Inert benzothiazole functionalised ruthenium(II) complexes; potential DNA hairpin binding agents

The two enantiomers of [Ru(bpy)2(bbtb)]2+ {bpy = 2,2'-bipyridine; bbtb = 4,4'-bis(benzothiazol-2-yl)-2,2'-bipyridine} have been isolated and fully characterised. Both enantiomers have been shown to have a strong association with calf thymus DNA by UV/visible absorption, emission and CD spectroscopy, with the lambda enantiomer having the greater affinity. The binding of both enantiomeric forms of [Ru(bpy)2(Me2bpy)]2+ and [Ru(bpy)2(bbtb)]2+ {Me2bpy = 4,4'-dimethyl-2,2'-bipyridine} to a range of oligonucleotides, including an octadecanucleotide and an icosanucleotide which contain hairpin-sequences, have been studied using a fluorescent intercalator displacement (FID) assay. The complex [Ru(bpy)2(bbtb)]2+ exhibited an interesting association to hairpin oligonucleotides, again with the lambda enantiomer binding more strongly. A 1H NMR spectroscopic study of the binding of both enantiomers of [Ru(bpy)2(bbtb)]2+ to the icosanucleotide d(CACTGGTCTCTCTACCAGTG) was conducted. This sequence contains a seven-base-pair duplex stem and a six-base hairpin-loop. The investigation gave an indication of the relative binding of the complexes between the two different regions (duplex and secondary structure) of the oligonucleotide. The results suggest that both enantiomers bind at the hairpin, with the ruthenium centre located at the stem-loop interface. NOE studies indicate that one of the two benzothiazole substituents of the bbtb ligand projects into the loop-region. A simple model of the metal complex/oligonucleotide adduct was obtained by means of molecular modelling simulations. The results from this study suggest that benzothiazole complexes derived from inert polypyridine ruthenium(II) complexes could lead to the development of new fluorescent DNA hairpin binding agents.

Resonance Raman and lifetime studies on regioselectively deuteriated ruthenium (II) polypyridyl complexes

Two series of ruthenium(II) polypyridyl complexes [Ru(bipy)2(phpytr)]+ and [Ru(bipy)2(phpztr)]+ (where Hphpytr = 2-(5-phenyl-1H-[1,2,4]triazol-3-yl)-pyridine and Hphpztr = 2-(5-phenyl-1H-[1,2,4]triazol-3-yl)-pyrazine) are examined by electrochemistry, UV/Vis, emission, resonance Raman, transient resonance Raman and transient absorption spectroscopy, in order to obtain a more comprehensive understanding of their excited state electronic properties. The interpretation of the results obtained is facilitated by the availability of several isotopologues of each of the complexes examined. For the pyridine-1,2,4-triazolato based complex the lowest emissive excited state is exclusively bipy based, however, for the pyrazine based complexes excited state localisation on particular ligands shows considerable solvent and pH dependency.

Benzothiazole bipyridine complexes of ruthenium(II) with cytotoxic activity

A series of benzothiazole-substituted trisbipyridine ruthenium(II) analogues {[Ru(bpy)(2)(4,5'-bbtb)](2+), [Ru(bpy)(2)(5,5'-bbtb)](2+) and [Ru(bpy)(2)(5-mbtb)](2+) [bpy is 2,2'-bipyridine, bbtb is bis(benzothiazol-2-yl)-2,2'-bipyridine, 5-mbtb is 5-(benzothiazol-2-yl),5'-methyl-2,2'-bipyridine]} have been prepared and compared with the complex [Ru(bpy)(2)(4,4'-bbtb)](2+) reported previously. From the UV-vis spectral studies, substitution at the 5-position of the bpy causes the ligand-centred transitions to occur at considerably lower energy than for those with the functionality at the 4-position, while at the same time causing the emission to be effectively quenched. However, substitution at the 4-position causes the metal-to-ligand charge transfer to occur at lower energies. Fluorescent intercalator displacement studies indicate that the doubly substituted complexes displace ethidium bromide from a range of oligonucleotides, with the greater preference shown for bulge and hairpin sequences by the Lambda enantiomer. Since the complexes only show small variation in the UV-vis spectra on the introduction of calf thymus DNA and a small increase in fluorescence they do not appear to be intercalators, but appear to associate within one of the grooves. All of the reported bisbenzothiazole complexes show reasonable cytotoxicity against a range of human cancer cell lines.

