987 resultados para Interferon-gamma -- immunology


Relevância:

80.00% 80.00%

Publicador:

Resumo:

BACKGROUND: Migration is one of the major causes of tuberculosis in developed countries. Undocumented patients are usually not screened at the border and are not covered by a health insurance increasing their risk of developing the disease unnoticed. Urban health centres could help identify this population at risk. The objective of this study is to assess the prevalence of latent tuberculosis infection (LTBI) and adherence to preventive treatment in a population of undocumented immigrant patients. METHODS: All consecutive undocumented patients that visited two urban healthcare centres for vulnerable populations in Lausanne, Switzerland for the first time were offered tuberculosis screening with an interferon-gamma assay. Preventive treatment was offered if indicated. Adherence to treatment was evaluated monthly over a nine month period. RESULTS: Of the 161 participants, 131 (81.4%) agreed to screening and 125 had complete examinations. Twenty-four of the 125 patients (19.2%; CI95% 12.7;27.2) had positive interferon-gamma assay results, two of which had active tuberculosis. Only five patients with LTBI completed full preventive treatments. Five others initiated the treatment but did not follow through. CONCLUSION: Screening for tuberculosis infection in this hard-to-reach population is feasible in dedicated urban clinics, and the prevalence of LTBI is high in this vulnerable population. However, the low adherence to treatment is an important public health concern, and new strategies are needed to address this problem.

Relevância:

80.00% 80.00%

Publicador:

Resumo:

Chronic inhalation of grain dust is associated with asthma and chronic bronchitis in grain worker populations. Exposure to fungal particles was postulated to be an important etiologic agent of these pathologies. Fusarium species frequently colonize grain and straw and produce a wide array of mycotoxins that impact human health, necessitating an evaluation of risk exposure by inhalation of Fusarium and its consequences on immune responses. Data showed that Fusarium culmorum is a frequent constituent of aerosols sampled during wheat harvesting in the Vaud region of Switzerland. The aim of this study was to examine cytokine/chemokine responses and innate immune sensing of F. culmorum in bone-marrow-derived dendritic cells and macrophages. Overall, dendritic cells and macrophages responded to F. culmorum spores but not to its secreted components (i.e., mycotoxins) by releasing large amounts of macrophage inflammatory protein (MIP)-1α, MIP-1β, MIP-2, monocyte chemoattractant protein (MCP)-1, RANTES, and interleukin (IL)-12p40, intermediate amounts of tumor necrosis factor (TNF), IL-6, IL-12p70, IL-33, granulocyte colony-stimulating factor (G-CSF), and interferon gamma-induced protein (IP-10), but no detectable amounts of IL-4 and IL-10, a pattern of mediators compatible with generation of Th1 or Th17 antifungal protective immune responses rather than with Th2-dependent allergic responses. The sensing of F. culmorum spores by dendritic cells required dectin-1, the main pattern recognition receptor involved in β-glucans detection, but likely not MyD88 and TRIF-dependent Toll-like receptors. Taken together, our results indicate that F. culmorum stimulates potently innate immune cells in a dectin-1-dependent manner, suggesting that inhalation of F. culmorum from grain dust may promote immune-related airway diseases in exposed worker populations.

Relevância:

80.00% 80.00%

Publicador:

Resumo:

Nitric oxide (NO) has been shown to exert cytotoxic effects on tumor cells. We have reported that EC219 cells, a rat-brain-microvessel-derived endothelial cell line, produced NO through cytokine-inducible NO synthase (iNOS), the induction of which was significantly decreased by (a) soluble factor(s) secreted by DHD/PROb, an invasive sub-clone of a rat colon-carcinoma cell line. In this study, the DHD/PROb cell-derived NO-inhibitory factor was characterized. Northern-blot analysis demonstrated that the induction of iNOS mRNA in cytokine-activated EC219 cells was decreased by PROb-cell-conditioned medium. When DHD/PROb cell supernatant was fractionated by affinity chromatography using Con A-Sepharose or heparin-Sepharose, the NO-inhibitory activity was found only in Con A-unbound or heparin-unbound fractions, respectively, indicating that the PROb-derived inhibitory factor was likely to be a non-glycosylated and non-heparin-binding molecule. Pre-incubation of DHD/PROb-cell supernatant with anti-TGF-beta neutralizing antibody completely blocked the DHD/PROb-derived inhibition of NO production by EC219 cells. Addition of exogenous TGF-beta 1 dose-dependently inhibited NO release by EC219 cells. The presence of active TGF-beta in the DHD/PROb cell supernatant was demonstrated using a growth-inhibition assay. Moreover, heat treatment of medium conditioned by the less invasive DHD/REGb cells, which constitutively secreted very low levels of active TGF-beta, increased both TGF-beta activity and the ability to inhibit NO production in EC219 cells. Thus, DHD/PROb colon-carcinoma cells inhibited NO production in EC219 cells by secreting a factor identical or very similar to TGF-beta.

