Normal human serum contains a natural IgM antibody cytotoxic for human neuroblastoma cells.

Neuroblastoma (NB) is characterized by the second highest spontaneous regression of any human malignant disorder, a phenomenon that remains to be elucidated. In this study, a survey of 94 normal human adult sera revealed a considerable natural humoral cytotoxicity against human NB cell lines in approximately one-third of the tested sera of both genders. Specific cell killing by these sera was in the range of 40% to 95%. Serum cytotoxicity was dependent on an intact classical pathway of complement. By several lines of evidence, IgM antibodies were identified as the cytotoxic factor in the sera. Further analyses revealed that a 260-kDa protein was recognized by natural IgM of cytotoxic sera in Western blots of NB cell extracts. The antigen was expressed on the surface of seven human NB cell lines but not on human melanoma or other control tumor cell lines derived from kidney, pancreas, colon, bone, skeletal muscle, lymphatic system, and bone marrow. Furthermore, no reactivity was observed with normal human fibroblasts, melanocytes, and epidermal keratinocytes. The antigen was expressed in vivo as detected by immunohistochemistry in both the tumor of a NB patient and NB tumors established in nude rats from human NB cell lines. Most interestingly, the IgM anti-NB antibody was absent from the sera of 11 human NB patients with active disease. The anti-NB IgM also could not be detected in tumor tissue obtained from a NB patient. Collectively, our data suggest the existence of a natural humoral immunological tumor defense mechanism, which could account for the in vivo phenomenon of spontaneous NB tumor regression.

Correlation between the effects of bombesin antagonists on cell proliferation and intracellular calcium concentration in Swiss 3T3 and HT-29 cell lines.

Bombesin (BN) acts as an autocrine mitogen in various human cancers. Several pseudononapeptide BN-(6-14) analogs with a reduced peptide bond between positions 13 and 14 have been shown to suppress the mitogenic activity of BN or gastrin-releasing peptide (GRP) when assessed by radioreceptor or proliferation assays and may have significant clinical applications. The search for potent and safe BN antagonists requires the evaluation of a large series of analogs in radioreceptor and proliferation assays. In this paper, we report that the ability of BN analogs to inhibit BN-induced calcium transients in Swiss 3T3 cells shows a high correlation with their inhibitory potency as evaluated by classical proliferation tests. The assay of calcium transients allows a rapid characterization of new BN analogs (in terms of minutes rather than days) and can be adapted as a labor and cost-effective screening step in the selection of potentially relevant BN antagonists for further characterization in cell proliferation systems. We also observed that results from the assay of calcium transients in Swiss 3T3 cells can be correlated with the results of the proliferative response in HT-29 cells, a cell line that does not seem to use the same early transmembrane ionic signal system. This result suggests that the calcium pathway is not mandatory for triggering cell division by the BN receptor.

Olfactory neuroblastoma is a peripheral primitive neuroectodermal tumor related to Ewing sarcoma.

Olfactory neuroblastoma (ONB) is a malignant tumor of the nasal mucosa whose histogenesis is unclear. A relationship to neuroblastoma (NB), a pediatric tumor of the sympathetic nervous system, is based on morphologic similarities and the expression of similar neural antigens. However, the clinical presentation of ONB differs from that of NB, and MYCN amplification characteristic of NB is not observed. We have therefore examined the relationship of this malignancy to other classes of neural tumors. In previous studies, two ONB cell lines demonstrated cytogenetic features and patterns of protooncogene expression suggestive of a relationship to the Ewing sarcoma family of childhood peripheral primitive neuroectodermal tumors (pPNETs). The pPNETs show t(11;22)(q24;q12) or t(21;22)(q22;q12) chromosomal translocations fusing the EWS gene from 22q12 with either the FL11 gene on 11q24 or the ERG gene on 21q22. We therefore analyzed ONBs for the presence of pPNET-associated gene fusions. Both cell lines showed rearrangement of the EWS gene, and fluorescence in situ hybridization (FISH) of each case demonstrated fusion of EWS and FL11 genomic sequences. Moreover, both lines expressed EWS/FL11 fusion transcripts with in-frame junctions between exon 7 of EWS and exon 6 of FL11 as described for pPNETs. We identified similar gene fusions in four of six primary ONB cases. None of the cases expressed tyrosine hydroxylase, a catecholamine biosynthetic enzyme widely expressed in NB. Our studies indicate that ONB is not a NB but is a member of the pPNET family.

Transcriptional activation of the human proliferating-cell nuclear antigen promoter by p53.

