DIP-STR: A new marker for resolving unbalanced DNA mixtures

The genetic characterization of unbalanced mixed stains remains an important area where improvementis imperative. Most cases of aggression, homicide and sexual assault produce biological traces withrelatively large amount of the victim's DNA and small amount of the aggressor's DNA. If this ratio issmaller than 1:10 it is currently not possible to obtain a conventional autosomal DNA profile of the minorcontributor, with potential loss of crucial DNA evidence. Y-STR analysis represents a solution for somecases but has several limitations. We propose here a method based on a new compound genetic markerformed by a Deletion/Insertion Polymorphism (DIP) linked to a Short Tandem Repeat polymorphism(STR), that we name DIP-STR. By means of allele-specific amplifications of DIP-STR haplotypes, we canproduce a high resolution autosomal DNA profile of a donor that contributes less than 0.1% to a DNAmixture. Based on these features DIP-STR markers may outperform conventional Y-STR markers inmixed stain analysis.

Cl gene cluster encoding several small nucleolar RNAs: a comparison amongst trypanosomatids

Small nucleolar RNAs (snoRNAs) are small non-coding RNAs that modify RNA molecules such as rRNA and snRNA by guiding 2'-O-ribose methylation (C/D box snoRNA family) and pseudouridylation reactions (H/ACA snoRNA family). H/ACA snoRNAs are also involved in trans-splicing in trypanosomatids. The aims of this work were to characterise the Cl gene cluster that encodes several snoRNAs in Trypanosoma rangeli and compare it with clusters from Trypanosoma cruzi, Trypanosoma brucei, Leishmania major, Leishmania infantum, Leishmania braziliensis and Leptomonas collosoma. The T. rangeli Cl gene cluster is an 801 base pair (bp) repeat sequence that encodes three C/D (Cl1, Cl2 and Cl4) and three H/ACA (Cl3, Cl5 and Cl6) snoRNAs. In contrast to T. brucei, the Cl3 and Cl5 homologues have not been annotated in the Leishmania or T. cruzi genome projects (http//:www.genedb.org). Of note, snoRNA transcribed regions have a high degree of sequence identity among all species and share gene synteny. Collectively, these findings suggest that the Cl cluster could constitute an interesting target for therapeutic (gene silencing) or diagnostic intervention strategies (PCR-derived tools).

Avaliação da associação entre a presença de polimorfismo no gene da metaloproeinase-9 e o desenvolvimento do carcinoma espinocelular quimicamente induzido pelo DMBA na pele de camundongos hairless

Coordenação de Aperfeiçoamento de Pessoal de Nível Superior (CAPES)

Interaction among nitric oxide (NO)-related genes in migraine susceptibility

The pathogenic mechanisms involved in migraine are complex and not completely clarified. Because there is evidence for the involvement of nitric oxide (NO) in migraine pathophysiology, candidate gene approaches focusing on genes affecting the endothelial function have been studied including the genes encoding endothelial NO synthase (eNOS), inducible NO synthase (iNOS), and vascular endothelial growth factor (VEGF). However, investigations on gene-gene interactions are warranted to better elucidate the genetic basis of migraine. This study aimed at characterizing interactions among nine clinically relevant polymorphisms in eNOS (T-786C/rs2070744, the 27 bp VNTR in intron 4, the Glu298Asp/rs1799983, and two additional tagSNPs rs3918226 and rs743506), iNOS (C(-1026)A/rs2779249 and G2087A/rs2297518), and VEGF (C(-2578)A/rs699947 and G(-634)C/rs2010963) in migraine patients and control group. Genotypes were determined by real-time polymerase chain reaction using the Taqman(A (R)) allele discrimination assays or PCR and fragment separation by electrophoresis in 99 healthy women without migraine (control group) and in 150 women with migraine divided into two groups: 107 with migraine without aura and 43 with aura. The multifactor dimensionality reduction method was used to detect and characterize gene-gene interactions. We found a significant interaction between eNOS rs743506 and iNOS 2087G/A polymorphisms in migraine patients compared to control group (P < 0.05), suggesting that this combination affect the susceptibility to migraine. Further studies are needed to determine the molecular mechanisms explaining this interaction.

