Common chromosomal fragile site FRA16D sequence: identification of the FOR gene spanning FRA16D and homozygous deletions and translocation breakpoints in cancer cells

Fluorescence in situ hybridization of a tile path of DNA subclones has previously enabled the cytogenetic definition of the minimal DNA sequence which spans the FRA16D common chromosomal fragile site, located at 16q23.2. Homozygous deletion of the FRA16D locus has been reported in adenocarcinomas of stomach, colon, lung and ovary. We have sequenced the 270 kb containing the FRA16D fragile site and the minimal homozygously deleted region in tumour cells. This sequence enabled localization of some of the tumour cell breakpoints to regions which contain AT-rich secondary structures similar to those associated with the FRA10B and FRA16B rare fragile sites. The FRA16D DNA sequence also led to the identification of an alternatively spliced gene, named FOR (fragile site FRA16D oxidoreductase), exons of which span both the fragile site and the minimal region of homozygous deletion. In addition, the complete DNA sequence of the FRA16D-containing FOR intron reveals no evidence of additional authentic transcripts. Alternatively spliced FOR transcripts (FOR I, FOR II and FOR III) encode proteins which share N-terminal WW domains and differ at their C-terminus, with FOR III having a truncated oxidoreductase domain. FRA16D-associated deletions selectively affect the FOR gene transcripts. Three out of five previously mapped translocation breakpoints in multiple myeloma are also located within the FOR gene. FOR is therefore the principle genetic target for DNA instability at 16q23.2 and perturbation of FOR function is likely to contribute to the biological consequences of DNA instability at FRA16D in cancer cells.

Extensive chromosomal variation associated with taxon divergence and host specificity in the gall-inducing scale insect Apiomorpha munita (Schrader) (Hemiptera : Sternorrhyncha : Coccoidea : Eriococcidae)

Apiomorpha Rubsaamen (Hemiptera: Coccoidea: Eriococcidae) is one of the most chromosomally diverse of all animal genera. There is extensive karyotypic variation within many of the morphologically defined species, including A. munita (Schrader) which is here reported to have diploid chromosome counts ranging from 6 to more than 100. Each of the three morphologically defined subspecies of A. munita also displays considerable chromosomal variation: A. m. tereticornuta Gullan (2n =6, 8, 20, 22 or 24), A. m. malleensis Gullan (2n =6, 20, 22, 24 or 26), and A. m. munita (Schrader) (2n=54 or >100). Apiomorpha munita appears to occur only on eucalypts of the informal subgenus Symphyomyrtus, with each of the subspecies of A. munita restricted to discrete symphyomyrt sections. Several different karyotypic forms within each subspecies of A. munita appear to be restricted to only one or a few eucalypt species or series. The association between apparent host specificity and chromosomal rearrangements in A. munita suggests that both may be playing an active role in taxon divergence in Apiomorpha. (C) 2001 The Linnean Society of London.

Sequence analysis, chromosomal distribution and long-range organization show that rapid turnover of new and old pBuM satellite DNA repeats leads to different patterns of variation in seven species of the Drosophila buzzatii cluster

We aimed to study patterns of variation and factors influencing the evolutionary dynamics of a satellite DNA, pBuM, in all seven Drosophila species from the buzzatii cluster (repleta group). We analyzed 117 alpha pBuM-1 (monomer length 190 bp) and 119 composite alpha/beta (370 bp) pBuM-2 repeats and determined the chromosome location and long-range organization on DNA fibers of major sequence variants. Such combined methodologies in the study of satDNAs have been used in very few organisms. In most species, concerted evolution is linked to high copy number of pBuM repeats. Species presenting low-abundance and scattered distributed pBuM repeats did not undergo concerted evolution and maintained part of the ancestral inter-repeat variability. The alpha and alpha/beta repeats colocalized in heterochromatic regions and were distributed on multiple chromosomes, with notable differences between species. High-resolution FISH revealed array sizes of a few kilobases to over 0.7 Mb and mutual arrangements of alpha and alpha/beta repeats along the same DNA fibers, but with considerable changes in the amount of each variant across species. From sequence, chromosomal and phylogenetic data, we could infer that homogenization and amplification events involved both new and ancestral pBuM variants. Altogether, the data on the structure and organization of the pBuM satDNA give insights into genome evolution including mechanisms that contribute to concerted evolution and diversification.

History teaching today: wanderings, gains and losses

This article analyzes traditions of debate about the teaching of history in Brazil since the 1964-1984 dictatorship. It discusses the changes, continuities, achievements and losses in the history of the discipline. It emphasizes the importance of school culture, the necessary continuity of the school as an institution and dialogue with non-school forms of education.

