Examining the influence of biological and psychological factors on cognitive performance in chronic fatigue syndrome: A randomized, double-blind, placebo-controlled, crossover study

The pathophysiology of chronic fatigue syndrome (CFS) remains unclear; however, both biological and psychological factors have been implicated in establishing or maintaining this condition. People with CFS report significant and disabling cognitive difficulties such as impaired concentration that in some cases are exacerbated by exposure to chemical triggers. The aim of this study was to determine if neuropsychological deficits in CFS are triggered by exposure to chemicals, or perceptions about the properties of these substances. Participants were 36 people with a primary diagnosis of CFS, defined according to Centers for Disease Control (CDC) criteria. A randomized, double-blind, placebo-controlled, crossover design was used, with objective assessment of neuropsychological function and participant rating of substance type, before and after exposure to placebo or chemical trigger. Results showed decrements in neuropsychological tests scores on three out of four outcome measures when participants rated the substance they had been exposed to as chemical. No change in performance was found based on actual substance type. These results suggest that cognitive attributions about exposure substances in people with CFS may be associated with worse performance on neuropsychological tasks. In addition, these findings suggest that psychological interventions aimed at modifying substance-related cognitions may reduce some symptoms of CFS.

Detecting sugarcane 'orange rust' disease using EO-1 Hyperion hyperspectral imagery

This Letter evaluates several narrow-band indices from EO-1 Hyperion imagery in discriminating sugarcane areas affected by 'orange rust' ( Puccinia kuehnii ) disease. Forty spectral vegetation indices (SVIs), focusing on bands related to leaf pigments, leaf internal structure, and leaf water content, were generated from an image acquired over Mackay, Queensland, Australia. Discriminant function analysis was used to select an optimum set of indices based on their correlations with the discriminant function. The predictive ability of each index was also assessed based on the accuracy of classification. Results demonstrated that Hyperion imagery can be used to detect orange rust disease in sugarcane crops. While some indices that only used visible near-infrared (VNIR) bands (e.g. SIPI and R800/R680) offer separability, the combination of VNIR bands with the moisture-sensitive band (1660 nm) yielded increased separability of rust-affected areas. The newly formulated 'Disease-Water Stress Indices' (DWSI-1=R800/R1660; DSWI-2=R1660/R550; DWSI-5=(R800+R550)/(R1660+R680)) produced the largest correlations, indicating their superior ability to discriminate sugarcane areas affected by orange rust disease.

Image calibration to like-values in mapping shallow water quality from multitemporal data

The applicability of image calibration to like-values in mapping water quality parameters from multitemporal images is explored, Six sets of water samples were collected at satellite overpasses over Moreton Bay, Brisbane, Australia. Analysis of these samples reveals that waters in this shallow bay are mostly TSS-dominated, even though they are occasionally dominated by chlorophyll as well. Three of the images were calibrated to a reference image based on invariant targets. Predictive models constructed from the reference image were applied to estimating total suspended sediment (TSS) and Secchi depth from another image at a discrepancy of around 35 percent. Application of the predictive model for TSS concentration to another image acquired at a time of different water types resulted in a discrepancy of 152 percent. Therefore, image calibration to like-values could be used to reliably map certain water quality parameters from multitemporal TM images so long as the water type under study remains unchanged. This method is limited in that the mapped results could be rather inaccurate if the water type under study has changed considerably. Thus, the approach needs to be refined in shallow water from multitemporal satellite imagery.

Proteasomal degradation of N-acetyltransferase 1 is prevented by acetylation of the active site cysteine - A mechanism for the slow acetylator phenotype and substrate-dependent down-regulation