The isolation and secondary functionalisation of the mer- and fac-isomers of tris(5-hydroxymethyl-2,2 '-bipyridine) complexes of ruthenium(II)

Tris-chelate 5-hydroxymethyl-2,2 '-bipyridine complexes of ruthenium (II) and the structurally related benzo- and naphthoesters have been isolated. The mer-isomer of the alcohol functionalised complex has been isolated by selective precipitation from methylene chloride and was subsequently functionalised to the benzoester with retention of the geometrical isomerism. The fac- and merisomeric forms of the ester complexes were separated using preparative plate silica chromatography and characterised by H-1 NMR spectroscopy. X-ray structural analysis of the fac-isomer of both the ester complexes confirmed the product assignment. The photophysical properties of the three isomers were investigated, indicating very similar absorption spectra to [Ru(biPY)(3)](2+). The emission wavelength was comparable in each case, with the aromatic ester complexes giving a much longer lifetime and higher quantum yields. (c) 2004 Elsevier B.V. All rights reserved.

Sequential C-H and C-Ru bond formation and cleavage during the thermally induced rearrangement of aryl ruthenium(II) complexes with [C6H3(CH2NMe2)(2)-2,6](-) as a bidentate eta(2)-C,N coordinated ligand. The crystal structures of the isomeric pairs [RuCl{eta(6)-C10H14}{eta(2)-C,N-C6H3(CH2NMe2)(2)-2,n}] (n = 4 or 6) and [Ru(eta(5)-C5H5){(eta(2)-C,N-C6H3(CH2NMe2)(2)-2,n} (PPH3)] (n = 4 or 6)

New air-stable ruthenium(II) complexes that contain the aryldiamine ligand [C6H3(CH2-NMe2)(2)-2,6](-) (NCN) are described. These complexes are [RuCl{eta(2)-C,N-C6H3(CH2NMe2)(2)-2,6}(eta(6)-C10H14)] (2; C10H14 = p-cymene = C6H4Me-Pr-i-4), [Ru{eta(2)-C,N-C6H3(CH2NMe2)(2)-2,6}(eta(5)-C5H5)(PPh3)] (5), and their isomeric forms [RuCl{eta(2)-C,N-C6H3(CH2NMe2)(2)-2,4}(eta(6)-C10H14)] (3) and [Ru{eta(2)-C,N-C6H3(CH2NMe2)(2)-2,4}(eta(5)-C5H5)(PPh3)] (6), respectively. Complex 2 has been prepared from the reaction of [Li(NCN)](2) with [RuCl2(eta(6)-C10H14)](2), whereas complex 5 has been prepared by the treatment of [RuCl{eta(3)-N,C,N-C6H3(CH2NMe2)(2)-2,6}(PPh3)] (4) with [Na(C5H5)](n). Both 2 and 5 are formally 18-electron ruthenium(II) complexes in which the monoanionic potentially tridentate coordinating ligand NCN is eta(2)-C,N-bonded, In solution (halocarbon solvent at room temperature or in aromatic solvents at elevated temperature), the intramolecular rearrangements of 2 and 5 afford complexes 3 and 6, respectively. This is a result of a shift of the metal-C-aryl bond from position-1 to position-3 on the aromatic ring of the NCN ligand. The mechanism of the isomerization is proposed to involve a sequence of intramolecular oxidative addition and reductive elimination reactions of both aromatic and aliphatic C-H bonds. This is based on results from deuterium labeling, spectroscopic studies, and some kinetic experiments. The mechanism is proposed to contain fully reversible steps in the case of 5, but a nonreversible step involving oxidative addition of a methyl NCH2-H bond in the case of 2. The solid-state structures of complexes 2, 3, 5, and 6 have been determined by single-crystal X-ray diffraction. A new dinuclear 1,4-phenylene-bridged bisruthenium(II) complex, [1,4-{RuCl(eta(6)-C10H14)}(2){C-6(CH2NMe2)(4)-2,3,5,6-C,N,C',N'}] (9) has also been prepared from the dianionic ligand [C-6(CH2NMe2)(4)-2,3,5,6](2-) (C2N4). The C2N4 ligand is in an eta(2)-C,N-eta(2)-C',N'-bis(bidentate) bonding mode. Compound 9 does not isomerize in solution (halocarbon solvent), presumably because of the absence of an accessible C-aryl-H bond. Complex 9 could not be isolated in an analytically pure form, probably because of its high sensitivity to air and very low solubility, which precludes recrystallization.

