Proline ring conformations corresponding to a bistable jump model from 13C spin-lattice relaxation times

A formalism for extracting the conformations of a proline ring based on the bistable jump model of R. E. London [(1978) J. Am. Chem. Soc. 100, 2678-2685] from 13C spin-lattice relaxation times (T1) is given. The method is such that the relaxation data are only partially used to generate the conformations; these conformations are constrained to satisfy the rest of the relaxation data and to yield acceptable ring geometry. An alternate equation for T1 of 13C nuclei to that of London is given. The formalism is illustrated through an example.

Proline-containing β-turns in peptides and proteins: Analysis of structural data on globular proteins

Tetrapeptide sequences of the type Z-Pro-Y-X were obtained from the crystal structure data on 34 globular proteins, and used in an analysis of the positional preferences of the individual amino acid residues in the β-turn conformation. The effect of fixing proline as the second position residue in the tetrapeptide sequence was studied by comparing the data obtained on the positional preferences with the corresponding data obtained by Chou and Fasman using the Z-R-Y-X sequence, where no particular residue was fixed in any of the four positions. While, in general, several amino acid residues having relatively very high or very low preferences for specific positions were found to be common to both the Z-Pro-Y-X and Z-R-Y-X sequences, many significant differences were found between the two sets of data, which are to be attributed to specific interactions arising from the presence of the proline residue.

Alterations in the activities of the enzymes of proline metabolism in Ragi (Eleusine coracana) leaves during water stress

Free proline content in Ragi (Eleusine coracana) leaves increased markedly (6 to 85 fold) as the degree of water stress, created by polyethylene gylcol treatment, was prolonged There was also a marginal increase in soluble proteins in the stressed leaves as compared to that in the controls. Water stress stimulated the activities of ornithine aminotransferase and pyrroline-5-carboxylate reductase, the enzymes of proline biosynthesis and markedly inhibited the enzymes involved in proline degradation viz., proline oxidase and pyrroline-5-carboxylate dehydrogenase. These results suggest that increase in free proline content of Ragi leaves could be due to enhanced activities of the enzymes synthesizing proline but more importantly due to severe inhibition of the enzymes degrading proline. These observations establish for the first time, the pathway of proline metabolism in plants by way of detection of the activities of all the enzymes involved and also highlight the role of these enzymes in proline accumulation during water stress.

Natural Abundant Solid State NMR Studies in Designed Tripeptides for Differentiation of Multiple Conformers

Solid state NMR (SSNMR) experiments on heteronuclei in natural abundance are described for three synthetically designed tripeptides Piv-(L)Pro_(L)Pro-(L)Phe-OMe (1), Piv-(D)Pro_(L)Pro_(L)Phe-OMe (2), and Piv-(D)Pro_(L)Pro_(L)Phe-NHMe (3). These peptides exist in different conformation as shown by solution state NMR and single crystal X-ray analysis (Chatterjee et al., Chem Eur J 2008, 14, 6192). In this study, SSNMR has been used to probe the conformations of these peptides in their powder form. The C-13 spectrum of peptide (1) showed doubling of resonances corresponding to cis/cis form, unlike in solution where the similar doubling is attributed to cis/trans form. This has been confirmed by the chemical shift differences of C-beta and C-gamma carbon of Proline in peptide (1) both in solution and SSNMR. Peptide (2) and (3) provided single set of resonances which represented all transform across the di-Proline segment. The results are In agreement with the X-ray analysis. Solid state N-15 resonances, especially from Proline residues provided additional information, which is normally not observable in solution state NMR. H-1 chemical shifts are also obtained from a two-dimensional heteronuclear correlation experiment between H-1-C-13. The results confirm the utility of NMR as a useful tool for identifying different conformers in peptides in the solid state. (C) 2009 Wiley Periodicals, Inc. Biopolymers 91: 851-860, 2009.