Relevância:

80.00% 80.00%

Publicador:

Resumo:

Atopic, IgE-mediated allergies are one of the major public health problems in Finland and other Western countries. These diseases are characterized by type 2 T helper (Th2) cell predominated immune responses (interleukin-4 (IL-4), IL-5) against ubiquitous environmental allergens. Despite of adequate pharmacological treatment, more than 20% of the patients with allergic rhinitis develop asthma. Allergen specific immunotherapy (SIT) is the only treatment currently available to affect to the natural course of allergic diseases. This treatment involves repeated administration of allergens to the patients either via sublingual route (sublingual immunotherapy, SLIT) or by subcutaneous injections (subcutaneous immunotherapy, SCIT). Successful treatment with SCIT or SLIT has been shown to provide long-term remission in symptoms, and prevent disease progression to asthma, but the immunological mechanisms behind these beneficial effects are not yet completely understood. Increased knowledge of such mechanisms could not only help to improve SIT efficacy, but also provide tools to monitor the development of clinical response to SIT in individual patients, and possibly also, predict the ultimate therapeutic outcome. The aim of this work was to clarify the immunological mechanisms associated with SIT by investigating the specific allergen-induced immune responses in peripheral blood mononuclear cells (PBMC) of allergic rhinitis patients during the course of SLIT and SCIT. The results of this work demonstrate that both therapies induced increases in the protective, Th2-balancing Th1 type immune responses in PBMC, e.g. by up-regulating signaling lymphocytic activation molecule (SLAM) and interferon gamma (IFN-γ) expression, and augmented tolerogenic T regulatory (Treg) cell type responses against the specific allergens, e.g. by increasing IL-10 or Forkhead box P3 (FOXP3) expression. The induction of allergen-specific Th1 and Treg type responses during SLIT were dependent on the treatment dose, favoring high allergen dose SLIT. During SCIT, the early decrease in Th2 type cytokine production - in particular of IL-4 mRNA and IL-4/IFN-γ expression ratio - was associated with the development of good therapeutic outcome. Conversely, increases in both Th2 (IL-5) and Th1 (IFN-γ, SLAM) type responses and IL-10 mRNA production were seen in the patients with less effective outcome. In addition, increase in Th17 type cytokine (IL-17) mRNA production was found in the PBMC of patients with less effective outcome during both SLIT and SCIT. These data strengthen the current hypothesis that immunomodulation of allergen-specific immune responses from the prevailing Th2-biased responses towards a more Th1 type, and induction of tolerogenic Treg cells producing IL-10 represent the two key mechanisms behind the beneficial effects of SIT. The data also give novel insight into the mechanisms why SIT may fail to be effective in some patients by demonstrating a positive correlation between the proinflammatory IL-17 responses, Th2 type IL-5 production and clinical symptoms. Taken together, these data indicate that the analysis of Th1, Th2, Treg ja Th17-associated immune markers such as IL-10, SLAM, IL-4, IL-5 and IL-17 could provide tools to monitor the development of clinical response to SIT, and thereby, predict the ultimate clinical outcome already in the early course of the treatment.

