993 resultados para Chromosomal rearrangement


Relevância:

20.00% 20.00%

Publicador:

Resumo:

Background: The Trypanosoma cruzi genome was sequenced from a hybrid strain (CL Brener). However, high allelic variation and the repetitive nature of the genome have prevented the complete linear sequence of chromosomes being determined. Determining the full complement of chromosomes and establishing syntenic groups will be important in defining the structure of T. cruzi chromosomes. A large amount of information is now available for T. cruzi and Trypanosoma brucei, providing the opportunity to compare and describe the overall patterns of chromosomal evolution in these parasites. Methodology/Principal Findings: The genome sizes, repetitive DNA contents, and the numbers and sizes of chromosomes of nine strains of T. cruzi from four lineages (TcI, TcII, TcV and TcVI) were determined. The genome of the TcI group was statistically smaller than other lineages, with the exception of the TcI isolate Tc1161 (Jose-IMT). Satellite DNA content was correlated with genome size for all isolates, but this was not accompanied by simultaneous amplification of retrotransposons. Regardless of chromosomal polymorphism, large syntenic groups are conserved among T. cruzi lineages. Duplicated chromosome-sized regions were identified and could be retained as paralogous loci, increasing the dosage of several genes. By comparing T. cruzi and T. brucei chromosomes, homologous chromosomal regions in T. brucei were identified. Chromosomes Tb9 and Tb11 of T. brucei share regions of syntenic homology with three and six T. cruzi chromosomal bands, respectively. Conclusions: Despite genome size variation and karyotype polymorphism, T. cruzi lineages exhibit conservation of chromosome structure. Several syntenic groups are conserved among all isolates analyzed in this study. The syntenic regions are larger than expected if rearrangements occur randomly, suggesting that they are conserved owing to positive selection. Mapping of the syntenic regions on T. cruzi chromosomal bands provides evidence for the occurrence of fusion and split events involving T. brucei and T. cruzi chromosomes.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Baccharis dracunculifolia De Candole (Asteraceae), a native plant from the Brazilian ""cerrado"", is widely used in folk medicine as an anti-inflammatory agent and for the treatment of gastrointestinal diseases. B. dracunculifolia has been described as the most important plant source of propolis in southeastern Brazil, which is called green propolis due to its color. The aim of the present study was to evaluate the mutagenic and antimutagenic effects of the ethyl acetate extract of B. dracunculifolia leaves (Bd-EAE) on Chinese hamster ovary cells. On one hand, the results showed a significant increase in the frequencies of chromosome aberrations at the highest Bd-EAE concentration tested (100 mu g/mL). On the other hand, the lowest Bd-EAE concentration tested (12.5 mu/mL) significantly reduced the chromosome damage induced by the chemotherapeutic agent doxorubicin. The present results indicate that Bd-EAE has the characteristics of a so-called Janus compound, that is, Bd-EAE is mutagenic at higher concentrations, whereas it displays a chemopreventive effect on doxorubicin-induced mutagenicity at lower concentrations. The constituents of B. dracunculifolia responsible for its mutagenic and antimutagenic effects are probably flavonoids and phenylpropanoids, since these compounds can act either as pro-oxidants or as free radical scavengers depending on their concentration.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Solanum lycocarpum A. St. Hil. (Solanaceae) is a hairy shrub or small much-branched tree of the Brazilian Cerrado. S. lycocarpum fruits are commonly used in traditional medicine in powder form or as folk preparations for the treatment of diabetes and obesity, as well as for controlling cholesterol levels. The aim of the present study was to chemically characterize the hydroalcoholic extract (SL) of S. lycocarpum by determination of total flavonoids and total poyphenols and quantification of steroidal alkaloids, as well as to evaluate its mutagenic and/or antimutagenic potential on V79 cells and Swiss mice using chromosomal aberrations and bone marrow micronucleus assays, respectively. Three concentrations of SL (16, 32, and 24 mu g/mL) were used for the evaluation of its mutagenic potential in V79 cells and four doses (0.25, 0.50, 1.0, and 2.0 g/kg body weight) were used for Swiss mice. In the antimutagenicity assays, the different concentrations of SL were combined with the chemotherapeutic agent doxorubicin (DXR). HPLC analysis of SL gave contents of 6.57% +/- 0.41 of solasonine and 4.60% +/- 0.40 of solamargine. Total flavonoids and polyphenols contents in SL were 0.04 and 3.60%, respectively. The results showed that not only SL exerted no mutagenic effect, but it also significantly reduced the frequency of chromosomal aberrations induced by DXR in both V79 cells and micronuclei in Swiss mice at the doses tested.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Sickle cell disease (SCD) is an inherited disorder caused by a single nucleotide substitution in the P-globin gene. The clinical heterogeneity observed in SCD patients has been attributed to environmental and genetic factors. The patients are subjected to increased oxidative stress, particularly during vaso-occlusive crises and acute chest pain. Another possible cause of oxidative stress in SCD is the high concentration of iron in the patients` plasma. The increase in oxidative stress could be a relevant risk factor for mutagenesis and carcinogenesis. Studies on the frequency of basal chromosomal aberrations in cultured lymphocytes from SCD patients have not been reported so far. In order to contribute to the understanding of the role of the different biomarkers and their relationship with the extremely variable clinical manifestation of SCD, we investigated the frequency of chromosome damage in peripheral lymphocytes from sickle cells patients and healthy controls. We found an increased frequency of chromosome damage and percentage of aberrant metaphases in these patients when compared with control subjects, even at basal values (p < 0.05). In the cytogenetic sensitivity assay, the results showed that these patients presented a marked decrease in the mitotic index values compared with healthy controls. Cisplatin-induced chromosomal damage in lymphocytes from these patients was significantly higher than the frequency measured in healthy controls. The results obtained in the present study showed that more investigations are needed in order to elucidate the susceptibility to genomic instability of SCD patients.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The Western European house mouse, Mus domesticus, includes many distinct Robertsonian (Rb) chromosomal races. Two competing hypotheses may explain the distribution of Rb translocations found in different populations: they may have arisen independently multiple times or they may have arisen once and been spread through long distance dispersal. We investigated the origin of the Rb 5.15 translocation using 6 microsatellite loci linked to the centromeres of chromosomes 5 and 15 in 84 individuals from 3 Rb populations and 4 neighboring standard-karyotype populations. Microsatellite variation on the 5.15 metacentric chromosomes was significantly reduced relative to the amount of variation found on acrocentric chromosomes 5 and 15, suggesting that linked microsatellite loci can track specific mutational events. Phylogenetic analyses resulted in trees which are consistent with multiple origins of the 5.15 metacentric found in the three Rb populations. These results suggest that cytologically indistinguishable mutations have arisen independently in natural populations of house mice.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