Human chromosomal fragile site FRA16B is an amplified AT-rich minisatellite repeat

Fragile sites are nonstaining gaps in chromosomes induced by specific tissue culture conditions. They vary both in population frequency and in the culture conditions required for induction. Folate-sensitive fragile sites are due to expansion of p(CCG)(n) trinucleotide repeats; however, the relationship between sequence composition and the chemistry of induction of fragile sites is unclear. To clarify this relationship, the distamycin A-sensitive fragile site FRA16B was isolated by positional cloning and found to be an expanded 33 bp AT-rich minisatellite repeat, p(ATATATTATATATTATATCTAATAATATAT(C)/(A)TA)(n) (consistent with DNA sequence binding preferences of chemicals that induce its cytogenetic expression). Therefore the mutation mechanism associated with trinucleotide repeats is also a property of minisatellite repeats (variable number tandem repeats).

Identification and chromosomal localization of one locus of Leishmania (L.) major related with resistance to itraconazole

Ergosterol is an important compound responsible to maintain integrity and fluidity of Leishmania spp. membranes. Starting from an overexpression/selection method, our group has isolated and mapped nine different loci of Leishmania (L.) major related to resistance against two inhibitors of the ergosterol biosynthesis pathway, terbinafine (TBF) and itraconazole (ITZ). Individual functional analysis after overexpression induction of these loci in the presence of TBF and/or ITZ [or the ITZ analog ketoconazole (CTZ)] have shown low but significant levels of resistance after transfection into L. major wild-type parasites. In this work, we have shown the insert mapping and chromosomal identification of one of these loci (cosItz2). Functional analysis experiments associated with chromosomal localization by comparison at genomic database allowed us to identify two prospective gene-protein systems not related to the ergosterol biosynthesis and capable to confer wild-type cells resistance to ITZ-CTZ after transfection. We expected that this approach can open new insights for a better understanding of mechanisms of ITZ-CTZ action and resistance in Leishmania resulting in new strategies for the leishmaniasis treatment.

Investigating 22q11.2 Deletion and Other Chromosomal Aberrations in Fetuses With Heart Defects Detected by Prenatal Echocardiography

Congenital heart disease (CHD) is the most common birth defect and the leading cause of mortality in the first year of life. In fetuses with a heart defect, chromosomal abnormalities are very frequent. Besides aneuploidy, 22q11.2 deletion is one of the most recognizable chromosomal abnormalities causing CHD. The frequency of this abnormality varies in nonselected populations. This study aimed to investigate the incidence of the 22q11.2 deletion and other chromosomal alterations in a Brazilian sample of fetuses with structural cardiac anomalies detected by fetal echocardiography. In a prospective study, 68 fetuses with a heart defect were evaluated. Prenatal detection of cardiac abnormalities led to identification of aneuploidy or structural chromosomal anomaly in 35.3% of these cases. None of the fetuses with apparently normal karyotypes had a 22q11.2 deletion. The heart defects most frequently associated with chromosomal abnormalities were atrioventricular septal defect (AVSD), ventricular septal defect (VSD), and tetralogy of Fallot. Autosomal trisomies 18 and 21 were the most common chromosomal abnormalities. The study results support the strong association of chromosome alterations and cardiac malformation, especially in AVSD and VSD, for which a chromosome investigation is indicated. In fetuses with an isolated conotruncal cardiopathy, fluorescence in situ hybridization (FISH) to investigate a 22q11.2 deletion is not indicated.

Height and weight gains in a nutrition rehabilitation day-care service

Objective: To evaluate nutritional recovery patterns in 106 undernourished children assisted by the Center of Nutritional Recovery and Education (CREN, in Portuguese) between January 1995 and December 1999. Design: CREN assists undernourished children aged 0 to 72 months living in the southern regions of Sao Paulo, in an outpatient setting. Nutritional status was assessed by Z-scores of weight-for-age, height-for-age and weight-for-height. Nutritional recovery evaluation considered Z-score gains in weight-for-age and height-for-age, grouping into four categories (Z-score increment of 0.50 between groups). Children with birth weight less than 2500 g were classified as low birth weight (LBW), while those born at term and with LBW were classified as small for gestational age. Setting: CREN (Center of Nutritional Recovery and Education in Portuguese), Sao Paulo, Brazil. Subjects: One hundred and six children from CREN. Results: Among the 106 evaluated children, ninety-eight (92.5%)recovered their weight or height and seventy-two (67.9%) recovered both. Nearly half of studied children presented a nutritional recovery (increase in Z-score) of more than 0.50 in height-for-age (46.2%) and about 40% in weight-for-age (38.7%). Multivariate analysis showed that treatment duration and initial weight-for-age contributed to weight-for-age Z-score increment, explaining 25% of the variation; and treatment duration, initial height-for-age and weight-for-age Z-score increment contributed to height-for-age Z-score increment, explaining 62% of the variation. Conclusions: Our findings show that nutritional recovery among children who attended CREN was influenced primarily by the degree of nutritional deficit at admission. It has also been shown that biological variables are more important than socio-economic status in determining the rate of nutritional recovery.

