997 resultados para Amylase activity
Application of simulated annealing in simulation and optimization of drying process of Zea mays malt
Resumo:
Kinetic simulation and drying process optimization of corn malt by Simulated Annealing (SA) for estimation of temperature and time parameters in order to preserve maximum amylase activity in the obtained product are presented here. Germinated corn seeds were dried at 54-76 °C in a convective dryer, with occasional measurement of moisture content and enzymatic activity. The experimental data obtained were submitted to modeling. Simulation and optimization of the drying process were made by using the SA method, a randomized improvement algorithm, analogous to the simulated annealing process. Results showed that seeds were best dried between 3h and 5h. Among the models used in this work, the kinetic model of water diffusion into corn seeds showed the best fitting. Drying temperature and time showed a square influence on the enzymatic activity. Optimization through SA showed the best condition at 54 ºC and between 5.6h and 6.4h of drying. Values of specific activity in the corn malt were found between 5.26±0.06 SKB/mg and 15.69±0,10% of remaining moisture.
Resumo:
The presence of carbohydrate-binding proteins, namely lectins, ß-galactosidases and amylases, was determined in aqueous extracts of plants collected in Uruguay. Twenty-six extracts were prepared from 15 Uruguayan plants belonging to 12 Phanerogam families. Among them, 18 extracts caused hemagglutination (HAG) that was inhibited by mono- and disaccharides in 13 cases, indicating the presence of lectins. The other 8 extracts did not cause any HAG with the four systems used to detect HAG activity (rabbit and mouse red cells, trypsin-treated rabbit and mouse red cells). For the extracts prepared from Solanum commersonii, HAG activity and HAG inhibition were similar for those prepared from tubers, leaves and fruits, with the chitocompounds being responsible for all the inhibitions. Purification of the S. commersonii tuber lectin was carried out by affinity chromatography on asialofetuin-Sepharose, and SDS-PAGE under reducing conditions gave a single band of Mr of approximately 80 kDa. The monomer N-acetylglucosamine did not inhibit HAG induced by the purified lectin, but chitobiose inhibited HAG at 24 mM and chitotriose inhibited it at 1 mM. ß-Galactosidase activity was detected in leaves and stems of Cayaponia martiana, and in seeds from Datura ferox. Only traces of amylase activity were detected in some of the extracts analyzed. The present screening increases knowledge about the occurrence of carbohydrate-binding proteins present in regional plants.
Resumo:
Transtracheal puncture has long been known as a safe, low-cost procedure. However, with the advent of bronchoscopy, it has largely been forgotten. Two researchers have suggested the use of α-amylase activity to diagnose salivary aspiration, but the normal values of this enzyme in tracheobronchial secretions are unknown. We aimed to define the normal values of α-amylase activity in tracheobronchial secretions and verify the rate of major complications of transtracheal puncture. From October 2009 to June 2011, we prospectively evaluated 118 patients without clinical or radiological signs of salivary aspiration who underwent transtracheal puncture before bronchoscopy. The patients were sedated with a solution of lidocaine and diazepam until they reached a Ramsay sedation score of 2 or 3. We then cleaned the cervical region and anesthetized the superficial planes with lidocaine. Next, we injected 10 mL of 2% lidocaine into the tracheobronchial tree. Finally, we injected 10 mL of normal saline into the tracheobronchial tree and immediately aspirated the saline with maximum vacuum pressure to collect samples for measurement of the α-amylase level. The α-amylase level mean ± SE, median, and range were 1914 ± 240, 1056, and 24-10,000 IU/L, respectively. No major complications (peripheral desaturation, subcutaneous emphysema, cardiac arrhythmia, or hemoptysis) occurred among 118 patients who underwent this procedure. Transtracheal aspiration is a safe, low-cost procedure. We herein define for the first time the normal α-amylase levels in the tracheobronchial secretions of humans.
Resumo:
Gliricidia sepium is a drought-tolerant species, easily multiplied by seeds, and has been exploited by farmers as a source of forage in the semi-arid region of northeast Brazil. The objective of the present study was to evaluate the effect of seed storage on the mobilization of reserves during imbibition of "Gliricidia" seeds. Freshly-harvested seeds were packed in kraft paper bags and stored for three and six months in the laboratory under ambient conditions (25 º C ± 3 T and 75% ± 3 RH). Cotyledons were isolated from imbibed seeds and macerated for the extraction and quantification of total soluble sugars, reducing sugars, sucrose and starch, as well as of proteins, amino acids and for amylase activity. Storage under these conditions resulted in an increase in seed water content although germination remained at relatively high levels (86%). Seed macromolecule levels showed significant variation with the storage period and imbibition and these variations were associated with a loss in seed viability due to inadequate storage conditions.