Relevância:

80.00% 80.00%

Publicador:

Resumo:

Resistance to Trypanosoma cruzi infections is critically dependent on cytokine-mediated activation of cell-mediated immune effector mechanisms. This review focuses on the role of IL-10, TNF-a, IFN-g and IL-12 in controlling T. cruzi replication by the innate and specific immune systems of the vertebrate host. A study performed on mice with disrupted recombinase-activating genes (RAG/KO), which lack T and B lymphocytes, revealed the importance of IL-12, IFN-g and TNF-a in the resistance against T. cruzi mediated by the innate immune system. In addition, data from experiments using IL-10 KO, RAG/KO and double RAG/IL-10 KO mice indicating an in vivo regulatory role of IL-10 in innate and T. cruzi-specific immunity are discussed

Relevância:

80.00% 80.00%

Publicador:

Resumo:

It has been shown that HLA class I molecules play a significant role in the regulation of the proliferation of T cells activated by mitogens and antigens. We evaluated the ability of mAb to a framework determinant of HLA class I molecules to regulate T cell proliferation and interferon gamma (IFN-g) production against leishmania, PPD, C. albicans and tetanus toxoid antigens in patients with tegumentary leishmaniasis and healthy subjects. The anti-major histocompatibility complex (MHC) mAb (W6/32) suppressed lymphocyte proliferation by 90% in cultures stimulated with aCD3, but the suppression was variable in cultures stimulated with leishmania antigen. This suppression ranged from 30-67% and was observed only in 5 of 11 patients. IFN-g production against leishmania antigen was also suppressed by anti-HLA class I mAb. In 3 patients IFN-g levels were suppressed by more than 60%, while in the other 2 cultures IFN-g levels were 36 and 10% lower than controls. The suppression by HLA class I mAb to the proliferative response in leishmaniasis patients and in healthy controls varied with the antigens and the patients or donors tested. To determine whether the suppression is directed at antigen presenting cells (APCs) or at the responding T cells, experiments with antigen-primed non-adherent cells, separately incubated with W6/32, were performed. Suppression of proliferation was only observed when the W6/32 mAb was added in the presence of T cells. These data provide evidence that a mAb directed at HLA class I framework determinants can suppress proliferation and cytokine secretion in response to several antigens.

Relevância:

80.00% 80.00%

Publicador:

Resumo:

Although the role of interleukin-2 (IL-2) and interferon gamma (gIFN) is still poorly understood in hyperthyroid diseases, it is reasonable to assume that these cytokines may be present at higher levels in Graves' disease (GD) than in other primarily non-autoimmune thyroid diseases. In order to look for an easy method to distinguish GD from primarily non-autoimmune causes of hyperthyroidism, we compared 13 healthy individuals with 21 treated and untreated hyperthyroid GD patients and with 19 patients with hyperthyroidism due to other etiologies: 7 cases of multinodular goiter, 5 cases of excessive hormone replacement and 7 cases of amiodarone-associated hyperthyroidism. All patients presented low TSH levels and a dubious clinical thyroid state. We found a good correlation between TSH and serum IL-2 levels (r = 0.56; P<0.01). Serum IL-2 (P<0.01) and gIFN (P<0.01) levels were lower in the hyperthyroid group of patients than in control subjects, suggesting a depressed TH1 pattern in the T-cell subset of hyperthyroid patients. GD had normal IL-2 levels, while patients with other forms of thyrotoxicosis presented decreased IL-2 levels (P<0.05). There was no difference between treated and untreated GD patients. We suggest that the direct measurement of serum IL-2 level may help to confirm hyperthyroidism caused by GD.

Relevância:

80.00% 80.00%

Publicador:

Resumo:

The gut mucosa is a major site of contact with antigens from food and microbiota. Usually, these daily contacts with natural antigens do not result in inflammatory reactions; instead they result in a state of systemic hyporesponsiveness named oral tolerance. Inflammatory bowel diseases (IBD) are associated with the breakdown of the immunoregulatory mechanisms that maintain oral tolerance. Several animal models of IBD/colitis are available. In mice, these include targeted disruptions of the genes encoding cytokines, T cell subsets or signaling proteins. Colitis can also be induced by intrarectal administration of chemical substances such as 2,4,6-trinitrobenzene sulfonic acid in 50% ethanol. We report here a novel model of colitis induced by intrarectal administration of 50% ethanol alone. Ethanol-treated mice develop an inflammatory reaction in the colon characterized by an intense inflammatory infiltrate in the mucosa and submucosa of the large intestine. They also present up-regulation of both interferon gamma (IFN-gamma) and interleukin-4 (IL-4) production by cecal lymph node and splenic cells. These results suggest a mixed type of inflammation as the substrate of the colitis. Interestingly, cells from mesenteric lymph nodes of ethanol-treated mice present an increase in IFN-gamma production and a decrease in IL-4 production indicating that the cytokine balance is altered throughout the gut mucosa. Moreover, induction of oral tolerance to ovalbumin is abolished in these animals, strongly suggesting that ethanol-induced colitis interferes with immunoregulatory mechanisms in the intestinal mucosa. This novel model of colitis resembles human IBD. It is easy to reproduce and may help us to understand the mechanisms involved in IBD pathogenesis.

Relevância:

80.00% 80.00%

Publicador:

Resumo:

Induced oral tolerance to mucosal-exposed antigens in immunized animals is of particular interest for the development of immunotherapeutic approaches to human allergic diseases. This is a unique feature of mucosal surfaces which represent the main contact interface with the external environment. However, the influence of oral tolerance on specific and natural polyreactive IgA antibodies, the major defense mechanism of the mucosa, is unknown. We have shown that oral administration of an extract of the dust mite Dermatophagoides pteronyssinus (Dp) to primed mice caused down-regulation of IgE responses and an increase in tumor growth factor-ß secretion. In the present study, we observed that primed inbred female A/Sn mice (8 to 10 weeks old) fed by gavage a total weight of 1.0-mg Dp extract on the 6th, 7th and 8th days post-immunization presented normal secretion of IL-4 and IL-10 in gut-associated lymphoid tissue and a decreased production of interferon gamma induced by Dp in the draining lymph nodes (13,340 ± 3,519 vs 29,280 ± 2,971 pg/ml). Mice fed the Dp extract also showed higher levels of serum anti-Dp IgA antibodies and an increase of IgA-secreting cells in mesenteric lymph nodes (N = 10), reflecting an increase in total fecal IgA antibodies (N = 10). The levels of secretory anti-Dp IgA antibodies increased after re-immunization regardless of Dp extract feeding. Oral tolerance did not interfere with serum or secretory IgA antibody reactivity related to self and non-self antigens. These results suggest that induction of oral tolerance to a Dp extract in sensitized mice triggered different regulatory mechanisms which inhibited the IgE response and stimulated systemic and secretory IgA responses, preserving the natural polyreactive IgA antibody production.

Relevância:

80.00% 80.00%

Publicador:

Resumo:

Several primary immunodeficiency diseases affecting the interleukin 12/interferon gamma (IFN-gamma) pathway have been identified, most of them characterized by recurrent and protracted infections produced by intracellular microorganisms, particularly by several species of mycobacteria. In the present study we analyzed the expression of IFN-gamma receptor (IFN-gammaR) and signal transducer and activator of transcription 1 (STAT-1) in 4 children with Mycobacterium tuberculosis infection of uncommon clinical presentation. These molecules were evaluated by flow cytometry and Western blotting in B cells transformed with Epstein-Barr virus and mutations were scanned by single-strand conformational polymorphisms and DNA sequencing. The expression of IFN-gammaR1 was normal in all 4 patients. The genetic analysis of IFN-gammaR1 and IFN-gammaR2 coding sequences did not reveal any mutation. The expression of the STAT-1 molecule was similar in patients and healthy controls; however, when the phosphorylation of this transcription factor in response to IFN-gamma activation was evaluated by Western blot, a significant lower signal was evident in one patient. These data indicate that there are no alterations in the expression or function of the IFN-gammaR chains in these patients. However, the low level of STAT-1 phosphorylation found in one of these patients might be explained by a defect in one of the molecules involved in the signal transduction pathway after IFN-gamma interacts with its receptor. In the other three patients the inability to eliminate the mycobacteria may be due to a defect in another effector mechanism of the mononuclear phagocytes.