A common mechanism for chromosomal fragile site genesis is not yet apparent. Folate-sensitive fragile sites are expanded p(CCG)n repeats that arise from longer normal alleles. Distamycin A or bromodeoxyuridine-inducible fragile site FRA16B is an expanded AT-rich similar to 33 bp repeat; however, the relationship between normal and fragile site alleles is not known. Here, we report that bromodeoxyuridine-inducible, distamycin A-insensitive fragile site FRA10B is composed of expanded similar to 42 bp repeats. Differences in repeat motif length or composition between different FRA10B families indicate multiple independent expansion events. Some FRA10B alleles comprise a mixture of different expanded repeat motifs. FRA10B fragile site and long normal alleles share flanking polymorphisms. Somatic and intergenerational FRA10B repeat instability analogous to that found in expanded trinucleotide repeats supports dynamic mutation as a common mechanism for repeat expansion.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

We have previously isolated and characterized murine MYB binding protein (p160) 1a, a protein that specifically interacts with the leucine zipper motif within the negative regulatory domain of the c-Myb proto-oncoprotein, We now describe the molecular cloning of the human MYBBP1A cDNA and chromosomal localization to 17p13.3 by fluorescence in situ hybridization analysis, Given the likely presence of a tumor suppressor gene (or genes) within this region of chromosome 17, the position of MYBBP1A was further mapped by radiation hybrid analysis and was found to lie between markers D17S1828 and D17S938. A P1 artificial chromosome clone containing the 5' region of MYBBP1A was isolated and indicates a physical linkage between MYBBP1A and the 15-lipoxygenase gene (ALOX15), A novel, polymorphic (CA)(25) dinucleotide repeat was also isolated from this PAC and may serve as a useful marker for MYBBP1A and this region of chromosome 17. (C) 1999 Academic Press.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