PRNP promoter polymorphisms are associated with BSE susceptibility in Swiss and German cattle

BACKGROUND: Non-synonymous polymorphisms within the prion protein gene (PRNP) influence the susceptibility and incubation time for transmissible spongiform encephalopathies (TSE) in some species such as sheep and humans. In cattle, none of the known polymorphisms within the PRNP coding region has a major influence on susceptibility to bovine spongiform encephalopathy (BSE). Recently, however, we demonstrated an association between susceptibility to BSE and a 23 bp insertion/deletion (indel) polymorphism and a 12 bp indel polymorphism within the putative PRNP promoter region using 43 German BSE cases and 48 German control cattle. The objective of this study was to extend this work by including a larger number of BSE cases and control cattle of German and Swiss origin. RESULTS: Allele, genotype and haplotype frequencies of the two indel polymorphisms were determined in 449 BSE cattle and 431 unaffected cattle from Switzerland and Germany including all 43 German BSE and 16 German control animals from the original study. When breeds with similar allele and genotype distributions were compared, the 23 bp indel polymorphism again showed a significant association with susceptibility to BSE. However, some additional breed-specific allele and genotype distributions were identified, mainly related to the Brown breeds. CONCLUSION: Our study corroborated earlier findings that polymorphisms in the PRNP promoter region have an influence on susceptibility to BSE. However, breed-specific differences exist that need to be accounted for when analyzing such data.

Do common genetic variants in endotoxin signaling pathway contribute to predisposition to alcoholic liver cirrhosis?

BACKGROUND: Tumor necrosis factor-alpha (TNF-alpha) and interleukin-1beta (IL-1beta), produced by endotoxin-activated Kupffer cells, play a key role in the pathogenesis of alcoholic liver cirrhosis (ALC). Alleles TNFA -238A, IL1B -31T and variant IL1RN*2 of repeat polymorphism in the gene encoding the IL-1 receptor antagonist increase production of TNF-alpha and IL-1beta, respectively. Alleles CD14 -159T, TLR4 c.896G and TLR4 c.1196T modify activation of Kupffer cells by endotoxin. We confirmed the published associations between these common variants and genetic predisposition to ALC by means of a large case-control association study conducted on two Central European populations. METHODS: The study population comprised a Czech sample of 198 ALC patients and 370 controls (MONICA project), and a German sample of 173 ALC patients and 331 controls (KORA-Augsburg), and 109 heavy drinkers without liver disease. RESULTS: Single locus analysis revealed no significant difference between patients and controls in all tested loci. Diplotype [IL1RN 2/ 2; IL1B -31T+] was associated with increased risk of ALC in the pilot study, but not in the validation samples. CONCLUSIONS: Although cytokine mediated immune reactions play a role in the pathogenesis of ALC, hereditary susceptibility caused by variants in the corresponding genes is low in Central European populations.

Bovine prion protein gene (PRNP) promoter polymorphisms modulate PRNP expression and may be responsible for differences in bovine spongiform encephalopathy susceptibility

