda enantiomer having the greater affinity. The binding of both enantiomeric forms of [Ru(bpy)2(Me2bpy)]2+ and [Ru(bpy)2(bbtb)]2+ {Me2bpy = 4,4'-dimethyl-2,2'-bipyridine} to a range of oligonucleotides, including an octadecanucleotide and an icosanucleotide which contain hairpin-sequences, have been studied using a fluorescent intercalator displacement (FID) assay. The complex [Ru(bpy)2(bbtb)]2+ exhibited an interesting association to hairpin oligonucleotides, again with the lambda enantiomer binding more strongly. A 1H NMR spectroscopic study of the binding of both enantiomers of [Ru(bpy)2(bbtb)]2+ to the icosanucleotide d(CACTGGTCTCTCTACCAGTG) was conducted. This sequence contains a seven-base-pair duplex stem and a six-base hairpin-loop. The investigation gave an indication of the relative binding of the complexes between the two different regions (duplex and secondary structure) of the oligonucleotide. The results suggest that both enantiomers bind at the hairpin, with the ruthenium centre located at the stem-loop interface. NOE studies indicate that one of the two benzothiazole substituents of the bbtb ligand projects into the loop-region. A simple model of the metal complex/oligonucleotide adduct was obtained by means of molecular modelling simulations. The results from this study suggest that benzothiazole complexes derived from inert polypyridine ruthenium(II) complexes could lead to the development of new fluorescent DNA hairpin binding agents.
Resumo:
A significant proportion of human cancers overexpress DNA polymerase beta (Pol beta), the major DNA polymerase involved in base excision repair. The underlying mechanism and biological consequences of overexpression of this protein are unknown. We examined whether Pol beta, expressed at levels found in tumor cells, is involved in the repair of DNA damage induced by oxaliplatin treatment and whether the expression status of this protein alters the sensitivity of cells to oxaliplatin. DNA damage induced by oxaliplatin treatment of HCT116 and HT29 colon cancer cells was observed to be associated with the stabilization of Pol beta protein on chromatin. In comparison with HCT116 colon cancer cells, isogenic oxaliplatin-resistant (HCT-OR) cells were found to have higher constitutive levels of Pol beta protein, faster in vitro repair of a DNA substrate containing a single nucleotide gap and faster repair of 1,2-GG oxaliplatin adduct levels in cells. In HCT-OR cells, small interfering RNA knockdown of Pol beta delayed the repair of oxaliplatin-induced DNA damage. In a different model system, Pol beta-deficient fibroblasts were less able to repair 1,2-GG oxaliplatin adducts and were hypersensitive to oxaliplatin treatment compared with isogenic Pol beta-expressing cells. Consistent with previous studies, Pol beta-deficient mouse fibroblasts were not hypersensitive to cisplatin treatment. These data provide the first link between oxaliplatin sensitivity and DNA repair involving Pol beta. They demonstrate that Pol beta modulates the sensitivity of cells to oxaliplatin treatment. Oncogene (2010) 29, 463-468; doi:10.1038/onc.2009.327; published online 19 October 2009
Resumo:
The general solution behaviour and" the major fragmentation pathways of the anticanceractive PtIV coordination complexes, trans, trans, cis, cis-[PtCIOH{N(pFC6F4) CH2h(pY)2] (1), trans, cis, cis-[Pt(OH)2{N(p-FC6F4)CH2h(Py)2] (2), trans, cis, cis-[Pt(OH)2{N(p-HC6F4)CH2h(Py)2] (3), trans, trans, cis, cis-[PtCIOH{N(pHC6F4) CH2h(Py)2] (4), and trans, trans, cis, cis-[PtOH(OCH3){N(p-HC6F4)CH2h(PY)2] (5) (Py = pyridine) have been deduced by positive-ion tandem-in-time ESI-MS. Overall, the acquired full-scan, positive-ion ESI-MS spectra of 2, 3, and 5 were characterized by the presence of relatively low-intensity [M+Nar and [M+Kt mass spectral peaks, whereas those of 1 and 4 were dominated by extremely intense [M+Hr peaks. Complexes 2 and 3 were also noted to