It has been proposed that common aphidicolin-inducible fragile sites, in general, predispose to specific chromosomal breakage associated with deletion, amplification, and/or translocation in certain forms of cancer. Although this appears to be the case for the fragile site FRA3B and may be the case for FRA7G, it is not Set clear whether this association is a general property of this class of fragile site. The major aim of the present study was to determine whether the FRA16D chromosomal fragile site locus has a role to play in predisposing DNA sequences within and adjacent to the fragile site to DNA instability (such as deletion or translocation), which could lead to or be associated with neoplasia. We report the localization of FRA16D within a contig of cloned DNA and demonstrate that this fragile site coincides with a region of homozygous deletion in a gastric adenocarcinoma cell line and is bracketed by translocation breakpoints in multiple myeloma, as reported previously (Chesi, M., et al., Blood, 91: 4457-4463, 1998), Therefore, given similar findings at the FRA3B and FRA7G fragile sites, it is likely that common aphidicolin-inducible fragile sites exhibit the general property of localized DNA instability in cancer cells.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Fluorescence in situ hybridization of a tile path of DNA subclones has previously enabled the cytogenetic definition of the minimal DNA sequence which spans the FRA16D common chromosomal fragile site, located at 16q23.2. Homozygous deletion of the FRA16D locus has been reported in adenocarcinomas of stomach, colon, lung and ovary. We have sequenced the 270 kb containing the FRA16D fragile site and the minimal homozygously deleted region in tumour cells. This sequence enabled localization of some of the tumour cell breakpoints to regions which contain AT-rich secondary structures similar to those associated with the FRA10B and FRA16B rare fragile sites. The FRA16D DNA sequence also led to the identification of an alternatively spliced gene, named FOR (fragile site FRA16D oxidoreductase), exons of which span both the fragile site and the minimal region of homozygous deletion. In addition, the complete DNA sequence of the FRA16D-containing FOR intron reveals no evidence of additional authentic transcripts. Alternatively spliced FOR transcripts (FOR I, FOR II and FOR III) encode proteins which share N-terminal WW domains and differ at their C-terminus, with FOR III having a truncated oxidoreductase domain. FRA16D-associated deletions selectively affect the FOR gene transcripts. Three out of five previously mapped translocation breakpoints in multiple myeloma are also located within the FOR gene. FOR is therefore the principle genetic target for DNA instability at 16q23.2 and perturbation of FOR function is likely to contribute to the biological consequences of DNA instability at FRA16D in cancer cells.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Apiomorpha Rubsaamen (Hemiptera: Coccoidea: Eriococcidae) is one of the most chromosomally diverse of all animal genera. There is extensive karyotypic variation within many of the morphologically defined species, including A. munita (Schrader) which is here reported to have diploid chromosome counts ranging from 6 to more than 100. Each of the three morphologically defined subspecies of A. munita also displays considerable chromosomal variation: A. m. tereticornuta Gullan (2n =6, 8, 20, 22 or 24), A. m. malleensis Gullan (2n =6, 20, 22, 24 or 26), and A. m. munita (Schrader) (2n=54 or >100). Apiomorpha munita appears to occur only on eucalypts of the informal subgenus Symphyomyrtus, with each of the subspecies of A. munita restricted to discrete symphyomyrt sections. Several different karyotypic forms within each subspecies of A. munita appear to be restricted to only one or a few eucalypt species or series. The association between apparent host specificity and chromosomal rearrangements in A. munita suggests that both may be playing an active role in taxon divergence in Apiomorpha. (C) 2001 The Linnean Society of London.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

We aimed to study patterns of variation and factors influencing the evolutionary dynamics of a satellite DNA, pBuM, in all seven Drosophila species from the buzzatii cluster (repleta group). We analyzed 117 alpha pBuM-1 (monomer length 190 bp) and 119 composite alpha/beta (370 bp) pBuM-2 repeats and determined the chromosome location and long-range organization on DNA fibers of major sequence variants. Such combined methodologies in the study of satDNAs have been used in very few organisms. In most species, concerted evolution is linked to high copy number of pBuM repeats. Species presenting low-abundance and scattered distributed pBuM repeats did not undergo concerted evolution and maintained part of the ancestral inter-repeat variability. The alpha and alpha/beta repeats colocalized in heterochromatic regions and were distributed on multiple chromosomes, with notable differences between species. High-resolution FISH revealed array sizes of a few kilobases to over 0.7 Mb and mutual arrangements of alpha and alpha/beta repeats along the same DNA fibers, but with considerable changes in the amount of each variant across species. From sequence, chromosomal and phylogenetic data, we could infer that homogenization and amplification events involved both new and ancestral pBuM variants. Altogether, the data on the structure and organization of the pBuM satDNA give insights into genome evolution including mechanisms that contribute to concerted evolution and diversification.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Fragile sites are nonstaining gaps in chromosomes induced by specific tissue culture conditions. They vary both in population frequency and in the culture conditions required for induction. Folate-sensitive fragile sites are due to expansion of p(CCG)(n) trinucleotide repeats; however, the relationship between sequence composition and the chemistry of induction of fragile sites is unclear. To clarify this relationship, the distamycin A-sensitive fragile site FRA16B was isolated by positional cloning and found to be an expanded 33 bp AT-rich minisatellite repeat, p(ATATATTATATATTATATCTAATAATATAT(C)/(A)TA)(n) (consistent with DNA sequence binding preferences of chemicals that induce its cytogenetic expression). Therefore the mutation mechanism associated with trinucleotide repeats is also a property of minisatellite repeats (variable number tandem repeats).

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Ergosterol is an important compound responsible to maintain integrity and fluidity of Leishmania spp. membranes. Starting from an overexpression/selection method, our group has isolated and mapped nine different loci of Leishmania (L.) major related to resistance against two inhibitors of the ergosterol biosynthesis pathway, terbinafine (TBF) and itraconazole (ITZ). Individual functional analysis after overexpression induction of these loci in the presence of TBF and/or ITZ [or the ITZ analog ketoconazole (CTZ)] have shown low but significant levels of resistance after transfection into L. major wild-type parasites. In this work, we have shown the insert mapping and chromosomal identification of one of these loci (cosItz2). Functional analysis experiments associated with chromosomal localization by comparison at genomic database allowed us to identify two prospective gene-protein systems not related to the ergosterol biosynthesis and capable to confer wild-type cells resistance to ITZ-CTZ after transfection. We expected that this approach can open new insights for a better understanding of mechanisms of ITZ-CTZ action and resistance in Leishmania resulting in new strategies for the leishmaniasis treatment.