Proliferating-cell nuclear antigen (PCNA) is a DNA damage-inducible protein that performs an essential function in DNA replication and repair as an auxiliary factor for DNA polymerases delta and epsilon. Examination of the human PCNA promoter DNA sequence revealed a site with homology to the consensus DNA sequence bound by p53. PCNA promoter fragments with this site intact bound p53 in vitro and were transcriptionally activated by wild-type p53 in transient expression assays in SAOS-2 cells. The resident p53-binding site could be functionally substituted by a previously described p53-binding site from the ribosomal gene cluster. A plasmid expressing a mutated version of p53 derived from a patient with Li-Fraumeni syndrome failed to activate the PCNA promoter in the cotransfection assay. In different cell types, activation of the PCNA promoter by the p53-binding sequence correlated with the status of p53. Activation of the PCNA promoter by wild-type p53 depends upon the level of p53 expression. This concentration dependence and cell type specificity reconciles the observations presented here with prior results indicating that wild-type p53 represses the PCNA promoter. These findings provide a mechanism whereby p53 modulates activation of PCNA expression as a cellular response to DNA damage.

Coexpression of NF-kappa B/Rel and Sp1 transcription factors in human immunodeficiency virus 1-induced, dendritic cell-T-cell syncytia.

Productive infection of T cells with human immunodeficiency virus 1 (HIV-1) typically requires that the T cells be stimulated with antigens or mitogens. This requirement has been attributed to the activation of the transcription factor NF-kappa B, which synergizes with the constitutive transcription factor Sp1 to drive the HIV-1 promoter. Recently, we have found that vigorous replication of HIV-1 takes place in nonactivated memory T cells after syncytium formation with dendritic cells (DCs). These syncytia lack activated cells as determined by an absence of staining for Ki-67 cell cycle antigen. The expression and activity of NF-kappa B and Sp1 were, therefore, analyzed in isolated T cells and DCs from humans and mice. We have used immunolabeling, Western blot analysis, and electrophoretic mobility shift and supershift assays. T cells lack active NF-kappa B but express Sp1 as expected. DCs express high levels of all known NF-kappa B and Rel proteins, with activity residing primarily within RelB, p50, and p65. However, DCs lack Sp1, which may explain the failure of HIV-1 to replicate in purified DCs. Coexpression of NF-kappa B and Sp1 occurs in the heterologous DC-T-cell syncytia that are induced by HIV-1. Therefore, HIV-1-induced cell fusion brings together factors that upregulate virus transcription. Since DCs and memory T cells frequently traffic together in situ, these unusual heterologous syncytia could develop in infected individuals and lead to chronic HIV-1 replication without ostensible immune stimulation.

Lack of functional retinoblastoma protein mediates increased resistance to antimetabolites in human sarcoma cell lines.

Growth inhibition assays indicated that the IC50 values for methotrexate (MTX) and 5-fluorodeoxyuridine (FdUrd) in HS-18, a liposarcoma cell line lacking retinoblastoma protein (pRB), and SaOS-2, an osteosarcoma cell line with a truncated and nonfunctional pRB, were 10- to 12-fold and 4- to 11-fold higher, respectively, than for the HT-1080 (fibrosarcoma) cell line, which has wild-type pRB. These Rb-/- cell lines exhibited a 2- to 4-fold increase in both dihydrofolate reductase (DHFR) and thymidylate synthase (TS) enzyme activities as well as a 3- to 4-fold increase in mRNA levels for these enzymes compared to the HT-1080 (Rb+/+) cells. This increase in expression was not due to amplification of the DHFR and TS genes. Growth inhibition by MTX and FdUrd was increased and DHFR and TS activities and expression were correspondingly decreased in Rb transfectants of SaOS-2 cells. In contrast, there was no significant difference in growth inhibition among these cell lines for the nonantimetabolites VP-16, cisplatin, and doxorubicin. A gel mobility-shift assay showed that parental SaOS-2 cells had increased levels of free E2F compared to the Rb-reconstituted SaOS-2 cells. These results indicate that pRB defective cells may have decreased sensitivity to growth inhibition by target enzymes encoded by genes whose transcription is enhanced by E2F proteins and suggest mechanisms of interaction between cytotoxic agents and genes involved in cell cycle progression.

Targeted disruption of vinculin genes in F9 and embryonic stem cells changes cell morphology, adhesion, and locomotion.