form [2M+Ht and [2M+Nat dilneric cations. The source of Na + and K+ ions is believed to be the sample, the solvent systems used or the transport line carrying the sample solutions into the ES ion source. Further, the fragmentation pathway of all complexes studied was found to be almost identical with concurrent loss of py and H20 molecules, loss of a {N(p-YC6F4)CH2} (Y = F, H) group and/or concomitant release of the latter group and a py ligand being the most conunon. The photochemical degradation behaviour of 1 and 2 was also investigated using either fluorescent or ultraviolet light and some products of that degradation were positively identified. Altogether, light irradiation of solutions of both complexes resulted in cation cationisation, reductive-elimination, ligand-release, ligand-exchange and ligand-addition reactions. Finally, positive- and negative-ion ESI-MSn spectra of 5' -GMP, guanosine, inosine and products of their reactions with 1, 2,3, and 4 were also recorded. On the whole, full-scan ESI-MS spectra of the pure nucleobases revealed the presence of cationic and anionic species that are highly reflective of both their solution ionic composition and their propensity t9 form polymeric clusters. Analyses of mass spectra acquired from their reaction solutions with the aforementioned platinum complexes indicated very slow kinetics. However, all complexes investigated formed, to various degrees, Pt-nucleobase adducts with guanosine and inosine, but not with 5'-GMP. The products included species having coordination numbers of III, IV, V, and VI, among which the first-time· observed, coordinatively saturated, jive-coordinate PtlI-nucleobase complexes were of most interest. The latter complexes are presumably stabilized by 7tback- donation involving the filled d orbitals of the PtII centre and the empty pz· orbital of MeCN. All products, whose peaks appeared inlull-scan ESI-MS spectra, are believed to represent solution species rather than artifacts of gas-phase processes. Finally, negativeion ESI-MSn spectra recorded in reaction solutions of 1 and 4 with guanosine and of the latter complex with inosine revealed the negative-ion-ESI-MS first-time observed, noncovalent, nucleoside-chloride adducts, with the source of chloride anion being complexes 1 and 4 theillselves. In contrast, no such adducts were observed to form with Na25'-GMP or its protonated fonn. Few suggestions are offered for the possible cause(s) behind the absence of such adduct ions.
Resumo:
A recent study showed that tetrahydrofuran (THF), a widely used solvent, is carcinogenic in experimental animals. Despite its carcinogenic activity, there is a paucity of information regarding cellular toxicity, biomolecular damage, and genotoxicity induced by THF. We describe here the structural characterization of adducts produced by the reaction of oxidized THF with 2'-deoxyguanosine (dGuo-THF 1 and dGuo-THF 2), 2'-deoxyadenosine (dAdo-THF), and 2'-deoxycytidine (dCyd-THF). Adducts were isolated from in vitro reactions by reverse-phase HPLC and fully characterized on the basis of spectroscopic measurements. The stable derivatives obtained by the reduction of adducts with NaBH4 ( the case of dGuo-THF 1, dCyd-THF, and dAdo-THF) and the stable adduct dGuo-THF 2 were used as standards for optimization of chromatographic separations for adduct detection in DNA through HPLC/ESI/MSMS. Using this methodology, we successfully detected the four adducts in calf thymus DNA reacted with oxidized THF. The present study also provides evidence that rat liver microsomal monooxigenases oxidize THF to the reactive electrophilic compounds that are able to damage the DNA molecule, as indicated by a significant increase in adduct dGuo-THF 1 level when NADPH was added to the THF/ microsomes/dGuo incubation mixtures. Our data point to DNA-THF adducts as possible contributing factors to the toxicological effects of THF exposure.