The susceptibility of humans to the variant Creutzfeldt-Jakob disease is greatly influenced by polymorphisms within the human prion protein gene (PRNP). Similar genetic differences exist in sheep, in which PRNP polymorphisms modify the susceptibility to scrapie. However, the known coding polymorphisms within the bovine PRNP gene have little or no effect on bovine spongiform encephalopathy (BSE) susceptibility in cattle. We have recently found a tentative association between PRNP promoter polymorphisms and BSE susceptibility in German cattle (Sander, P., Hamann, H., Pfeiffer, I., Wemheuer, W., Brenig, B., Groschup, M., Ziegler, U., Distl, O., and Leeb, T. (2004) Neurogenetics 5, 19-25). A plausible hypothesis explaining this observation could be that the bovine PRNP promoter polymorphisms cause changes in PRNP expression that might be responsible for differences in BSE incubation time and/or BSE susceptibility. To test this hypothesis, we performed a functional promoter analysis of the different bovine PRNP promoter alleles by reporter gene assays in vitro and by measuring PRNP mRNA levels in calves with different PRNP genotypes in vivo. Two variable sites, a 23-bp insertion/deletion (indel) polymorphism containing a RP58-binding site and a 12-bp indel polymorphism containing an SP1-binding site, were investigated. Band shift assays indicated differences in transcription factor binding to the different alleles at the two polymorphisms. Reporter gene assays demonstrated an interaction between the two postulated transcription factors and lower expression levels of the ins/ins allele compared with the del/del allele. The in vivo data revealed substantial individual variation of PRNP expression in different tissues. In intestinal lymph nodes, expression levels differed between the different PRNP genotypes.

Genomic and cDNA sequence analysis of the cell matrix adhesion regulator gene

The cell matrix adhesion regulator (CMAR) gene has been suggested to be a signal transduction molecule influencing cell adhesion to collagen and, through this, possibly involved in tumor suppression. The originally reported CMAR cDNA was 464 bp long with a tyrosine phosphorylation site at the extreme 3′ end, which mutagenesis studies had shown to be central to the function of this gene. Since the discovery of a 4-bp insertion polymorphism within the originally reported coding region, further sequence information has been obtained. The cDNA has been extended 5′ by ≈2 kb revealing a 559-bp region showing strong homology to the proposed 5′ untranslated sequence of a murine protein kinase receptor family member, variant in kinase (vik). CMAR genomic sequencing has shown the presence of an intron, the intron/exon boundary lying within this region of homology. An RNA transcript for CMAR of ≈2.5 kb has also been identified. The data suggest complex mechanisms for control of expression of two closely associated genes, CMAR and the vik- associated sequence.

Molecular cloning of the transcription factor TFIIB homolog from Sulfolobus shibatae.

The Archaea (archaebacteria) constitute a group of prokaryotes that are phylogenetically distinct from Eucarya (eukaryotes) and Bacteria (eubacteria). Although Archaea possess only one RNA polymerase, evidence suggests that their transcriptional apparatus is similar to that of Eucarya. For example, Archaea contain a homolog of the TATA-binding protein which interacts with the TATA-box like A-box sequence upstream of many archaeal genes. Here, we report the cloning of a Sulfolobus shibatae gene that encodes a protein (transcription factor TFB) with striking homology to the eukaryotic basal transcription factor TFIIB. We show by primer extension analysis that transcription of the S. shibatae TFB gene initiates 27 bp downstream from a consensus A-box element. Significantly, S. shibatae TFB contains an N-terminal putative metal-binding region and two imperfect direct repeats--structural features that are well conserved in eukaryotic TFIIBs. This suggests that TFB may perform analogous functions in Archaea and Eucarya. Consistent with this, we demonstrate that S. shibatae TFB promotes the binding of S. shibatae TBP to the A-box element of the Sulfolobus 16S/23S rRNA gene. Finally, we show that S. shibatae TFB is significantly more related to TFB of the archaeon Pyrococcus woesei than it is to eukaryotic TFIIBs. These data suggest that TFB arose in the common archaeal/eukaryotic ancestor and that the lineages leading to P. woesei and S. shibatae separated after the divergence of the archaeal and eukaryotic lines of descent.

Seronegative spondyloarthropathies: To lump or split?

The advent of novel biological therapies for the treatment of rheumatic disease has renewed interest in the seronegative spondyloarthropathies (SpAs). International efforts are redefining disease classification and measures of disease activity, outcome, metrology, and imaging. However, opinion is divided between those who propose that the SpA group represents the same disease with variable expression (the lumpers) and those who consider these to be separate diseases with shared clinical features (the splitters). This review presents the evidence for both approaches.