Many drugs and chemicals found in the environment are either detoxified by N-acetyltransferase 1 (NAT1, EC 2.3.1.5) and eliminated from the body or bioactivated to metabolites that have the potential to cause toxicity and/or cancer. NAT1 activity in the body is regulated by genetic polymorphisms as well as environmental factors such as substrate-dependent down-regulation and oxidative stress. Here we report the molecular mechanism for the low protein expression from mutant NAT1 alleles that gives rise to the slow acetylator phenotype and show that a similar process accounts for enzyme down-regulation by NAT1 substrates. NAT1 allozymes NAT1 14, NAT1 15, NAT1 17, and NAT1 22 are devoid of enzyme activity and have short intracellular half-lives (similar to4 h) compared with wild-type NAT1 4 and the active allozyme NAT1 24. The inactive allozymes are unable to be acetylated by cofactor, resulting in ubiquitination and rapid degradation by the 26 S proteasome. This was confirmed by site-directed mutagenesis of the active site cysteine 68. The NAT1 substrate p-aminobenzoic acid induced ubiquitination of the usually stable NAT1 4, leading to its rapid degradation. From this study, we conclude that NAT1 exists in the cell in either a stable acetylated state or an unstable non-acetylated state and that mutations in the NAT1 gene that prevent protein acetylation produce a slow acetylator phenotype.

Mandibular gland secretions of meliponine worker bees: further evidence for their role in interspecific and intraspecific defence and aggression and against their role in food source signalling

Like ants and termites some species of stingless bees (Meliponini), which are very important pollinators in the tropics, use pheromone trails to communicate the location of a food source. We present data on the communicative role of mandibular gland secretions of Meliponini that resolve a recent controversy about their importance in the laying of such trails. Volatile constituents of the mandibular glands have been erroneously thought both to elicit aggressive/defensive behaviour and to signal food source location. We studied Trigona spinipes and Scaptotrigona aff. depilis (`postica`), two sympatric species to which this hypothesis was applied. Using extracts of carefully dissected glands instead of crude cephalic extracts we analysed the substances contained in the mandibular glands of worker bees. Major components of the extracts were 2-heptanol (both species), nonanal (T. spinipes), benzaldehyde and 2-tridecanone (S. aff. depilis). The effect of mandibular gland extracts and of individual components thereof on the behaviour of worker bees near their nest and at highly profitable food sources was consistent. Independent of the amount of mandibular gland extract applied, the bees overwhelmingly reacted with defensive behaviour and were never attracted to feeders scented with mandibular gland extract or any of the synthetic chemicals tested. Both bee species are capable of using mandibular gland secretions for intra-and interspecific communication of defence and aggression and share 2-heptanol as a major pheromone compound. While confirming the role of the mandibular glands in nest defence, our experiments provide strong evidence against their role in food source signalling.

Residues of spinosad in the tissues of sheep after aerosol treatment of blowfly myiasis

Objective To measure the residues of spinosad and chlorhexidine in the tissues of sheep after treatment of blowfly strike. Procedure Fourteen sheep with natural myiasis and 12 with artificial infestations of Lucilia cuprina larvae had the wool removed over their infestations and were treated with an aerosol wound dressing containing spinosad and chlorhexidine. Sheep were killed up to 14 days after treatment and residues of the chemicals measured in tissues. Results Chlorhexidine was not detected in any tissue. Residues of spinosad were highest in fat, lowest in muscle and intermediate in liver and kidney. The highest residue detected was 0.2 mg/kg spinosad in perirenal fat 7 days after generous treatment of a sheep with a large fly strike. Residues of spinosad in fat peaked 3 to 7 days after treatment and 1 to 3 days after treatment in liver and kidney. Conclusion These studies present a realistic worst-case in struck sheep and at the highest dose studied, equivalent to 5.8 mg spinosad per kg body weight, the maximum residue detected of 0.2 mg/kg in peri-renal fat was 20% of the Australian maximum residue limit. Muscle, liver and kidney residues of spinosad were also below the Australian maximum residue limits at all times.

Experience-induced preference for oviposition repellents derived from a non-host plant by a specialist herbivore

Foraging adults of phytophagous insects are attracted by host-plant volatiles and supposedly repelled by volatiles from non-host plants. In behavioural control of pest insects, chemicals derived from non-host plants applied to crops are expected to repel searching adults and thereby reduce egg laying. How experience by searching adults of non-host volatiles affects their subsequent searching and oviposition behaviour has been rarely tested. In laboratory experiments, we examined the effect of experience of a non-host-plant extract on the oviposition behaviour of the diamondback moth (DBM), Plutella xylostella, a specialist herbivore of cruciferous plants. Naive ovipositing DBM females were repelled by an extract of dried leaves of Chrysanthemum morifolium, a non-host plant of DBM, but experienced females were not repelled. Instead they were attracted by host plants treated with the non-host-plant extract and laid a higher proportion of eggs on treated than on untreated host plants. Such behavioural changes induced by experience could lead to host-plant range expansion in phytophagous insects and play an important role in determining outcome for pest management of some behavioural manipulation methods.