Resumo:
This work presents two potential metallo-drugs, the ionic (C17H19FN3O3)(3)[RuCl6]center dot 3H(2)O (1) and the coordination [Ru(C17H17FN3O3)(3)]center dot 4H(2)O (2) compounds, obtained by the combination of ruthenium(III) and ciprofloxacin in different synthetic conditions. The ESI MS spectrum of 1 displayed a main peak at m/z = 994.6, assigned to the gaseous phase adduct (ciprofloxacin)(3)center dot H+, while 2 featured peaks at m/z 1093.3 and 547.1 ascribed to [Ru(C17H17FN3O3)(3)center dot H+-4H(2)O](+) and [Ru(C17H17FN3O3)(3)center dot 2H(+)-4H(2)O](2+). Thermal analysis corroborated the proposed water content for both complexes. Absorption spectra of the compounds in aqueous medium are dominated by ciprofloxacin transitions in the UV region but displayed weak bands in the visible region, assigned to ligand field transitions. The cyclic voltammograms of 2 exhibited a quasi-reversible process ascribed to the Ru(II)/(III) redox pair at -0.25V (vs. SHE) while 1 displayed this process at -0.11 V, showing that the central ruthenium ion is stabilized in the (III) oxidation state by the coordination to the hard oxygen atoms of ciprofloxacin. The solubility of 1 is pH dependent (as well as free ciprofloxacin) while 2 is fully water soluble and stable under physiological pH for at least 48 h. The compounds are also stable under incubation conditions (stomach pH and 37 degrees C) without significant pH lowering. An interaction study of 2 with ct-DNA showed a value of K-b = 2.47 (+/- 0.89) x 10(4) mol(-1) L for the intrinsic binding constant.
Resumo:
The spatio-temporal control of gene expression is fundamental to elucidate cell proliferation and deregulation phenomena in living systems. Novel approaches based on light-sensitive multiprotein complexes have recently been devised, showing promising perspectives for the noninvasive and reversible modulation of the DNA-transcriptional activity in vivo. This has lately been demonstrated in a striking way through the generation of the artificial protein construct light-oxygen-voltage (LOV)-tryptophan-activated protein (TAP), in which the LOV-2-Jα photoswitch of phototropin1 from Avena sativa (AsLOV2-Jα) has been ligated to the tryptophan-repressor (TrpR) protein from Escherichia coli. Although tremendous progress has been achieved on the generation of such protein constructs, a detailed understanding of their functioning as opto-genetical tools is still in its infancy. Here, we elucidate the early stages of the light-induced regulatory mechanism of LOV-TAP at the molecular level, using the noninvasive molecular dynamics simulation technique. More specifically, we find that Cys450-FMN-adduct formation in the AsLOV2-Jα-binding pocket after photoexcitation induces the cleavage of the peripheral Jα-helix from the LOV core, causing a change of its polarity and electrostatic attraction of the photoswitch onto the DNA surface. This goes along with the flexibilization through unfolding of a hairpin-like helix-loop-helix region interlinking the AsLOV2-Jα- and TrpR-domains, ultimately enabling the condensation of LOV-TAP onto the DNA surface. By contrast, in the dark state the AsLOV2-Jα photoswitch remains inactive and exerts a repulsive electrostatic force on the DNA surface. This leads to a distortion of the hairpin region, which finally relieves its tension by causing the disruption of LOV-TAP from the DNA.
Resumo:
Aflatoxin B1 (AFB1) is a potent human carcinogen implicated in the etiology of hepatocellular carcinoma. Upon metabolic activation to the reactive epoxide, AFB1 forms DNA adducts primarily at the N7 position of guanines. To elucidate more fully the molecular mechanism of AFB1-induced mutagenesis, an intercalation inhibitor was designed to probe the effects of intercalation by AFB1 epoxide on its reaction with DNA. DNA duplexes were prepared consisting of a target strand containing multiple potentially reactive guanines and a nontarget strand containing a cis-syn thymidine-benzofuran photoproduct. Because the covalently linked benzofuran moiety physically occupies an intercalation site, we reasoned that such a site would be rendered inaccessible to AFB1 epoxide. By strategic positioning of this intercalation inhibitor in the intercalation site 5′ to a specific guanine, the adduct yield at that site was greatly diminished, indicating that intercalation by AFB1 epoxide contributes favorably to adduct formation. Using this approach it has been possible to simplify the production of site-specifically modified oligonucleotides containing AFB1 adducts in the sequence context of a p53 mutational hotspot. Moreover, we report herein isolation of site-specifically AFB1-modified oligonucleotides in sequences containing multiple guanines. Use of intercalation inhibitors will facilitate both investigation of the ability of other carcinogens to intercalate into DNA and the synthesis of specific carcinogen-DNA adducts.