Versatile N,C,N coordination behavior of a monoanionic aryldiamine ligand in ruthenium(II) complexes: Syntheses and crystal structures of [Ru-II(C6H3(CH(2)NMe(2))(2)-2,6)X(L)] (L equals norbornadiene, X=Cl, SO3CF3; L=PPh(3), X=I) and [Ru-II{C6H3(CH(2)NMe(2))(2)-2,6}(2,2':6:2''-terpyridine)]Cl

The monoanionic ligand [C6H3(CH(2)NMe(2))(2)-2,6](-), a potentially terdentate N,C,N bonding system, has been employed to synthesize a series of new ruthenium(II) complexes [Ru{C6H3(CH(2)NMe(2))(2)-2,6}X(L)] (L = PPh(3) X = Cl (2a), I (2b); L = norbornadiene (nbd), X = Cl (4), eta(1)-OSO2CF3 (5)) and [Ru{C6H3(CH(2)NMe(2))(2)-2,6}(2,2':6',2 ''-terpyridine)]Cl (3). X-ray crystal structures of 2b and 3-5 have been determined, in which the N,C,N coordination geometry with respect to the metal center is found to differ considerably. In each complex the aryldiamine ligand is terdentate, eta(3)-N,C,N-bonded as a six electron donor system. However, depending on the other ligands in the Ru(II) coordination sphere, this ligand demonstrates considerable flexibility in adopting coordination geometries which range from meridional in 3 through pseudomeridional in 2b to pseudofacial in 4 and 5. In the structures of 4 and 5 significant distortions of the aryl ring, involving bending of the six-membered ring into a boatlike conformation, are found. The different combinations of the N,C,N ligand with sets of other ligands lead to a range of metal geometries, i.e. square pyramidal in 2b, octahedral in 3, and bicapped tetrahedral in 4 and 5.

Alkynyl-Bridged Ruthenium(II) 4 '-Diferroceny1-2,2 ':6 ',2 ''-terpyridine Electron Transfer Complexes: Synthesis, Structures, and Electrochemical and Spectroscopic Studiese

The novel ligand 4'-diferrocenylallcyne-2,2':6',2 ''-terpyridine (7; Fc-C C-Fc-tpy; tpy = terpyridyl; Fc = ferrocenyl) and its Ru2+ complexes 8-10 have been synthesized and characterized by single-crystal X-ray diffraction, cyclic voltammetry, and UV-vis and luminescence spectroscopy. Electrochemical data and UV absorption and emission spectra indicate that the insertion of an ethynyl group causes delocalization of electrons in the extended pi* orbitals. Cyclic voltammetric measurements of 7 show two successive reversible one-electron-oxidation processes with half-wave potentials of 0.53 and 0.78 V. The small variations of the E-1/2 values for the Fe2+/Fe3+ redox couples after the coordination of the Ru2+ ion suggest a weak interaction between the Ru2+ and Fe2+ centers. After insertion of an ethynyl group, UV-vis absorption spectra show a red shift of the absorption peak of the (1)[(d(pi)(Fe))(6)]->(1)[(d(pi)(Fe))(5)(pi*(Ru)(tpy))(1)] MMLCT of the Ru2+ complexes. The Ru2+ complex 8 exhibits the strongest luminescence intensity (lambda(em)(max) 712 nm, Phi(em) = 2.63 x 10(-4), tau = 323 ns) relative to analogous ferrocene-based terpyridine Ru(II) complexes in H2O/CH3CN (4/1 v/v) solution.