Vinculin, a major constituent of focal adhesions and zonula adherens junctions, is thought to be involved in linking the microfilaments to areas of cell-substrate and cell-cell contacts. To test the role of vinculin in cell adhesion and motility, we used homologous recombination to generate F9 embryonal carcinoma and embryonic stem cell clones homozygous for a disrupted vinculin gene. When compared to wild-type cells, vinculin-mutant cells displayed a rounder morphology and a reduced ability to adhere and spread on plastic or fibronectin. Decreased adhesion of the mutant cells was associated with a reduction in lamellipodial extensions, as observed by time-lapse video microscopy. The locomotive activities of control F9 and the vinculin-null cells were compared in two assays. Loss of vinculin resulted in a 2.4-fold increase in cell motility. These results demonstrate an important role for vinculin in determining cell shape, adhesion, surface protrusive activity, and cell locomotion.

Neoplastic development: paradoxical relation between impaired cell growth at low population density and excessive growth at high density.

The role of heritable, population-wide cell damage in neoplastic development was studied in the 28 L subline of NIH 3T3 cells. These cells differ from the 17(3c) subline used previously for such studies in their lower frequency of "spontaneous" transformation at high population density and their greater capacity to produce large, dense transformed foci. Three cultures of the 28 L subline of NIH 3T3 cells were held under the constraint of confluence for 5 wk (5 wk 1 degree assay) and then assayed twice in succession (2 degrees and 3 degrees assays) for transformed foci and saturation density. After the 2 degrees assay, the cells were also passaged at low density to determine their exponential growth rates and cloned to determine the size and morphological features of the colonies. Concurrent measurements were made in each case with control cells that had been kept only in frequent low-density passages and cells that had been kept at confluence for only 2 wk (2 wk 1 degree). Two of the three cultures transferred from the 2 degrees assay of the 5 wk 1 degree cultures produced light transformed foci, and the third produced dense foci. The light focus-forming cultures grew to twice the control saturation density in their 2 degrees assay and 6-8 times the control density in the 3 degrees assay; saturation densities for the dense focus formers were about 10 times the control values in both assays. All three of the cultures transferred from the 2 degrees assay of the 5 wk 1 degree cultures multiplied at lower rates than controls at low densities, but the dense focus formers multiplied faster than the light focus formers. The reduced rates of multiplication of the light focus formers persisted for > 50 generations of exponential multiplication at low densities. Isolated colonies formed from single cells of the light focus formers were of a lower population density than controls; colonies formed by the dense focus formers were slightly denser than the controls but occupied only half the area. A much higher proportion of the colonies from the 5 wk 1 degree cultures than the controls consisted of giant cells or mixtures of giant and normal-appearing cells. The results reinforce the previous conclusion that the early increases in saturation density and light focus formation are associated with, and perhaps caused by, heritable, population-wide damage to cells that is essentially epigenetic in nature. The more advanced transformation characterized by large increases in saturation density and dense focus formation could have originated from rare genetic changes, such as chromosome rearrangements, known to occur at an elevated frequency in cells destabilized by antecedent cellular damage.

Upregulation of class I major histocompatibility complex antigens by interferon gamma is necessary for T-cell-mediated elimination of recombinant adenovirus-infected hepatocytes in vivo.

Recombinant adenoviruses are attractive vehicles for liver-directed gene therapy because of the high efficiency with which they transfer genes to hepatocytes in vivo. First generation recombinant adenoviruses deleted of E1 sequences also express recombinant and early and late viral genes, which lead to development of destructive cellular immune responses. Previous studies indicated that class I major histocompatibility complex (MHC)-restricted cytotoxic T lymphocytes (CTLs) play a major role in eliminating virus-infected cells. The present studies utilize mouse models to evaluate the role of T-helper cells in the primary response to adenovirus-mediated gene transfer to the liver. In vivo ablation of CD4+ cells or interferon gamma (IFN-gamma) was sufficient to prevent the elimination of adenovirus-transduced hepatocytes, despite the induction of a measurable CTL response. Mobilization of an effective TH1 response as measured by in vitro proliferation assays was associated with substantial upregulation of MHC class I expression, an effect that was prevented in IFN-gamma-deficient animals. These results suggest that elimination of virus-infected hepatocytes in a primary exposure to recombinant adenovirus requires both induction of antigen-specific CTLs as well as sensitization of the target cell by TH1-mediated activation of MHC class I expression.

Overexpressed Ly-6A.2 mediates cell-cell adhesion by binding a ligand expressed on lymphoid cells.