Relevância:

80.00% 80.00%

Publicador:

Resumo:

Wheezing associated with respiratory viral infections in infancy is very common and results in high morbidity worldwide. The Th1/Th2 pattern of immune response in these patients remains unclear and previous studies have shown controversial results. The aim of the present study was to compare the type of Th1/Th2 cytokine response between infants with acute bronchiolitis, recurrent wheezing and upper respiratory infections from a developing country. Infants younger than 2 years of age admitted to Hospital São Lucas, Porto Alegre, RS, Brazil, between May and November 2001, with an acute episode of wheezing associated with viral respiratory infection were selected. Subjects with upper respiratory infections from the emergency department were selected for the control group. Interferon-gamma (IFN-gamma) and interleukin-4 (IL-4) levels from nasal aspirates were determined by ELISA from peripheral mononuclear cell cultures. Twenty-nine subjects with acute bronchiolitis, 18 with recurrent wheezing and 15 with upper respiratory infections were enrolled. There were no differences in family history of atopy or parental smoking between groups. Oxygen requirement was similar for the acute bronchiolitis and recurrent wheezing groups. The percentage of positive tests for the cytokines studied and the IFN-gamma/IL-4 ratio was similar for all groups. Comparison of the polarized Th1/Th2 cytokine results for the various groups showed no specific pattern of cytokine production. Infants with wheezing from a developing country do not show any specific predominant pattern of Th1/Th2 cytokine production, suggesting that multiple factors may be involved in the pathogenesis of this illness.

Relevância:

80.00% 80.00%

Publicador:

Resumo:

Susceptibility to experimental autoimmune uveitis (EAU) in inbred mice has been associated with a dominant Th1 response. Elevated anti-inter-photoreceptor retinoid-binding protein (anti-IRBP) IgG2a/IgG1 antibody ratios have been implicated as candidate markers to predict disease severity. In the present study, both the anti-IRBP antibody isotype and severity of EAU phenotypes were examined in 4 non-isogenic genetically selected mouse lines to determine if they can be used as general markers of disease. Mice between 8 and 12 weeks old selected for high (H III) or low (L III) antibody response and for maximum (AIR MAX) or minimum (AIR MIN) acute inflammatory reaction (AIR) were immunized with IRBP. Each experiment was performed with at least 5 mice per group. EAU was evaluated by histopathology 21 days after immunization and the minimal criterion was inflammatory cell infiltration of the ciliary body, choroid and retina. Serum IgG1- and IgG2a-specific antibodies were determined by ELISA. EAU was graded by histological examination of the enucleated eyes. The incidence of EAU was lower in AIR MIN mice whereas in the other strains approximately 40% of the animals developed the disease. Low responder animals did not produce anti-IRBP IgG2a antibodies or interferon-gamma. No correlation was observed between susceptibility to EAU and anti-IRBP isotype profiles. Susceptibility to EAU is related to the intrinsic capacity to mount higher inflammatory reactions and increased production of anti-IRBP IgG2a isotype is not necessarily a marker of this immunologic profile.

Relevância:

80.00% 80.00%

Publicador:

Resumo:

Our objective was to determine lipid peroxidation and nuclear factor-κB (NF-κB) activation in skeletal muscle and the plasma cytokine profile following maximum progressive swimming. Adult male Swiss mice (N = 15) adapted to the aquatic environment were randomly divided into three groups: immediately after exercise (EX1), 3 h after exercise (EX2) and control. Animals from the exercising groups swam until exhaustion, with an initial workload of 2% of body mass attached to the tail. Control mice did not perform any exercise but were kept immersed in water for 20 min. Maximum swimming led to reactive oxygen species (ROS) generation in skeletal muscle, as indicated by increased thiobarbituric acid reactive species (TBARS) levels (4062.67 ±1487.10 vs 19,072.48 ± 8738.16 nmol malondialdehyde (MDA)/mg protein, control vs EX1). Exercise also promoted NF-κB activation in soleus muscle. Cytokine secretion following exercise was marked by increased plasma interleukin-6 (IL-6) levels 3 h post-exercise (P < 0.05). Interleukin-10 (IL-10) levels were reduced following exercise and remained reduced 3 h post-exercise (P < 0.05). Plasma levels of other cytokines investigated, monocyte chemotactic protein-1 (MCP-1), tumor necrosis factor-alpha (TNF-α), interferon-gamma (IFN-γ) and interleukin-12 (IL-12), were not altered by exercise. The present findings showed that maximum swimming, as well as other exercise models, led to lipid peroxidation and NF-κB activation in skeletal muscle and increased plasma IL-6 levels. The plasma cytokine response was also marked by reduced IL-10 levels. These results were attributed to exercise type and intensity.