Ruthenium(II)-trithiacyclononane complexes as potential antitumourals

Os únicos complexos metálicos presentemente utilizados em quimioterapia compreendem exclusivamente compostos de platina, com as desvantagens de apresentarem um leque de acção restrito e de provocarem sérios efeitos secundários. Na constante procura por novos fármacos antineoplásicos metálicos, os complexos de ruténio têm sido apresentados como uma alternativa adequada e existem já dois complexos de Ru(III) em ensaios clínicos. Estes são descritos como pró-fármacos, postulando-se que o seu mecanismo de acção envolva redução in vivo para originar complexos de Ru(II) activos. Assim, o actual desenvolvimento de fármacos antitumorais baseados em ruténio passará por criar novos complexos de Ru(II). O trabalho aqui descrito enquadra-se neste objectivo, tendo sido sintetizados complexos de ruténio(II)-tritiaciclononano com ligandos biologicamente activos, e avaliada a sua actividade antitumoral in vitro. Os ligandos utilizados compreendem um hidroxifenilpirazole, aminoácidos e derivados, flavonóides e quinonas. No primeiro capítulo do trabalho são apresentados os actuais desafios no desenvolvimento de complexos metálicos para quimioterapia e é ilustrada a importância dos complexos de Ru(II) aqui descritos no panorama actual de investigação. No capítulo dois, é apresentada uma descrição pormenorizada dos procedimentos experimentais, materiais e equipamentos utilizados na síntese, caracterização e ensaios biológicos. O capítulo três é dividido em duas sub-secções, a primeira analisando os resultados das sínteses e a caracterização estrutural dos complexos, e a segunda apresentando os resultados da sua actividade antiproliferativa. Foram obtidos onze novos complexos de ruténio(II)-tritiaciclononano, com rendimentos razoáveis. São apresentadas propostas das suas estruturas moleculares, sendo que estas mostram uma variedade interessante de modos de coordenação de acordo com os diferentes ligandos, ou seja, N, N,O, O,O e O. A actividade antiproliferativa dos complexos e dos respectivos ligandos foi avaliada em quatro linhas celulares tumorais, representativas de três tipos de cancro: osso (MG-63), próstata (PC-3) e mama (MCF-7 e MDA-MB-231). Quatro dos novos complexos demonstraram uma actividade antiproliferativa promissora, ou seja, aqueles que apresentam um hidroxifenilpirazole, a 3,7-dihidroxiflavona, a plumbagina ou a juglona na sua esfera de coordenação. Entre estes resultados, destacam-se os valores de IC50 para a linha celular MDA-MB-231 por se apresentarem inferiores ao apresentado pelo complexo de Ru(II)-tritiaciclononano mais activo descrito na literatura.

Fast atom bombardment mass spectrometry studies of ruthenium (II) polypyridy coordination complexes and of group V Triptycenes and related complexes

In order to investigate the use of Fast Atom Bombardment Mass Spectrometry (FAB-MS) as a tool for structural characterization, two groups of complexes are analyzed. The first group is a set of ruthenium(II) coordination complexes containing bidentate polypyridyl ligands. The positive and negative ion FAB-MS spectra are found to be sufficient to allow for an almost complete characterization of the central metal atom, the ligands and the counter anions contained in the intact complex. An unusual observation of mUltiply charged ions in the positive ion FAB-MS spectra (i.e. [RUL 3 ]2+) is explained to be as a result of the oxidative quenching of the excited state of the doubly charged ion by the matrix, 3-nitrobenzyl alcohol. An analysis of a mixture shows that the technique is a good one for identifying components therein. A group of triptycene and related complexes containing Group V elements is also analyzed by FAB-MS and the results. in terms of relative abundances of fragment ions, are found to be consistent with known metal-carbon bond strengths.