Genomewide Linkage Scan of 409 European-ancestry and African American Families with Schizophrenia: Suggestive Evidence of Linkage at 8p23.3-p21.2 and 11p13.1-q14.1 in the Combined Sample

We report the clinical characteristics of a schizophrenia sample of 409 pedigrees-263 of European ancestry ( EA) and 146 of African American ancestry ( AA)-together with the results of a genome scan ( with a simple tandem repeat polymorphism interval of 9 cM) and follow-up fine mapping. A family was required to have a proband with schizophrenia ( SZ) and one or more siblings of the proband with SZ or schizoaffective disorder. Linkage analyses included 403 independent full-sibling affected sibling pairs ( ASPs) ( 279 EA and 124 AA) and 100 all-possible half-sibling ASPs ( 15 EA and 85 AA). Nonparametric multipoint linkage analysis of all families detected two regions with suggestive evidence of linkage at 8p23.3-q12 and 11p11.2-q22.3 ( empirical Z likelihood-ratio score [ Z(lr)] threshold >= 2.65) and, in exploratory analyses, two other regions at 4p16.1-p15.32 in AA families and at 5p14.3-q11.2 in EA families. The most significant linkage peak was in chromosome 8p; its signal was mainly driven by the EA families. Z(lr) scores >= 2.0 in 8p were observed from 30.7 cM to 61.7 cM ( Center for Inherited Disease Research map locations). The maximum evidence in the full sample was a multipoint Z(lr) of 3.25 ( equivalent Kong-Cox LOD of 2.30) near D8S1771 ( at 52 cM); there appeared to be two peaks, both telomeric to neuregulin 1 ( NRG1). There is a paracentric inversion common in EA individuals within this region, the effect of which on the linkage evidence remains unknown in this and in other previously analyzed samples. Fine mapping of 8p did not significantly alter the significance or length of the peak. We also performed fine mapping of 4p16.3-p15.2, 5p15.2-q13.3, 10p15.3-p14, 10q25.3-q26.3, and 11p13-q23.3. The highest increase in Z(lr) scores was observed for 5p14.1-q12.1, where the maximum Z(lr) increased from 2.77 initially to 3.80 after fine mapping in the EA families.

HLA-G 14-bp Insertion/Deletion Polymorphism Is a Risk Factor for HTLV-1 Infection

About 95% of HTLV-1 infected patients remain asymptomatic throughout life, and the risk factors associated with the development of related diseases, such as HAM/TSP and ATL, are not fully understood. The human leukocyte antigen-G molecule (HLA-G), a nonclassical HLA class I molecule encoded by MHC, is expressed in several pathological conditions, including viral infection, and is related to immunosuppressive effects that allow the virus-infected cells to escape the antiviral defense of the host. The 14-bp insertion/deletion polymorphism of exon 8 HLA-G gene influences the stability of the transcripts and could be related to HTLV-1-infected cell protection and to the increase of proviral load. The present study analyzed by conventional PCR the 14-bp insertion/deletion polymorphism of exon 8 HLA-G gene in 150 unrelated healthy subjects, 82 HTLV-1 infected patients with symptoms (33 ATL and 49 HAM), and 56 asymptomatic HTLV-1 infected patients (HAC). In addition, the proviral load was determined by quantitative real-time PCR in all infected groups and correlated with 14-bp insertion/deletion genotypes. The heterozygote genotype frequencies were significantly higher in HAM, in the symptomatic group, and in infected patients compared to control (p < 0.05). The proviral load was higher in the symptomatic group than the HAC group (p < 0.0005). The comparison of proviral load and genotypes showed that -14-bp/-14-bp genotype had a higher proviral load than +14-bp/-14-bp and +14-bp/+14-bp genotypes. Although HLA-G 14-bp polymorphism does not appear to be associated

