924 resultados para neutron reactions
Resumo:
Irradiation of argon matrices at 12 K containing hydrogen peroxide and tetrachloroethene using the output from a medium-pressure mercury lamp gives rise to the carbonyl compound trichloroacetyl chloride (CCl3CClO). Similarly trichloroethene gives dichloroacetyl chloride ( CCl2HCClO) - predominantly in the gauche form - under the same conditions. It appears that the reaction is initiated by homolysis of the O-O bond of H2O2 to give OH radicals, one of which adds to the double bond of an alkene molecule. The reaction then proceeds by abstraction of the H atom of the hydroxyl group and Cl-atom migration. This mechanism has been explored by the use of DFT calculations to back up the experimental findings. The mechanism is analogous to that shown by the simple hydrocarbon alkenes.
Resumo:
The compounds chlorothiazide and hydrochlorothiazide (crystalline form II) have been studied in their fully hydrogenous forms by powder neutron diffraction on the GEM diffractometer. The results of joint Rietveld refinement of the structures against multi-bank neutron and single-bank X-ray powder data are reported and show that accurate and precise structural information can be obtained from polycrystalline molecular organic materials by this route.
Resumo:
Tetrazole and acylsulfonamide organocatalysts derived from proline have been synthesised and applied to the asymmetric Mannich, nitro-Michael and aldol reactions to give results that are superior to the proline-catalysed counterpart.
Resumo:
Threatening intrusive images are central to posttraumatic stress disorder. It has been suggested that intrusive imagery in the context of a sense of threat leads to the development and persistence of posttraumatic stress symptoms. This study investigates London school children's (N = 76; age 10-11 years) self-reported posttraumatic stress symptoms in response to viewing the attacks of September 11, 2001 on television. Assessments were made at two time points. A minority of participants reported moderate-severe symptoms with functional impairment at 2 months (14.5%) and 6 months (9.2%) after viewing the September 11events. After controlling for symptom stability, persistent symptoms were associated with peri-traumatic factors, notably perceiving that one's life was in danger. The combined effect of intrusive imagery and peri-traumatic life threat was associated with symptom persistence. Assessments of intrusive image content via checklist and free-report indicated that the images were directly related to September 11 and were fairly stable over time. Implications for treating children's intrusive images following stressful events are explored. (C) 2007 Elsevier Ltd. All rights reserved.
Resumo:
This article describes work undertaken by the VERA project to investigate how archaeologists work with information technology (IT) on excavation sites. We used a diary study to research the usual patterns of behaviour of archaeologists digging the Silchester Roman town site during the summer of 2007. Although recording had previously been undertaken using pen and paper, during the 2007 season a part of the dig was dedicated to trials of IT and archaeologists used digital pens and paper and Nokia N800 handheld PDAs to record their work. The goal of the trial was to see whether it was possible to record data from the dig whilst still on site, rather than waiting until after the excavation to enter it into the Integrated Archaeological Database (IADB) and to determine whether the archaeologists found the new technology helpful. The digital pens were a success, however, the N800s were not successful given the extreme conditions on site. Our findings confirmed that it was important that technology should fit in well with the work being undertaken rather than being used for its own sake, and should respect established work flows. We also found that the quality of data being entered was a recurrent concern as was the reliability of the infrastructure and equipment.
Resumo:
Recent developments in instrumentation and facilities for sample preparation have resulted in sharply increased interest in the application of neutron diffraction. Of particular interest are combined approaches in which neutron methods are used in parallel with X-ray techniques. Two distinct examples are given. The first is a single-crystal study of an A-DNA structure formed by the oligonucleotide d(AGGGGCCCCT)2, showing evidence of unusual base protonation that is not visible by X-ray crystallography. The second is a solution scattering study of the interaction of a bisacridine derivative with the human telomeric sequence d(AGGGTTAGGGTTAGGGTTAGGG) and illustrates the differing effects of NaCl and KCl on this interaction.