Resumo:
This thesis Entitled Studies on amylolytic bacteria in cochin backwaters.This thesis presents a detailed account of the disribution of amylolytic bacteria in water. sediment. fishes ( Etroplus suratensis and Liza parsia) • prawns ( Penaeus indicus and Metapenaeus dobsoni) and clams ( Sunetta scripta and Meretrix casta) from Cochin backwaters. genera-wise distribution of amylolytic bacteria, ability of selected strains to grow and produce amylase at various physico-chemical conditions. Regulation of amylase synthesis anrt characters of amylases producer by these halophilic bacteria.Amylolytic bacteria are distributed widely in water. sediment. fishes. prawns and clams of Cochin back waters. 53% of the total isolates tested were capable of producing amylase. Maximum number of arnylolytic bacteria were present in Metapenaeus dobsoni. In general, the gut region of aquatic animals harboured more amylolytic bacteria than the gill or surface. These bacteria may help in the digestion of starch present in their food.Presence of ions in the medium was found to be essential for growth and amylase production. It was found that this ionic requirement is not highly specific. Sorlium chloride could be replaced by potassium chloride. or magnesium chloride to some extent I without affecting growth and amylase production. The important function of these ions may be to maintain the osmotic balance between the cells and their environment.All the isolates showed the ability to grow and produce amylase using raw-starches from cassava. plantain and potato .This property suggests their role in the rdegradation of native starches in the environment
Resumo:
The major digestive enzyme activities and digestive indices were compared between Etroplus suratensis and Oreochromis mossambicus. Pepsin - like acid proteases that acts on low pH has been identified all along the digestive tract of both the fishes. Comparatively low alpha amylase activity is shown by the E. suratensis and the enzyme is distributed almost equally throughout the intestinal segments in both the species. Very low alkaline protease activity is found in the stomach of both the fishes and in O. mossambicus, the enzyme activity diminishes extensively towards the posterior portion of the intestine whereas in E. suratensis the activity increases towards the posterior part. The present study showed that lipase is one of the prominent digestive enzymes in O. mossambicus with a remarkable specific activity throughout the digestive tract than that of E. suratensis .It has been noted that O. mossambicus has a higher values for digestive somatic index, hepato somatic index, intestinal coefficient and gut Vs standard length ratio than that of E. suratensis indicating its higher digestive and metabolic capabilities. The early maturity and fast growth of O. mossambicus can be explained by their enhanced digestive indices. The compa ratively low activities of acid protease, amylase, lipase and total alkaline protease of E. suratensis revealed poor digestive capacity than that of O. mossambicus
Resumo:
A series of experiments was completed to investigate the impact of addition of enzymes at ensiling on in vitro rumen degradation of maize silage. Two commercial products, Depot 40 (D, Biocatalysts Ltd., Pontypridd, UK) and Liquicell 2500 (L, Specialty Enzymes and Biochemicals, Fresno, CA, USA), were used. In experiment 1, the pH optima over a pH range 4.0-6.8 and the stability of D and L under changing pH (4.0, 5.6, 6.8) and temperature (15 and 39 degreesC) conditions were determined. In experiment 2, D and L were applied at three levels to whole crop maize at ensiling, using triplicate 0.5 kg capacity laboratory minisilos. A completely randomized design with a factorial arrangement of treatments was used. One set of treatments was stored at room temperature, whereas another set was stored at 40 degreesC during the first 3 weeks of fermentation, and then stored at room temperature. Silages were opened after 120 days. Results from experiment I indicated that the xylanase activity of both products showed an optimal pH of about 5.6, but the response differed according to the enzyme, whereas the endoglucanase activity was inversely related to pH. Both products retained at least 70% of their xylanase activity after 48 h incubation at 15 or 39 degreesC. In experiment 2, enzymes reduced (P < 0.05) silage pH, regardless of storage temperature and enzyme level. Depol 40 reduced (P < 0.05) the starch contents of the silages, due to its high alpha-amylase activity. This effect was more noticeable in the silages stored at room temperature. Addition of L reduced (P < 0.05) neutral detergent fiber (NDF) and acid detergent fiber (ADF) contents. In vitro rumen degradation, assessed using the Reading Pressure Technique (RPT), showed that L increased (P < 0.05) the initial 6 h gas production (GP) and organic matter degradability (OMD), but did not affect (P > 0.05) the final extent of OMD, indicating that this preparation acted on the rumen degradable material. In contrast, silages treated with D had reduced (P < 0.05) rates of gas production and OMD. These enzymes, regardless of ensiling temperature, can be effective in improving the nutritive quality of maize silage when applied at ensiling. However, the biochemical properties of enzymes (i.e., enzymic activities, optimum pH) may have a crucial role in dictating the nature of the responses. (C) 2003 Elsevier B.V. All rights reserved.