Relevância:

80.00% 80.00%

Publicador:

Resumo:

The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.

Relevância:

80.00% 80.00%

Publicador:

Resumo:

Vitamin D metabolites are important in the regulation of bone and calcium homeostasis, but also have a more ubiquitous role in the regulation of cell differentiation and immune function. Severely low circulating 25-dihydroxyvitamin D [25(OH)D] concentrations have been associated with the onset of active tuberculosis (TB) in immigrant populations, although the association with latent TB infection (LTBI) has not received much attention. A previous study identified the prevalence of LTBI among a sample of Mexican migrant workers enrolled in Canada's Seasonal Agricultural Workers Program (SA WP) in the Niagara Region of Ontario. The aim of the present study was to determine the vitamin D status of the same sample, and identify if a relationship existed with LTBI. Studies of vitamin D deficiency and active TB are most commonly carried out among immigrant populations to non-endemic regions, in which reactivation of LTBI has occurred. Currently, there is limited knowledge of the association between vitamin D deficiency and LTBI. Entry into Canada ensured that these individuals did not have active TB, and L TBI status was established previously by an interferon-gamma release assay (IGRA) (QuantiFERON-TB Gold In-Tube®, Cellestis Ltd., Australia). Awareness of vitamin D status may enable individuals at risk of deficiency to improve their nutritional health, and those with LTBI to be aware of this risk factor for disease. Prevalence of vitamin D insufficiency among the Mexican migrant workers was determined from serum samples collected in the summer of 2007 as part of the cross sectional LTBI study. Samples were measured for concentrations of the main circulating vitamin D metabolite, 25(OH)D, with a widely used 1251 250HD RIA (DiaSorin Inc.®, Stillwater, MN), and were categorized as deficient «37.5 nmoI/L), insufficient (>37.5 nmollL, < 80 nmol/L) or sufficient (2::80 nmoI/L). Fisher's exact tests and t tests were used to determine if vitamin D status (sufficiency or insufficiency) or 25(OH)D concentrations significantly differed by sex or age categories. Predictors of vitamin D insufficiency and 25(OH)D concentrations were taken from questionnaires carried out during the previous study, and analyzed in the present study using multiple regression prediction models. Fisher's exact test and t test was used to determine if vitamin D status or 25(OH)D concentration differed by LTBI status. Strength of the relationship between interferongamma (IFN-y) concentration (released by peripheral T cells in response to TB antigens) and 25(OH)D concentration was analyzed using a Spearman correlation. Out of 87 participants included in the study (78% male; mean age 38 years), 14 were identified as LTBI positive but none had any signs or symptoms of TB reactivation. Only 30% of the participants were vitamin D sufficient, whereas 68% were insufficient and 2% were deficient. Significant independent predictors of lower 25(OH)D concentrations were sex, number of years enrolled in the SA WP and length of stay in Canada. No significant differences were found between 25(OH)D concentrations and LTBI status. There was a significant moderate correlation between IFN-y and 25(OH)D concentrations ofLTBI-positive individuals. The majority of participants presented with Vitamin D insufficiency but none were severely deficient, indicating that 25(OH)D concentrations do not decrease dramatically in populations who temporarily reside in Canada but go back to their countries of origin during the Canadian winter. This study did not find a statistical relationship between low levels of vitamin D and LTBI which suggests that in the presence of overall good health, lower than ideal levels of 2S(OH)D, may still be exerting a protective immunological effect against LTBI reactivation. The challenge remains to determine a critical 2S(OH)D concentration at which reactivation is more likely to occur.