Resumo:
NF-κB is a major transcription factor consisting of 50(p50)- and 65(p65)-kDa proteins that controls the expression of various genes, among which are those encoding cytokines, cell adhesion molecules, and inducible NO synthase (iNOS). After initial activation of NF-κB, which involves release and proteolysis of a bound inhibitor, essential cysteine residues are maintained in the active reduced state through the action of thioredoxin and thioredoxin reductase. In the present study, activation of NF-κB in human T cells and lung adenocarcinoma cells was induced by recombinant human tumor necrosis factor α or bacterial lipopolysaccharide. After lipopolysaccharide activation, nuclear extracts were treated with increasing concentrations of selenite, and the effects on DNA-binding activity of NF-κB were examined. Binding of NF-κB to nuclear responsive elements was decreased progressively by increasing selenite levels and, at 7 μM selenite, DNA-binding activity was completely inhibited. Selenite inhibition was reversed by addition of a dithiol, DTT. Proportional inhibition of iNOS activity as measured by decreased NO products in the medium (NO2− and NO3−) resulted from selenite addition to cell suspensions. This loss of iNOS activity was due to decreased synthesis of NO synthase protein. Selenium at low essential levels (nM) is required for synthesis of redox active selenoenzymes such as glutathione peroxidases and thioredoxin reductase, but in higher toxic levels (>5–10 μM) selenite can react with essential thiol groups on enzymes to form RS–Se–SR adducts with resultant inhibition of enzyme activity. Inhibition of NF-κB activity by selenite is presumed to be the result of adduct formation with the essential thiols of this transcription factor.
Resumo:
It is a goal of cancer chemotherapy to achieve the selective killing of tumor cells while minimizing toxicity to normal tissues. We describe the design of selective toxins forming DNA adducts that attract the estrogen receptor (ER), a transcription factor that is overexpressed in many human breast and ovarian tumors. The compounds consist of 4-(3-aminopropyl)-N,N-(2-chloroethyl)-aniline linked to 2-(4′-hydroxyphenyl)-3-methyl-5-hydroxy-indole. The former moiety is a DNA damaging nitrogen mustard and the latter is a ligand for the ER. The connection between these groups was refined to permit DNA adducts formed by the mustard portion of the molecule to present the ligand domain so that it was able to interact efficiently with the ER. By using 16-mers containing specific DNA adducts, it was determined that monoadducts and putative intrastrand crosslinks were preferred targets for the ER over interstrand crosslinks. A series of structurally related 2-phenylindole mustards was prepared, some of which were selectively toxic to the ER-positive breast cancer cell line MCF-7, as compared with the ER(−) negative line MDA-MB231. The ability both to bind to DNA and to interact significantly with the ER were essential to achieve selective lethality toward ER(+) cells. Compounds forming DNA adducts without the ability to bind receptor showed similar toxicities in the two cell lines. Several models could explain the selective toxicity of the mustard–phenylindole compounds toward ER(+) cells. The favored model suggests that a mustard–DNA adduct is shielded by the ER from DNA repair enzymes and hence cells possessing an abundance of the ER selectively retain the adduct and are killed.
Resumo:
Nondistorting C4′ backbone adducts serve as molecular tools to analyze the strategy by which a limited number of human nucleotide excision repair (NER) factors recognize an infinite variety of DNA lesions. We have constructed composite DNA substrates containing a noncomplementary site adjacent to a nondistorting C4′ adduct to show that the loss of hydrogen bonding contacts between partner strands is an essential signal for the recruitment of NER enzymes. This specific conformational requirement for excision is mediated by the affinity of xeroderma pigmentosum group A (XPA) protein for nonhybridizing sites in duplex DNA. XPA recognizes defective Watson–Crick base pair conformations even in the absence of DNA adducts or other covalent modifications, apparently through detection of hydrophobic base components that are abnormally exposed to the double helical surface. This recognition function of XPA is enhanced by replication protein A (RPA) such that, in combination, XPA and RPA constitute a potent molecular sensor of denatured base pairs. Our results indicate that the XPA–RPA complex may promote damage recognition by monitoring Watson–Crick base pair integrity, thereby recruiting the human NER system preferentially to sites where hybridization between complementary strands is weakened or entirely disrupted.