Resumo:
Twenty-eight field experiments on sandy-loam soils in the UK (1982-2003) are reviewed by relating the extension of the green area duration of the flag leaf (GLADF) by fungicides to effects on yield and quality of winter wheat. Over all experiments mean grain yield = 8.85t ha(-1) at 85% DM. With regards quality, mean values were: thousand grain weight (TGW) = 44.5 g; specific weight (SWT) = 76.9 kg hl(-1); crude protein concentration (CP (N x 5.7)) = 12.5 % DM; Hagberg falling number (HFN) = 285 s; and sodium dodecyl sulphate (SDS)-sedimentation volume = 69ml. For each day (d) that fungicides increased GLADF there were associated average increases in yield (0.144 1 ha(-1) d(-1), se 0.0049, df = 333), TGW (0.56 gd(-1), se = 0.017) and SWT (0.22 kg hl(-1) d(-1), se 0.011). Some curvature was evident in all these relationships. When GLADF was delayed beyond 700 degrees Cd after anthesis, as was possible in cool wet seasons, responses were curtailed, or less reliable. Despite this apparent terminal sink limitation, fungicide effects on sink size, eg endosperm cell numbers or maximum water mass per grain, were not prerequisites for large effects on grain yield, TGW or SWT. Fungicide effects on CP were variable. Although the average response of CP was negative (-0.029%DM/d; se = 0.00338), this depended on cultivar and disease controlled. Controlling biotrophs such as rusts, (Puccinia spp.) tended to increase CP, whereas controlling a more necrotrophic pathogen (Septoria tritici) usually reducedCP. Irrespective of pathogen controlled, delaying senescence of the flag leaf was associated with increased nitrogen yields in the grain (averaging 2.24 kg N ha-1 d(-1), se = 0.0848) due to both increased N uptake into the above ground crop, and also more efficient remobilisation of N from leaf laminas. When sulphur availability appeared to be adequate, fungicide x cultivar interactions were similar on S as for CP, although N:S ratios tended to decline (i.e. improve for bread making) when S. tritici was controlled. On average, SDS-sedimentation volume declined (-0. 18 ml/d, se = 0.027) with increased GLADF, broadly commensurate with the average effect on CP. Hagberg falling number decreased as fungicide increased GLADF (-2.73 s/d, se = 0.178), indicating an increase in alpha-amylase activity.
Resumo:
Four hull-less barley samples were milled on a Buhler MLU 202 laboratory mill and individual and combined milling fractions were characterized. The best milling performance was obtained when the samples were conditioned to 14.3% moisture. Yields were 37-48% for straight-run flour, 47-56% for shorts, and 5-8% for bran. The beta-glucan contents of the straight-run white flours were 1.6-2.1%, of which approximate to49% was water-extractable. The arabinoxylan contents were 1.2-1.5%, of which approximate to17% was water-extractable. Shorts and bran fractions contained more beta-glucan (4.2-5.8% and 3.0-4.7%, respectively) and arabinoxylan (6.1-7.7% and 8.1-11.8%, respectively) than the white flours. For those fractions, beta-glucan extractability was high (58.5 and 52.3%, respectively), whereas arabinoxylan extractability was very low (approximate to6.5 and 2.0%, respectively). The straight-run white flours had low alpha-amylase, beta-glucanase, and endoxylanase activities. The highest alpha-amylase activity was found in the shorts fractions and the highest beta-glucanase and endoxylanase activities were generally found in the bran fractions. Endoxylanase inhibitor activities were low in the white flours and highest in the shorts fractions. High flavanoid, tocopherol, and tocotrienol contents were found in bran and shorts fractions.