Resumo:
The adsorption of NO on Ir{100} has been studied as a function of NO coverage and temperature using temperature programmed reflection absorption infrared spectroscopy (TP-RAIRS), low energy electron diffraction (LEED) and temperature programmed desorption (TPD). After saturating the clean (1 x 5)-reconstructed surface with NO at 95 K. two N-2, desorption peaks are observed upon heating. The first N-2 peak at 346 K results from the decomposition of bridge-bonded NO, and the second at 475 K from the decomposition of atop-bonded NO molecules. NO decomposition is proposed to be the rate limiting step for both N-2 desorption states. For high NO coverages on the (1 x 5) surface, the narrow width of the first N-2 desorption peak is indicative of an autocatalytic process for which the parallel formation of N2O appears to be the crucial step. When NO is adsorbed on the metastable unreconstructed (1 x 1) phase of clean Ir{100} N-2 desorption starts at lower temperatures, indicating that this surface modification is more reactive. When a high coverage of oxygen, near 0.5 ML, is pre-adsorbed on the surface, the decomposition of NO is inhibited and mainly desorption of intact NO is observed.
Resumo:
We have employed a combination of experimental surface science techniques and density functional calculations to study the reduction of TiO2(110) surfaces through the doping with submonolayer transition metals. We concentrate on the role of Ti adatoms in self doping of rutile and contrast the behaviour to that of Cr. DFT+U calculations enable identification of probable adsorption structures and their spectroscopic characteristics. Adsorption of both metals leads to a broken symmetry and an asymmetric charge transfer localised around the defect site of a mixed localised/delocalised character. Charge transfer creates defect states with Ti 3d character in the band gap at similar to 1-eV binding energy. Cr adsorption, however, leads to a very large shift in the valence-band edge to higher binding energy and the creation of Cr 3d states at 2.8-eV binding energy. Low-temperature oxidation lifts the Ti-derived band-gap states and modifies the intensity of the Cr features, indicative of a change of oxidation state from Cr3+ to Cr4+. Higher temperature processing leads to a loss of Cr from the surface region, indicative of its substitution into the bulk.
Resumo:
Rate coefficients for reactions of nitrate radicals (NO3) with the anthropogenic emissions 2-methylpent-2-ene, (Z)-3-methylpent-2-ene.. ethyl vinyl ether, and the stress-induced plant emission ethyl vinyl ketone (pent-1-en-3-one) were determined to be (9.3 +/- 1.1) x 10(-12), (9.3 +/- 3.2) x 10(-12), (1.7 +/- 1.3) x 10(-12) and (9.4 + 2.7) x 10(-17) cm(3) molecule(-1) s(-1). We performed kinetic experiments at room temperature and atmospheric pressure using a relative-rate technique with GC-FID analysis. Experiments with ethyl vinyl ether required a modification of our established procedure that might introduce additional uncertainties, and the errors suggested reflect these difficulties. Rate coefficients are discussed in terms of electronic and steric influences. Atmospheric lifetimes with respect to important oxidants in the troposphere were calculated. NO3-initiated oxidation is found to be the strongly dominating degradation route for 2-methylpent-2-ene, (Z)-3-methylpent-2-ene and ethyl vinyl ether. Atmospheric concentrations of the alkenes and their relative contribution to the total NMHC emissions from trucks can be expected to increase if plans for the introduction of particle filters for diesel engines are implemented on a global scale. Thus more kinetic data are required to better evaluate the impact of these emissions.