Synthesis, spectroscopic and redox properties of some ruthenium(II) thiosemicarbazone complexes: structural description of four of these complexes

Sixteen neutral mixed ligand thiosemicarbazone complexes of ruthenium having general formula [Ru(PPh3)(2)L-2], where LH = 1-(arylidine)4-aryl thiosemicarbazones, have been synthesized and characterized. All complexes are diamagnetic and hence ruthenium is in the +2 oxidation state (low-spin d(6), S = 0). The complexes show several intense peaks in the visible region due to allowed metal to ligand charge transfer transitions. The structures of four of the complexes have been determined by single-crystal X-ray diffraction and they show that thiosemicarbazone ligands coordinate to the ruthenium center through the hydrazinic nitrogen and sulfur forming four-membered chelate rings with ruthenium in N2S2P2 coordination environment. In dichloromethane solution, the complexes show two quasi-reversible oxidative responses corresponding to loss of electron from HOMO and HOMO - 1. The E-0 values of the above two oxidations shows good linear relationship with Hammett substituents constant (sigma) as well as with the HOMO energy of the molecules calculated by the EHMO method. A DFT calculation on one representative complex suggests that there is appreciable contribution of the sulfur p-orbitals to the HOMO and HOMO - 1. Thus, assignment of the oxidation state of the metal in such complexes must be made with caution. (c) 2005 Elsevier B.V. All rights reserved.

Synthesis, X-ray crystal structure and catalytic activity of the manganese(II) complex [Mn(bdoa)(H2O)3](bdoaH2 =benzene-1,2-dioxyacetic acid)

Benzene-1,2-dioxyacetic acid (bdoaH2) reacts with Mn(CH3CO2)2·4H2O in an ethanol-water mixture to give the manganese(II) complex [Mn(bdoa)(H2O)3]. The X-ray crystal structure of the complex shows the metal to be pseudo seven-coordinate. The quadridentate bdoa2− dicar☐ylate ligand forms an essentially planar girdle around the metal, being strongly bondedtransoid by a car☐ylate oxygen atom from each of the two car☐ylate moieties (mean MnO 2.199A˚) and also weakly chelated by the two internal ether oxygen atoms (mean MnO 2.413A˚). The coordination sphere about the manganese is completed by three water molecules (mean MnO 2.146A˚) lying in a meridional plane orthogonal to that of the bdoa2− ligand. Magnetic, conductivity and voltammetry data for the complex are given, and its use as a catalyst for the disproportionisation of H2O2 is described.

Ruthenium(II) complexes containing N(4)-tolyl-2-acetylpyridine thiosemicarbazones and phosphine ligands: NMR and electrochemical studies of cis-trans isomerization

[Ru(HL)(PPh3)(2)Cl]Cl complexes have been obtained in which HL = N(4)-ortho (complex 1), N(4)-meta (complex 2) and N(4) pctratolyl 2-acetylpyridine thiosemicarbazone (complex 3). NMR and electrochemical studies indicate that both cis and trans isomers exist in solution, and that the cis isomers are converted into the trans isomers with time. Crystal structure determination of (1) reveals that the traps isomer is formed in the solid state. (c) 2007 Elsevier B.V. All rights reserved.