Water stress induced alterations in ornithine aminotransferase of ragi (Eleusine coracana): Protection by proline against heat inactivation and denaturation by urea and guanidinium chloride

Water stress resulted in a specific response leading to a large and significant increase (80-fold) in free proline content of ragi (Eleusine coracana) leaves and seedlings. L-Proline protected ornithine aminotransferase, an enzyme in the pathway for proline biosynthesis, isolated from normal and stressed ragi leaves against heat inactivation and denaturation by urea and guanidinium chloride. The protection of the stressed enzyme by L-proline was much more complete than that of the enzyme isolated from normal leaves. While L-ornithine, one of the substrates, protected the stressed enzyme against inactivation, it enhanced the rate of inactivation of the normal enzyme. α-Ketoglutarate protected both the normal and stressed enzyme against inactivation and denaturation. These results support the suggestion that ornithine aminotransferase has undergone a structural alteration during water stress. In view of the causal relationship between elevated temperature and water stress of plants under natural conditions, the protection afforded by proline against inactivation and denaturation of the enzyme from stressed leaves assumes significance. These results provide an explanation for a possible functional importance of proline accumulation during water stress.

An explanation for the rare occurrence of cis peptide units in proteins and polypeptides

The rarity of occurrence of cis peptide units is only partially explained by the higher intrinsic energy of the cis over the trans form, which provides a probability of 0·01 for cis peptide units to occur. An additional factor is the conformational restriction imposed by the occurrence of a cis peptide unit in a chain of trans units. Taking a section of three peptide units having the sequences trans-trans-trans (ttt) and trans-cis-trans (tct), conformational energy calculations indicate that the latter can occur only to an extent of 0·1%, unless there occurs the sequence X-Pro, in which case it is of the order of 30%. This explains the extreme rarity of cis peptide units, in general; however, it follows that even with non-prolyl residues, cis peptide units are not forbidden, but can occur in some rare examples and should be looked for.

Polypurine/polypyrimidine sequences as cis-acting transcriptional regulators

Genome sequence information has generated increasing evidence for the claim that repetitive DNA sequences present within and around genes could play a important role in the regulation of gene expression. Polypurine/polypyrimidine sequences [poly(Pu/Py)] have been observed in the vicinity of promoters and within the transcribed regions of many genes. To understand whether such sequences influence the level of gene expression, we constructed several prokaryotic and eukaryotic expression vectors incorporating poly(Pu/Py) repeats both within and upstream of a reporter gene, lacZ (encoding β-galactosidase), and studied its expression in vivo. We find that, in contrast to the situation in Escherichia coli, the presence of poly(Pu/Py) sequences within the gene does not significantly inhibit gene expression in mammalian cells. On the other hand, the presence of such sequences upstream of lacZ leads to a several-fold reduction of gene expression in mammalian cells. Similar down-regulation was observed when a structural cassette containing poly(Pu/Py) sequences upstream of lacZ was integrated into yeast chromosome V. Sequence analysis of the nine totally sequenced yeast chromosomes shows that a large number of such sequences occur upstream of ORFs. On the basis of our experimental results and DNA sequence analysis, we propose that these sequences can function as cis-acting transcriptional regulators.

Nucleotide sequence of a cucumber chloroplast proline tRNA

The nucleotide sequence of a proline tRNA (anticodon UGG) from cucumber chloroplasts has been determined. The sequence is: pAAGGAUGUAGCGCAGCUUCADAGCGCAΨUUGUUUUGGNΨFACAAAAUm7GUCACGGGTΨCAAAUCCUGUCAUCCUUACCAOH. It shows 93% homology with spinach chloroplast tRNAPro (UGG) and 72% homology with bean mitochondrial tRNA Pro (UGG), the other two known plant organellar tRNAsPro.

Positional Preferences of Polypurine/Polypyrimidine Tracts in Saccharomyces cerevisiae Genome: Implications for cis Regulation of Gene Expression

The complete genome of the baker's yeast S. cerevisiae was analyzed for the presence of polypurine/polypyrimidine (poly[pu/py]) repeats and their occurrences were classified on the basis of their location within and outside open reading frames (ORFs). The analysis reveals that such sequence motifs are present abundantly both in coding as well as noncoding regions. Clear positional preferences are seen when these tracts occur in noncoding regions. These motifs appear to occur predominantly at a unit nucleosomal length both upstream and downstream of ORFs. Moreover, there is a biased distribution of polypurines in the coding strands when these motifs occur within open reading frames. The significance of the biased distribution is discussed with reference to the occurrence of these motifs in other known mRNA sequences and expressed sequence tags. A model for cis regulation of gene expression is proposed based on the ability of these motifs to form an intermolecular triple helix structure when present within the coding region and/or to modulate nucleosome positioning via enhanced histone affinity when present outside coding regions.