Mapping changes in coastline geomorphic features using Landsat TM and ETM+ imagery: examples in southeastern Brazil

Multitemporal Landsat Thematic Mapper (TM) and Enhanced Thematic Mapper Plus (ETM+) imagery was used to assess coastline morphological changes in southeastern Brazil. A spectral linear mixing approach (SLMA) was used to estimate fraction imagery representing amounts of vegetation, clean water (a proxy for shade) and soil. Fraction abundances were related to erosive and depositional features. Shoreline, sandy banks (including emerged and submerged banks) and sand spits were highlighted mainly by clean water and soil fraction imagery. To evaluate changes in the coastline geomorphic features, the fraction imagery generated for each data set was classified in a contextual approach using a segmentation technique and ISOSEG, an unsupervised classification. Evaluation of the classifications was performed visually and by an error matrix relating ground-truth data to classification results. Comparison of the classification results revealed an intense transformation in the coastline, and that erosive and depositional features are extremely dynamic and subject to change in short periods of time.

Symptoms after mould exposure including Stachybotrys chartarum, and comparison with darkroom disease

P>Background: Mould-attributed symptoms have included features which overlap with unexplained syndromes such as sick building syndrome. Objectives: We describe questionnaire and chart review findings in patients following exposure to moulds which include Stachybotrys and compare responses with two control groups. Methods: Thirty-two patients presented with symptoms attributed to mould exposures. Exposure identification for 25 patients had reported S tachybotrys chartarum as well as other mould (Aspergillus, Penicillium), 88% at work. The remaining seven had professionally visualized or self-reported/photographic exposure evidence only. A chart review was performed and a follow-up with a questionnaire, including questions on current health status, and nonspecific symptoms. Results: Cough, shortness of breath and chest tightness (at presentation) were reported in 79%, 70% and 64%, respectively, and persisted > 6 weeks in 91%. Skin test(s) were positive to fungal extract(s) in 30%. Seventeen returned questionnaires were obtained 3.1 (SD 0.5) years after the initial clinic assessment. Among this subgroup, persisting asthma-like symptoms and symptoms suggestive of sick building syndrome were frequent, and similar to a group previously assessed for darkroom disease among medical radiation technologists. The mould-exposed group more commonly reported they were bothered when walking in a room with carpets, complained of a chemical or metallic taste in their mouth, and had problems in concentration when compared with a control physiotherapist group (P < 0.005). Conclusions: Although only a minority with health concerns from indoor mould exposure had demonstrable mould-allergy, a significant proportion had asthma-like symptoms. Other symptoms were also common and persistent after the initial implicated exposure.

Immunopathology of allergic contact dermatitis

Allergic contact dermatitis is the consequence of an immune reaction mediated by T cells against low molecular weight chemicals known as haptens. It is a common condition that occurs in all races and age groups and affects the quality of life of those who present it. The immunological mechanism of this disease has been reviewed in recent decades with significant advance in its understanding. The metabolism and pathway of the haptens as well as the activation and mechanism of action of the cells responsible for both the immune reaction and its completion are discussed in this article.

Three-dimensional model for multi-component reactive transport with variable density groundwater flow