Resumo:
The night-time atmospheric chemistry of the biogenic volatile organic compounds (Z)-hex-4-en-1-ol, (Z)-hex-3-en-1-ol ('leaf alcohol'), (E)-hex-3-en-1-ol, (Z)-hex-2-en-1-ol and (E)-hex-2-en-1-ol, has been studied at room temperature. Rate coefficients for reactions of the nitrate radical (NO3) with these stress-induced plant emissions were measured using the discharge-flow technique. We employed off-axis continuous-wave cavity-enhanced absorption spectroscopy (CEAS) for the detection of NO3, which enabled us to work in excess of the hexenol compounds over NO3. The rate coefficients determined were (2.93 +/- 0.58) x 10(-13) cm(3) molecule(-1) s(-1), (2.67 +/- 0.42) x 10(-13) cm(3) molecule(-1) s(-1), (4.43 +/- 0.91) x 10(-13) cm(3) molecule(-1) s(-1), (1.56 +/- 0.24) x 10(-13) cm(3) molecule(-1) s(-1), and (1.30 +/- 0.24) x 10(-13) cm(3) molecule(-1) s(-1) for (Z)-hex-4-en-1-ol, (Z)-hex-3en-1-ol, (E)-hex-3-en-1-ol, (Z)-hex-2-en-1-ol and (E)-hex-2-en-1-ol. The rate coefficient for the reaction of NO3 with (Z)-hex-3-en-1-ol agrees with the single published determination of the rate coefficient using a relative method. The other rate coefficients have not been measured before and are compared to estimated values. Relative-rate studies were also performed, but required modification of the standard technique because N2O5 (used as the source of NO3) itself reacts with the hexenols. We used varying excesses of NO2 to determine simultaneously rate coefficients for reactions of NO3 and N2O5 with (E)-hex-3-en-1-ol of (5.2 +/- 1.8) x 10(-13) cm(3) molecule(-1) s(-1) and (3.1 +/- 2.3) x 10(-18) cm(3) molecule(-1) s(-1). Our new determinations suggest atmospheric lifetimes with respect to NO3-initiated oxidation of roughly 1-4 h for the hexenols, comparable with lifetimes estimated for the atmospheric degradation by OH and shorter lifetimes than for attack by O-3. Recent measurements of [N2O5] suggest that the gas-phase reactions of N2O5 with unsaturated alcohols will not be of importance under usual atmospheric conditions, but they certainly can be in laboratory systems when determining rate coefficients.
Resumo:
We present updated structure-activity relations (SARs) for the prediction of rate coefficients for gas-phase reactions with alkenes of the major atmospheric oxidants NO3, OH and O-3. Such SARs provide one way of incorporating essential information about reactivity into atmospheric models. Rate coefficients obtained from correlations relating the logarithms of the rate coefficients to the energies of the highest occupied molecular orbitals (HOMOs) of the alkenes were used to refine the SARs. SARs have an advantage for the user over the direct application of the correlations in that knowledge of the structure of the alkene of interest is sufficient to estimate rate coefficients, and no quantum-mechanical calculations need to be performed. A comparison of the values predicted by the SARs with experimental data where they exist allowed us to assess the reliability of our method.
Resumo:
Methods are developed for predicting rate coefficients for reactions of initiators of tropospheric oxidation with unsaturated compounds that are abundant in the atmosphere; prognostic tools of this kind are essential for atmospheric chemists and modellers. To pursue the aim of exploring such tools, the kinetics of reactions of NO3, OH and O-3 with a series of alkenes are examined for correlations relating the logarithms of the rate coefficients to the energies of the highest occupied molecular orbitals (HOMOs) of the alkenes. A comparison of the values predicted by the correlations with experimental data (where the latter exist) allowed us to assess the reliability of our method. We used a series of theoretical methods to calculate the HOMO energies, and found that higher computational effort improves the agreement of the predicted rate coefficients with experimental values, especially for reactions of NO3 with alkenes that possess vinyllic halogen substituents. As a consequence, it is expedient to suggest new correlations to replace those presented by us and others that were based on the lower level of theory. We propose the following correlations for the reactions of NO3, OH and O-3 with alkenes: ln(k(NO3)/cm(3) molecule(-1) s(-1)) = 6.40(E-HOMO/eV) + 31.69, ln(k(OH)/cm(3) molecule(-1) s(-1)) = 1.21 (E-HOMO/eV)-12.34 and ln(k(O3)/cm(3) molecule(-1) s(-1)) = 3.28(E-HOMO/eV)-6.78. These new correlations have been developed using the larger experimental data sets now available, and the impact of the extended data on the quality of the correlations is examined in the paper. Atmospheric lifetimes have been calculated from both experimental and estimated rate coefficients to provide an overview of removal efficiencies for different classes of alkenes with respect to oxidative processes initiated by NO3, OH and O-3. A figure is presented to show the spatial scales over which alkenes may survive transport in competition with attack by NO3, OH and O-3. Removal by NO3 or OH is always more important than removal by O-3, and reactions with NO3 dominate for scales up to a few hundred metres.