The Ly-6 locus encodes several cell surface proteins whose functions are unknown. Although it is hypothesized that these proteins may be receptors, there is no direct evidence that they bind a ligand. Herein we present evidence that Ly-6A.2, a Ly-6 protein expressed on T lymphocytes, binds a ligand expressed on normal thymocytes and splenic B and T cells. We find that transgenic thymocytes that overexpress Ly-6A.2 spontaneously aggregate in culture. This homotypic adhesion requires the overexpression of Ly-6A.2 because it is not observed in cultures of nontransgenic thymocytes. The aggregation of Ly-6A.2 transgenic thymocytes is inhibited by phosphatidylinositol-specific phospholipase C (which removes Ly-6A.2 and other glycosylphosphatidylinositol-anchored proteins from the membrane). Some anti-Ly-6A.2 monoclonal antibodies, including nonactivating ones and Fab' fragments, inhibit this aggregation. In contrast, other anti-Ly-6A.2 monoclonal antibodies increase the aggregation of transgenic but not nontransgenic thymocytes. To further examine whether Ly-6A.2 mediates adhesion (versus inducing another adhesion pathway) reaggregation assays were performed with paraformaldehyde-fixed Tg+ thymocytes. Paraformaldehyde-fixed Tg+ thymocytes reaggregate in culture and this aggregation is also blocked by phosphatidyl-inositol-specific phospholipase C and anti-Ly-6A.2 monoclonal antibodies. These results indicate that the homotypic adhesion of cultured Ly-6A.2 transgenic thymocytes is directly mediated by Ly-6A.2 and, more importantly, strongly suggests that Ly-6A.2 binds a ligand that is expressed on thymocytes. Tg+ thymocytes also bind to nontransgenic thymocytes, B cells, and T cells, indicating that normal cells naturally express the Ly-6A.2 ligand.

Induction of the gene encoding mucosal vascular addressin cell adhesion molecule 1 by tumor necrosis factor alpha is mediated by NF-kappa B proteins.

Mucosal vascular addressin cell adhesion molecule 1 (MAdCAM-1) is involved in trafficking of lymphocytes to mucosal endothelium. Expression of MAdCAM-1 is induced in the murine endothelial cell line bEnd.3 by tumor necrosis factor alpha (TNF-alpha), interleukin 1, and bacterial lipopolysaccharide. Here we show that TNF-alpha enhances expression of a firefly luciferase reporter directed by the MAdCAM-1 promoter, confirming transcriptional regulation of MAdCAM-1. Mutational analysis of the promoter indicates that a DNA fragment extending from nt -132 to nt +6 of the gene is sufficient for TNF-alpha inducibility. Two regulatory sites critical for TNF-alpha induction were identified in this region. DNA-binding experiments demonstrate that NF-kappa B proteins from nuclear extracts of TNF-alpha-stimulated bEnd.3 cells bind to these sites, and transfection assays with promoter mutants of the MAdCAM-1 gene indicate that occupancy of both sites is essential for promoter function. The predominant NF-kappa B binding activity detected with these nuclear extracts is a p65 homodimer. These findings establish that, as with other endothelial cell adhesion molecules, transcriptional induction of MAdCAM-1 by TNF-alpha requires activated NF-kappa B proteins.

A regulatory element in the promoter of the human granulocyte-macrophage colony-stimulating factor gene that has related sequences in other T-cell-expressed cytokine genes.

Granulocyte-macrophage colony-stimulating factor (GM-CSF) is a cytokine with a broad spectrum of cell-differentiating and colony-stimulating activities. It is expressed by several undifferentiated (bone marrow stromal cells, fibroblasts) and fully differentiated (T cells, macrophages, and endothelial cells) cells. Its expression in T cells is activation dependent. We have found a regulatory element in the promoter of the GM-CSF gene which contains two symmetrically nested inverted repeats (-192 CTTGGAAAGGTTCATTAATGAAAACCCCCAAG -161). In transfection assays with the human GM-CSF promoter, this element has a strong positive effect on the expression of a reporter gene by the human T-cell line Jurkat J6 upon stimulation with phorbol dibutyrate and ionomycin or anti-CD3 antibody. This element also acts as an enhancer when inserted into a minimal promoter vector. In DNA band-retardation assays this sequence produces six specific bands that involve one or the other of the inverted repeats. We have also shown that a DNA-protein complex can be formed involving both repeats and probably more than one protein. The external inverted repeat contains a core sequence CTTGG...CCAAG, which is also present in the promoters of several other T-cell-expressed human cytokines (interleukins 4, 5, and 13). The corresponding elements in GM-CSF and interleukin 5 promoters compete for the same proteins in band-retardation assays. The palindromic elements in these genes are larger than the core sequence, suggesting that some of the interacting proteins may be different for different genes. Considering the strong positive regulatory effect and their presence in several T-cell-expressed cytokine genes, these elements may be involved in the coordinated expression of these cytokines in T-helper cells.