PHWAT is a new model that couples a geochemical reaction model (PHREEQC-2) with a density-dependent groundwater flow and solute transport model (SEAWAT) using the split-operator approach. PHWAT was developed to simulate multi-component reactive transport in variable density groundwater flow. Fluid density in PHWAT depends not on only the concentration of a single species as in SEAWAT, but also the concentrations of other dissolved chemicals that can be subject to reactive processes. Simulation results of PHWAT and PHREEQC-2 were compared in their predictions of effluent concentration from a column experiment. Both models produced identical results, showing that PHWAT has correctly coupled the sub-packages. PHWAT was then applied to the simulation of a tank experiment in which seawater intrusion was accompanied by cation exchange. The density dependence of the intrusion and the snow-plough effect in the breakthrough curves were reflected in the model simulations, which were in good agreement with the measured breakthrough data. Comparison simulations that, in turn, excluded density effects and reactions allowed us to quantify the marked effect of ignoring these processes. Next, we explored numerical issues involved in the practical application of PHWAT using the example of a dense plume flowing into a tank containing fresh water. It was shown that PHWAT could model physically unstable flow and that numerical instabilities were suppressed. Physical instability developed in the model in accordance with the increase of the modified Rayleigh number for density-dependent flow, in agreement with previous research. (c) 2004 Elsevier Ltd. All rights reserved.

The Parkes half-jansky flat-spectrum sample

We present a new sample of Parkes half-jansky flat-spectrum radio sources, having made a particular effort to find any previously unidentified sources. The sample contains 323 sources selected according to a flux limit of 0.5 Jy at 2.7 GHz, a spectral index measured between 2.7 and 5.0 GHz of alpha(2.7/5.0) > -0.5, where S(nu) proportional to nu(alpha), Galactic latitude \b\ > 20 degrees and -45 degrees < declination (B1950) < +10 degrees. The sample was selected from a region 3.90 steradians in area. We have obtained accurate radio positions for all the unresolved sources in this sample, and combined these with accurate optical positions from digitized photographic sky survey data to check all the optical identifications. We report new identifications based on R- and Kn-band imaging and new spectroscopic measurements of many of the sources. We present a catalogue of the 323 sources, of which 321 now have identified optical counterparts and 277 have measured spectral redshifts.

Human chromosomal fragile site FRA16B is an amplified AT-rich minisatellite repeat

Fragile sites are nonstaining gaps in chromosomes induced by specific tissue culture conditions. They vary both in population frequency and in the culture conditions required for induction. Folate-sensitive fragile sites are due to expansion of p(CCG)(n) trinucleotide repeats; however, the relationship between sequence composition and the chemistry of induction of fragile sites is unclear. To clarify this relationship, the distamycin A-sensitive fragile site FRA16B was isolated by positional cloning and found to be an expanded 33 bp AT-rich minisatellite repeat, p(ATATATTATATATTATATCTAATAATATAT(C)/(A)TA)(n) (consistent with DNA sequence binding preferences of chemicals that induce its cytogenetic expression). Therefore the mutation mechanism associated with trinucleotide repeats is also a property of minisatellite repeats (variable number tandem repeats).

Evaluation of the poly-L-lactic acid implant for treatment of the nasolabial fold: 3-year follow-up evaluation

The search for an ideal filler for soft tissue augmentation still continues. Because aging changes are continuous, temporary fillers should be preferred against permanent ones. Since 1999, the poly-L-lactic acid filler (PLA) has been marketed in Europe as Newfill. As a synthetic biocompatible polymer, PLA originally was used in suture materials and screws. In 2004, the U.S. Food and Drug Administration approved PLA under the name of Sculptra for the treatment of human immunodeficiency virus-related facial lipoatrophy. This study aimed to evaluate a 3-year follow-up investigation into the effect of PLA implant injection for the treatment of sunken nasolabial folds. Between October 2003 and February 2004, 10 women with a median age of 54 years (range, 43-60 years) were injected with polylactic acid hydrogel (Newfill) in the nasolabial fold area for aesthetic reasons. All the patients underwent three injections: one injection per month for 3 months. Evaluation of the results based on clinical examination and photography was performed at each session, at 6 months, and then 36 months after the third session. Injectable PLA was able to correct nasolabial folds successfully with a more lasting result than absorbable fillers commonly used in clinical practice, such as hyaluronic acid and collagen. Careful and standardized photographic documentation is indispensable.

Drugs in the acute porphyrias - Toxicogenetic diseases

The acute Porphyrias are examples of toxico-genetic diseases and diseases genetically acquired, which show an idiosyncratic reaction to certain chemicals and drugs. Porphyrics are at risk of developing an acute attack if exposed to various precipitating factors of which drugs are the most common factor. This paper presents lists of drugs complied into those hazardous for patients with acute porphyria and those thought to be safe.