Coordination of nitro-thiosemicarbazones to ruthenium(II) as a strategy for anti-trypanosomal activity improvement

Complexes [RuCl(H4NO(2)Fo4M)(bipy)(dppb)]PF(6) (1), [RuCl(H4NO(2)Fo4M)(Mebipy)(dppb)]PF(6) (2), [RuCl(H4NO(2)Fo4M)(phen)(dppb)]PF(6) (3), [RuCl(H4NO(2)Ac4M)(bipy)(dppb)]PF(6) (4), [RuCl(H4NO(2)Ac4M)(Mebipy)(dppb)]PF(6) (5) and [RuCl(H4NO(2)Ac4M)(phen)(dppb)]PF(6) (6) with N(4)-methyl-4-nitrobenzalde hyde thiosemicarbazone (H4NO(2)Fo4M) and N(4)-methyl-4-nitroacetophenone thiosemicarbazone (H4NO(2) Ac4M) were obtained from [RuCl(2)(bipy)(dppb)], [RuCl(2)(Mebipy)(dppb)], and [RuCl(2)(phen)(dppb)], (dppb = 1,4-bis(diphenylphospine)butane; bipy = 2,2`-bipyridine: Mebipy = 4,4`-dimethyl-2,2`-bipyridine: phen = 1,10-phenanthroline). In all cases the thiosemicarbazone is attached to the metal center through the sulfur atom. Complexes (1-6), together with the corresponding ligands and the Ru precursors were evaluated for their ability to in vitro suppress the growth of Trypanosoma cruzi. All complexes were more active than their corresponding ligands and precursors. Complexes (1-3) and (5) revealed to be the most active among all studied compounds with ID(50) = 0.6-0.8 mu M. In all cases the association of the thiosemicarbazone with ruthenium, dppb and bipyridine or phenanthroline in one same complex proved to be an excellent strategy for activity improvement. (C) 2010 Elsevier Masson SAS. All rights reserved.

Evaluation of tris(4,7-diphenyl-1,10-phenanthrolinedisulfonate)ruthenium(II) as a chemiluminescence reagent

Previous studies have suggested that tris(4,7-diphenyl-1,10-phenanthrolinedisulfonate)ruthenium(II) (Ru(BPS)₃⁴⁻) has great potential as a chemiluminescence reagent in acidic aqueous solution. We have evaluated four different samples of this reagent (two commercially available and two synthesised in our laboratory) in comparison with tris(2,2′-bipyridine)ruthenium(II) (Ru(bipy)₃²⁺) and tris(1,10-phenanthroline)ruthenium(II) (Ru(phen)₃²⁺), using a range of structurally diverse analytes. In general, Ru(BPS)₃⁴⁻ produced more intense chemiluminescence, but the oxidised Ru(BPS)₃³⁻ species is less stable in aqueous solution than Ru(bipy)₃³⁺ and produced a greater blank signal than Ru(bipy)₃³⁺ or Ru(phen)₃³⁺, which had a detrimental effect on sensitivity. Although the complex is often depicted with the sulfonate groups of the BPS ligand in the para position on the phenyl rings, NMR characterisation revealed that the commercially available BPS material used in this study was predominantly the meta isomer.

Simultaneous control of spectroscopic and electrochemical properties in functionalised electrochemiluminescent tris(2,2'-bipyridine)ruthenium(II) complexes

Using a combination of electrochemical, spectroscopic and computational techniques, we have explored the fundamental properties of a series of ruthenium diimine complexes designed for coupling with other molecules or surfaces for electrochemiluminescence (ECL) sensing applications. With appropriate choice of ligand functionality, it is possible to manipulate emission wavelengths while keeping the redox ability of the complex relatively constant. DFT calculations show that in the case of electron withdrawing substituents such as ester or amide, the excited state is located on the substituted bipyridine ligand whereas in the case of alkyl functionality it is localised on a bipyridine. The factors that dictate annihilation ECL efficiency are interrelated. For example, the same factors that determine ΔG for the annihilation reaction (i.e. the relative energies of the HOMO and LUMO) have a corresponding effect on the energy of the excited state product. As a result, most of the complexes populate the excited state with an efficiency (Φex) of close to 80% despite the relatively wide range of emission maxima. The quantum yield of emission (Φp) and the possibility of competing side reactions are found to be the main determinants of ECL intensity.