Human chromosomal fragile site FRA16B is an amplified AT-rich minisatellite repeat

Fragile sites are nonstaining gaps in chromosomes induced by specific tissue culture conditions. They vary both in population frequency and in the culture conditions required for induction. Folate-sensitive fragile sites are due to expansion of p(CCG)(n) trinucleotide repeats; however, the relationship between sequence composition and the chemistry of induction of fragile sites is unclear. To clarify this relationship, the distamycin A-sensitive fragile site FRA16B was isolated by positional cloning and found to be an expanded 33 bp AT-rich minisatellite repeat, p(ATATATTATATATTATATCTAATAATATAT(C)/(A)TA)(n) (consistent with DNA sequence binding preferences of chemicals that induce its cytogenetic expression). Therefore the mutation mechanism associated with trinucleotide repeats is also a property of minisatellite repeats (variable number tandem repeats).

Interleukin-1 receptor antagonist gene (IL1RN) polymorphism possibly associated to severity of rheumatic carditis in a Brazilian cohort

Aims: To evaluate the IL1RN polymorphism as a possible marker for Rheumatic Fever (RF) susceptibility or disease severity. Methods: The genotypes of 84 RF patients (Jones criteria) and 84 normal race-matched controls were determined through the analysis of the number of 86-bp tandem repeats in the second intron of IL1RN. The DNA was extracted from peripheral-blood leukocytes and amplified with specific primers. Clinical manifestations of RF were obtained through a standardized questionnaire and an extensive chart review. Carditis was defined as new onset cardiac murmur that was perceived by a trained physician with corresponding valvae regurgitation or stenosis on echocardiogram. Carditis was classified as severe in the presence of congestive heart failure or upon the indication for cardiac surgery. The statistical association among the genotypes, RF and its clinical variations was determined. Results: The presence of allele I and the genotype A1/A1 were found less frequently among patients with severe carditis when compared to patients without this manifestation (OR = 0.11, p = 0.031; OR = 0.092, p = 0.017). Neither allele I nor allele 2 were associated with the presence of RF (p = 0.188 and p = 0.106), overall carditis (p = 0.578 and p = 0.767), polyarthritis (p = 0.343 and p = 0.313) and chorea (p = 0.654 and p = 0.633). Conclusion: In the Brazilian population, the polymorphism of the IL-1ra gene is a relevant factor for rheumatic heart disease severity. (C) 2009 Elsevier Ltd. All rights reserved.

Lack of Association Between a 3 ` UTR VNTR Polymorphism of Dopamine Transporter Gene (SLC6A3) and ADHD in a Brazilian Sample of Adult Patients

Objective: To investigate a possible association between a 3`UTR VNTR polymorphism of the dopamine transporter gene (SLC6A3) and ADHD in a Brazilian sample of adult patients. Method: Study Case-control with 102 ADHD adult outpatients (DSM-IV criteria) and 479 healthy controls. The primers` sequence used were: 3`UTR-Forward: 5`TGT GGT GAT GGG AAC GGC CTG AG 3` and 3`UTR-Reverse: 5`CTT CCT GGA GGT CAC GGC TCA AGG 3`. Alleles of the 3`UTR were coded according to their number of repeats: 6- repeat 320 bp (allele 6), 8- repeat 400 bp (allele 8), 9-repeat 480 bp (allele 9), 10- repeat 480 bp (allele 10), and 11- repeat 520 bp (allele 11). Results: There were no allelic (chi(2) = 2.67, 5df, p = .75) and genotypic (chi(2) = 7.20, 1df, p = .61) association between adult ADHD and VNTR 3`UTR polymorphism of SLC6A3. Conclusion: Our findings do not support SLC6A3 as marker genetic susceptibility factor in adult ADHD. More comprehensive polymorphism coverage within the SLC6A3 region should be conducted in larger samples, including comparisons in clinical subgroups, and in samples with different ethnic backgrounds. (J. of Att. Dis. 2011; 15(4) 305-309)