Resumo:
A discharge-flow system, coupled to cavity-enhanced absorption spectroscopy (CEAS) detection systems for NO3 at lambda = 662 nm and NO2 at lambda = 404 nm, was used to investigate the kinetics of the reactions of NO3 with eight peroxy radicals at P similar to 5 Torr and T similar to 295 K. Values of the rate constants obtained were (k/10(-12) cm(3) molecule(-1) s(-1)): CH3O2 (1.1 +/- 0.5), C2H5O2 (2.3 +/- 0.7), CH2FO2 (1.4 +/- 0.9), CH2ClO2 (3.8(-2.6)(+1.4)), c-C5H9O2 (1.2(-0.5)(+1.1)), c-C6H11O2 (1.9 +/- 0.7), CF3O2 (0.62 +/- 0.17) and CF3CFO2CF3 (0.24 +/- 0.13). We explore possible relationships between k and the orbital energies of the reactants. We also provide a brief discussion of the potential impact of the reactions of NO3 with RO2 on the chemistry of the night-time atmosphere.
Resumo:
The kinetics of the reactions of the atoms O(P-3), S(P-3), Se(P-3), and Te((3)p) with a series of alkenes are examined for correlations relating the logarithms of the rate coefficients to the energies of the highest occupied molecular orbitals (HOMOs) of the alkenes. These correlations may be employed to predict rate coefficients from the calculated HOMO energy of any other alkene of interest. The rate coefficients obtained from the correlations were used to formulate structure-activity relations (SARs) for reactions of O((3)p), S(P-3), Se (P-3), and Te((3)p) with alkenes. A comparison of the values predicted by both the correlations and the SARs with experimental data where they exist allowed us to assess the reliability of our method. We demonstrate the applicability of perturbation frontier molecular orbital theory to gas-phase reactions of these atoms with alkenes. The correlations are apparently not applicable to reactions of C(P-3), Si(P-3), N(S-4), and Al(P-2) atoms with alkenes, a conclusion that could be explained in terms of a different mechanism for reaction of these atoms.
Resumo:
Rate coefficients for reactions of nitrate radicals (NO3) with (Z)-pent-2-ene, (E)-pent-2-ene, (Z)-hex-2-ene, (E)-hex-2-ene, (Z)-hex-3-ene, (E)-hex-3-ene and (E)-3-methylpent-2-ene were determined to be (6.55 +/- 0.78) x 10(-13) cm(3) molecule(-1) s(-1), (3.78 +/- 0.45) x 10(-13) cm(3) molecule(-1) s(-1), (5.30 +/- 0.73) x 10(-13) cm(3) molecule(-1) s(-1), (3.83 +/- 0.47) x 10(-13) cm(3) molecule(-1) s(-1), (4.37 +/- 0.49) x 10(-13) cm(3) molecule(-1) s(-1), (3.61 +/- 0.40) x 10(-13) cm(3) molecule(-1) s(-1) and (8.9 +/- 1.5) x 10(-12) cm(3) molecule(-1) s(-1), respectively. We performed kinetic experiments at room temperature and atmospheric pressure using a relative-rate technique with GC-FID analysis. The experimental results demonstrate a surprisingly large cis-trans (Z-E) effect, particularly in the case of the pent-2-enes, where the ratio of rate coefficients is ca. 1.7. Rate coefficients are discussed in terms of electronic and steric influences, and our results give some insight into the effects of chain length and position of the double bond on the reaction of NO3 with unsaturated hydrocarbons. Atmospheric lifetimes were calculated with respect to important oxidants in the troposphere for the alkenes studied, and NO3-initiated oxidation is found to be the dominant degradation route for (Z)-pent-2-ene, (Z)-hex-3-ene and (E)-3-methylpent-2-ene.