Establishing a Robust In Vitro Embryonic Stem Cell Differentiation Assay to Monitor the Hematopoietic Potential of DELES Clones

Afin d’effectuer des études fonctionnelles sur le génome de la souris, notre laboratoire a généré une bibliothèque de clones de cellules souches embryonnaires (ESC) présentant des suppressions chromosomiques chevauchantes aléatoires – la bibliothèque DELES. Cette bibliothèque contient des délétions couvrant environ 25% du génome murin. Dans le laboratoire, nous comptons identifier de nouveaux déterminants du destin des cellules hématopoïétiques en utilisant cet outil. Un crible primaire utilisant la benzidine pour démontrer la présence d'hémoglobine dans des corps embryoïdes (EBS) a permis d’identifier plusieurs clones délétés présentant un phénotype hématopoïétique anormal. Comme cet essai ne vérifie que la présence d'hémoglobine, le but de mon projet est d'établir un essai in vitro de différenciation des ESC permettant de mesurer le potentiel hématopoïétique de clones DELES. Mon hypothèse est que l’essai de différenciation hématopoïétique publié par le Dr Keller peut être importé dans notre laboratoire et utilisé pour étudier l'engagement hématopoïétique des clones DELES. À l’aide d’essais de RT-QPCR et de FACS, j’ai pu contrôler la cinétique de différenciation hématopoïétique en suivant l’expression des gènes hématopoïétiques et des marqueurs de surface comme CD41, c-kit, RUNX1, GATA2, CD45, β-globine 1 et TER-119. Cet essai sera utilisé pour valider le potentiel hématopoïétique des clones DELES candidats identifiés dans le crible principal. Mon projet secondaire vise à utiliser la même stratégie rétro-virale a base de Cre-loxP utilisée pour générer la bibliothèque DELES pour générer une bibliothèque de cellules KBM-7 contenant des suppressions chromosomiques chevauchantes. Mon but ici est de tester si la lignée cellulaire leuémique humaine presque haploïde KBM-7 peut être exploitée en utilisant l'approche DELES pour créer cette bibliothèque. La bibliothèque de clones KBM-7 servira à définir les activités moléculaires de drogues anti-leucémiques potentielless que nous avons identifiées dans le laboratoire parce qu’elles inhibent la croissance cellulaire dans plusieurs échantillons de leucémie myéloïde aiguë dérivés de patients. Elle me permettra également d'identifier les voies de signalisation moléculaires qui, lorsque génétiquement perturbées, peuvent conférer une résistance à ces drogues.

Multiple regulatory variants located in cell type-specific enhancers within the PKP2 locus form major risk and protective haplotypes for canine atopic dermatitis in German shepherd dogs.

BACKGROUND Canine atopic dermatitis (CAD) is a chronic inflammatory skin disease triggered by allergic reactions involving IgE antibodies directed towards environmental allergens. We previously identified a ~1.5 Mb locus on canine chromosome 27 associated with CAD in German shepherd dogs (GSDs). Fine-mapping indicated association closest to the PKP2 gene encoding plakophilin 2. RESULTS Additional genotyping and association analyses in GSDs combined with control dogs from five breeds with low-risk for CAD revealed the top SNP 27:19,086,778 (p = 1.4 × 10(-7)) and a rare ~48 kb risk haplotype overlapping the PKP2 gene and shared only with other high-risk CAD breeds. We selected altogether nine SNPs (four top-associated in GSDs and five within the ~48 kb risk haplotype) that spanned ~280 kb forming one risk haplotype carried by 35 % of the GSD cases and 10 % of the GSD controls (OR = 5.1, p = 5.9 × 10(-5)), and another haplotype present in 85 % of the GSD cases and 98 % of the GSD controls and conferring a protective effect against CAD in GSDs (OR = 0.14, p = 0.0032). Eight of these SNPs were analyzed for transcriptional regulation using reporter assays where all tested regions exerted regulatory effects on transcription in epithelial and/or immune cell lines, and seven SNPs showed allelic differences. The DNA fragment with the top-associated SNP 27:19,086,778 displayed the highest activity in keratinocytes with 11-fold induction of transcription by the risk allele versus 8-fold by the control allele (pdifference = 0.003), and also mapped close (~3 kb) to an ENCODE skin-specific enhancer region. CONCLUSIONS Our experiments indicate that multiple CAD-associated genetic variants located in cell type-specific enhancers are involved in gene regulation in different cells and tissues. No single causative variant alone, but rather multiple variants combined in a risk haplotype likely contribute to an altered expression of the PKP2 gene, and possibly nearby genes, in immune and epithelial cells, and predispose GSDs to CAD.

Statistical Hurdle Models for Single Cell Gene Expression: Differential Expression and Graphical Modeling

Thesis (Ph.D.)--University of Washington, 2016-06