Resumo:
Near isogenic lines varying for alleles for reduced height (Rht) and photoperiod insensitivity (Ppd-D1) in cv. Mercia (2005/6 to 2010/11; rht (tall), Rht-B1b, Rht-D1b, Rht-B1c, Rht8c+Ppd-D1a, Rht-D1c, Rht12) and cvs Maris Huntsman and Maris Widgeon (2007/8 to 2010/11; rht (tall), Rht-B1b, Rht-D1b, Rht-B1c, Rht-B1b+Rht-D1b, Rht-D1b+Rht-B1c) were compared at one field site, but within different systems (‘organic’, O, 2005/6 to 2007/8 v ‘intensive’, I, 2005/6 to 2010/11). Further experiments at the site (2006/7 to 2008/9) compared 64 lines of a doubled haploid (DH) population [Savannah (Rht-D1b) × Renesansa (Rht-8c+Ppd-D1a)]. Gibberellin (GA) insensitive dwarfing alleles (Rht-B1b; Rht-B1c; Rht-D1b; Rht-D1c) could reduce α-amylase activity and/or increase Hagberg falling number (HFN) but effects depended greatly on system, background and season. Only Rht-B1c increased grain dormancy despite producing plants taller than Rht-D1c. The GA-sensitive Rht8c+Ppd-D1a in Mercia was associated with reduced HFN but analysis of the DH population suggested this was more closely linked with Ppd-D1a, rather than Rht8c. The severe GA-sensitive dwarfing allele Rht12 was associated with reduced HFN. Instability in HFN over season tended to increase with degree of dwarfing. There was a negative association between mean grain weight and HFN that was in addition to effects of Rht and Ppd-D1 allele.
Resumo:
The effect of inoculation of Aspergillus flavus, Fusarium verticillioides, and Penicillium sp. in Dystrophic Red Latosol (DRL) and Eutroferric Red Latosol (ERL) soils with or without glucose on the total carbohydrate content and the dehydrogenase and amylase activities was studied. The fungal growth and spore production in culture medium with and without glucose were also evaluated. A completely randomized design with factorial arrangement was used. The addition of glucose in the culture medium increased the growth rate of A. flavus and Penicillium sp. but not of F. verticillioides. The number of spores increased 1.2 for F. verticillioides and 8.2 times for A. flavus in the medium with glucose, but was reduced 3.5 times for Penicillium sp. The total carbohydrates contents reduced significantly according to first and second degree equations. The consumption of total carbohydrates by A. flavus and Penicillium sp. was higher than the control or soil inoculated with F. verticillioides. The addition of glucose to soils benefited the use of carbohydrates, probably due to the stimulation of fungal growth. Dehydrogenase activity increased between 1.5 to 1.8 times (p <0.05) in soils with glucose and inoculated with the fungi (except F. verticillioides), in relation to soil without glucose. Amylase activity increased 1.3 to 1.5 times due to the addition of glucose in the soil. Increased amylase activity was observed in the DRL soil with glucose and inoculated with A. flavus and Penicillium sp. when compared to control.
Resumo:
Durante a germinação das sementes, os carboidratos de reserva são degradados pela atividade de a-amilase. A identificação de mRNA é uma ferramenta fundamental para a definição da cinética de síntese de alfa-amilase. Objetivou-se padronizar a metodologia do RT-PCR para identificar o mRNA do gene de a-amilase em sementes de milho. Após três dias de germinação das cultivares Saracura-BRS 4154 e CATI-AL34, extraiu-se o RNA total pelo método do tiocianato de guanidina-fenol-clorofórmio, com algumas modificações. A partir do RNA total extraído foi obtido cDNA com utilização de random primers. A amplificação por PCR de uma porção do gene da alfa-amilase foi realizada com os primers: sense - CGACATCGACCACCTCAAC; antisense - TTGACCAGCTCCTGCCTGTC; gelatina; DMSO e 1,25 unidades de Taq DNA polimerase por reação e completados com água tratada com DEPC. Os ciclos para a amplificação foram 94ºC durante 4 minutos, seguidos por 34 ciclos de 94ºC durante 1 minuto, 42ºC durante 1 minuto e 72ºC durante 1,5 minutos e, finalmente, 72ºC por 5 minutos. O produto do RT-PCR apresentou uma banda de 249 pares de base (pb) bem definida, para as duas cultivares estudadas, não ocorrendo bandas inespecíficas. A técnica do RT-PCR mostrou ser uma metodologia eficiente para a identificação da expressão de alfa-amilase durante a germinação das sementes e pode ser usado para estudo qualitativo e quantitativo da cinética de síntese dessa enzima em experimentos de germinação.