Using a combination of MLPA kits to detect chromosomal imbalances in patients with multiple congenital anomalies and mental retardation is a valuable choice for developing countries

Conventional karyotyping detects anomalies in 3-15% of patients with multiple congenital anomalies and mental retardation (MCA/MR). Whole-genome array screening (WGAS) has been consistently suggested as the first choice diagnostic test for this group of patients, but it is very costly for large-scale use in developing countries. We evaluated the use of a combination of Multiplex Ligation-dependent Probe Amplification (MLPA) kits to increase the detection rate of chromosomal abnormalities in MCA/MR patients. We screened 261 MCA/MR patients with two subtelomeric and one microdeletion kits. This would theoretically detect up to 70% of all submicroscopic abnormalities. Additionally we scored the de Vries score for 209 patients in an effort to find a suitable cut-off for MLPA screening. Our results reveal that chromosomal abnormalities were present in 87 (33.3%) patients, but only 57 (21.8%) were considered causative. Karyotyping detected 15 abnormalities (6.9%), while MLPA identified 54 (20.7%). Our combined MLPA screening raised the total detection number of pathogenic imbalances more than three times when compared to conventional karyotyping. We also show that using the de Vries score as a cutoff for this screening would only be suitable under financial restrictions. A decision analytic model was constructed with three possible strategies: karyotype, karyotype + MLPA and karyotype + WGAS. Karyotype + MLPA strategy detected anomalies in 19.8% of cases which account for 76.45% of the expected yield for karyotype + WGAS. Incremental Cost Effectiveness Ratio (ICER) of MLPA is three times lower than that of WGAS, which means that, for the same costs, we have three additional diagnoses with MLPA but only one with WGAS. We list all causative alterations found, including rare findings, such as reciprocal duplications of regions deleted in Sotos and Williams-Beuren syndromes. We also describe imbalances that were considered polymorphisms or rare variants, such as the new SNP that confounded the analysis of the 22q13.3 deletion syndrome. (C) 2011 Elsevier Masson SAS. All rights reserved.

High frequency of submicroscopic chromosomal imbalances in patients with syndromic craniosynostosis detected by a combined approach of microsatellite segregation analysis, multiplex ligation-dependent probe amplification and array-based comparative genome hybridisation

We present the first comprehensive study, to our knowledge, on genomic chromosomal analysis in syndromic craniosynostosis. In total, 45 patients with craniosynostotic disorders were screened with a variety of methods including conventional karyotype, microsatellite segregation analysis, subtelomeric multiplex ligation-dependent probe amplification) and whole-genome array-based comparative genome hybridisation. Causative abnormalities were present in 42.2% (19/45) of the samples, and 27.8% (10/36) of the patients with normal conventional karyotype carried submicroscopic imbalances. Our results include a wide variety of imbalances and point to novel chromosomal regions associated with craniosynostosis. The high incidence of pure duplications or trisomies suggests that these are important mechanisms in craniosynostosis, particularly in cases involving the metopic suture.

Polyploidy in atypical grade II choroid plexus papilloma of the posterior fossa

Cytogenetic studies of choroid plexus tumors, particularly for atypical choroid plexus papillomas, have been rarely described. In the present report, the cytogenetic investigation of an atypical choroid plexus papilloma occurring at the posterior fossa of a 16-year-old male is described. Comparative genome hybridization analysis demonstrated gains of genetic material from almost all chromosomes. Chromosome losses involved 19p, regional losses at chromosome X and loss of chromosome Y. The presence of polyploid cells was confirmed by fluorescence in situ hybridization analysis with probes directed to centromeric regions. Furthermore, the microscopic analysis of cultures showed nuclear buds, nucleoplasmic bridges, and micronuclei in 23% of tumor cells suggesting the presence of complex chromosomal abnormalities. Previous cytogenetic studies on choroid plexus papillomas showed either normal, hypodiploid or hyperdiploid karyotypes. To the best of our knowledge, this is the first report of polyploidy in choroid plexus papilloma of intermediate malignancy grade. Although the mechanisms beneath such genome duplication remain to be elucidated, the observed abnormal nuclear shapes indicate constant restructuring of the tumor`s genome and deserves further investigation.

A study of adrenocortical tumors in children and adolescents by a comparative genomic hybridization technique

Adrenocortical tumors (ACT) are rare neoplasms of the adrenal glands accounting for 0.2% of all pediatric cancers. However, the incidence of ACT in South Brazilian children is 10 to 15 times greater than the worldwide incidence. Comparative genomic hybridization studies have revealed the presence of a high degree of chromosomal instability in ACT. We evaluated 16 ACT, 8 of them carcinomas and 8 adenomas. The presence of changes in DNA copy numbers was determined by comparative genomic hybridization, and the findings were validated by real-time polymerase chain reaction on the basis of IGF-II gene expression. The adenomas showed a mean of 19.7 imbalances per case, with the most frequent gain and loss being 4p15.1-p15.3 and 20p11.2-p13.2, respectively. The carcinomas presented with a mean of 35.5 imbalances per case, with the more frequent gain being 2q14.1-q24.3 and the more frequent losses being 3q21-q26.2, 20q12-qter, and 22q11.2-q13.3. The most frequent imbalances in both adenomas and carcinomas were gains of 1p21-p31.2, 2p12-p21 and loss of 20p11.2-p12. The expression of IGF-II mRNA (11p15.5) was higher in samples that presented with a gain of this region. It has been established that great genomic instability exists in pediatric ACT.