Identification and functional characterization of a cis-acting positive DNA element regulating CYP 2B1/B2 gene transcription in rat liver

A positive cis-acting DNA element in the near 5'-upstream region of the CYP2B1/B2 genes in rat liver was found to play an important role in the transcription of these genes. An oligonucleotide covering -69 to -98 nt mimicked the gel mobility shift pattern given by the fragment -179 to +29 nt, which was earlier found adequate to confer the regulatory features of this gene. Two major complexes were seen, of which the slower and faster moving complexes became intense under uninduced and Phenobarbitone-induced conditions respectively. Minigene cloned DNA plasmid covering -179 to +181 nt in pUC 19 and Bal 31 mutants derived from this parent were transcribed in whole nuclei and cell free transcription extracts and mutants containing only upto -75 nt of the upstream were poorly transcribed. Transcription extracts from phenobarbitone-injected rat liver nuclei were significantly more active than extracts from uninduced rats in transcribing the minigene constructs. Addition of the oligonucleotide (-69 to -98nt) specifically inhibited the transcription of the minigene construct (-179 to +181 nt) in the cell free transcription system. It is therefore, concluded that the region -69 to -98 nt acts as a positive cis-acting element in the transcription of the CYP2B1/B2 genes and in mediating the inductive effects of phenobarbitone.

Transcriptional Silencing of a tRNA1Gly Copy from within a Multigene Family Is Modulated by Distal cis Elements

Individual copies of tRNA1Gly from within the multigene family in Bombyx mori could be classified based on in vitro transcription in homologous nuclear extracts into three categories of highly, moderately, or weakly transcribed genes. Segregation of the poorly transcribed gene copies 6 and 7, which are clustered in tandem within 425 base pairs, resulted in enhancement of their individual transcription levels, but the linkage itself had little influence on the transcriptional status. For these gene copies, when fused together generating a single coding region, transcription was barely detectable, which suggested the presence of negatively regulating elements located in the far flanking sequences. They exerted the silencing effect on transcription overriding the activity of positive regulatory elements. Systematic analysis of deletion, chimeric, and mutant constructs revealed the presence of a sequence element TATATAA located beyond 800 nucleotides upstream to the coding region acting as negative modulator, which when mutated resulted in high level transcription. Conversely, a TATATAA motif reintroduced at either far upstream or far downstream flanking regions exerted a negative effect on transcription. The location of cis-regulatory sequences at such farther distances from the coding region and the behavior of TATATAA element as negative regulator reported here are novel. These element(s) could play significant roles in activation or silencing of genes from within a multigene family, by recruitment or sequestration of transcription factors.

Racemization at proline residues during peptide bond formation : A study of diastereomeric mixtures of synthetic alamethicin fragments by 270 MHz 1H NMR

The stepwise synthesis of amino terminal pentapeptide of alamethicin, Z-Aib-Pro-Aib-Ala-Aib-OMe, by the dicyclohexylcarbodiimide mediated couplings leads to extensive racemization at the Ala and Pro residues. Racemization is largely suppressed by the use of additives like N-hydroxysuccinimide and 1-hydroxybenzotriazole. The presence of diastereomeric peptides may be detected by the observation of additional methyl ester and benzylic methylene signals in the 270 MHz 1H NMR spectra. Unambiguous spectral assignment of the signals to the diastereomers has been carried out by the synthesis and NMR studies of the D-Ala tetra and pentapeptides. The racemization at Pro is of particular relevance in view of the reported lack of inversion at C-terminal Pro on carboxyl activation.

Enantioselective syntheses of cis, syn, cis- and cis, anti, cis-linear triquinanes

Enantioselective syntheses of both cis, syn, cis- and cis, anti, cis-linear triquinanes, starting from the readily available (S)-campholenaldehyde, employing an RCM reaction-based cyclopentannulation strategy, are described.

Enantioselective syntheses of diquinane and (cis, anti, cis)-linear triquinanes

The enantioselective syntheses of diquinane and cis, anti, cis-linear triquinanes, starting from the readily available (S)-campholenaldehyde, employing an intramolecular rhodium carbenoid CH insertion reaction, are described. (C) 2010 Elsevier Ltd. All rights reserved.