Resumo:
O uso de reguladores de crescimento na fase de germinação melhora o desempenho das plântulas, acelerando a velocidade de emergência e realçando o potencial das sementes de várias espécies, mesmo sob condições adversas. Este trabalho teve como objetivo avaliar a influência do ácido giberélico na atividade amilolítica e no vigor de sementes armazenadas de milho super doce. O experimento foi conduzido nos Laboratórios de Análise de Sementes do Departamento de Produção Vegetal/FCA e no Laboratório de Bioquímica de Plantas do Departamento de Química e Bioquímica/IB da Universidade Estadual Paulista (UNESP/Botucatu), entre os meses de julho e setembro de 2001, onde foram feitas as avaliações da qualidade fisiológica, através dos testes de germinação, vigor e bioquímicos. Sementes de milho super doce da cultivar DO-04, foram acondicionadas em sacos de papel e armazenadas por oito meses em câmara seca (40% UR). Após este período, foram colocadas para germinar em rolos de papel toalha, embebidos com GA3 nas concentrações zero; 50; 100; 150 e 200mg.L-1. Foram avaliadas a germinação, vigor e atividade amilolítica das sementes. As sementes submetidas à pré-embebição em solução de 50mg.L-1 de ácido giberélico, apresentaram maior germinação e vigor, menor teor de proteínas totais e maior atividade amilolítica.
Resumo:
Algaroba (Prosopis juliflora) is a typical legume from arid and semi arid regions, which is composed by sugar-rich pods and high protein seeds. Phenolic compounds are secondary metabolites recognized as potent bioactive compounds, found in several vegetables.Therefore, the objective of this work is to characterize the algaroba flour in terms of its physicalchemical composition, total phenolic content, antioxidant activity by DPPH and ABTS methods, a-amylase and a-glycosidase inhibition, as well as to analyze its organic compounds by high performance liquid chromatography (HPLC). Three experimental groups were investigated (seeds, seeds and pod together and only pod), which were prepared by oven drying and posterior grinding. Water and ethanol extracts (70, 80, 100% v/v) were prepared and used for functional studies. Organic compounds were detected by using HPLC equipment coupled to mass spectrometer. Results show important physical-chemical differences among the experimental groups, seeds, seeds and pod together and only pod. The algarroba seed flour is high in protein (49.49%) and fat (3.10%), while the pod flour is especially rich in sugar (60.3% to 67.9%). Algaroba phenolics are concentrated in pod flour, mainly in water extracts (1.30 mg GAEQ/100g sample). All seed extracts showed high DPPH activity and maximum antioxidant activity was registered for ethanol 80% extracts (19.81 μM Trolox/g sample). The ABTS activity ranged from 9.73 to 12.74 μM Trolox/g sample. Nearly all the extracts were able to inhibit α-amylase activity mildly (30.50% to 48.80%), while the maximum α-glycosidase inhibition was observed for pod water extracts (81.03%). Algaroba water extracts proven to be especially rich in organic compounds, observed by the high number of chromatographic peaks. Results demonstrate that algaroba is a potential candidate for further investigations concerning its possible functional applications
Resumo:
The total number of prokaryotic cells on Earth has been estimated at 4 to 6x1030 and only about 1% of microorganisms present in the environment can be cultivated by standard techniques of cultivation and plating. Therefore, it is a huge biological and genetic pool that can be exploited, for the identification and characterization of genes with biotechnological potential. Within this perspective, the metagenomics approach was applied in this work. Functional screening methods were performed aiming to identify new genes related to DNA repair and / or oxidative stress resistance, hydrocarbon degradation and hydrolytic activities (lipase, amylase and protease). Metagenomic libraries were built utilizing DNA extracted from soil samples collected in João Câmara RN. The libraries were analyzed functionally using specific substrate containing solid medium (hydrolytic activity), supplemented with H2O2 (DNA repair and / or resistance to oxidative stress) and liquid medium supplemented with light Arabian oil (activity, degradation of hydrocarbons). After confirmation of activity and exclusion of false-positive results, 49 clones were obtained, being 2 positive for amylase activity, 22 resistant to oxidative stress generated by H2O2 and 25 clones active for hydrocarbons degradation. Analysis of the sequences showed hypothetical proteins, dienelactona hydrolase, DNA polymerase, acetyltransferase, phosphotransferase, methyltransferase, endonucleases, among other proteins. The sequence data obtained matched with the functions tested, highlighting the success of metagenomics approaches combined with functional screening methods, leading to very promising results