974 resultados para IRON-REGULATORY PROTEINS


Relevância:

30.00% 30.00%

Publicador:

Resumo:

cAMP-response element binding (CREB) proteins are involved in transcriptional regulation in a number of cellular processes (e.g., neural plasticity and circadian rhythms). The CREB family contains activators and repressors that may interact through positive and negative feedback loops. These loops can be generated by auto- and cross-regulation of expression of CREB proteins, via CRE elements in or near their genes. Experiments suggest that such feedback loops may operate in several systems (e.g., Aplysia and rat). To understand the functional implications of such feedback loops, which are interlocked via cross-regulation of transcription, a minimal model with a positive and negative loop was developed and investigated using bifurcation analysis. Bifurcation analysis revealed diverse nonlinear dynamics (e.g., bistability and oscillations). The stability of steady states or oscillations could be changed by time delays in the synthesis of the activator (CREB1) or the repressor (CREB2). Investigation of stochastic fluctuations due to small numbers of molecules of CREB1 and CREB2 revealed a bimodal distribution of CREB molecules in the bistability region. The robustness of the stable HIGH and LOW states of CREB expression to stochastic noise differs, and a critical number of molecules was required to sustain the HIGH state for days or longer. Increasing positive feedback or decreasing negative feedback also increased the lifetime of the HIGH state, and persistence of this state may correlate with long-term memory formation. A critical number of molecules was also required to sustain robust oscillations of CREB expression. If a steady state was near a deterministic Hopf bifurcation point, stochastic resonance could induce oscillations. This comparative analysis of deterministic and stochastic dynamics not only provides insights into the possible dynamics of CREB regulatory motifs, but also demonstrates a framework for understanding other regulatory processes with similar network architecture.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Chondrocyte gene regulation is important for the generation and maintenance of cartilage tissues. Several regulatory factors have been identified that play a role in chondrogenesis, including the positive transacting factors of the SOX family such as SOX9, SOX5, and SOX6, as well as negative transacting factors such as C/EBP and delta EF1. However, a complete understanding of the intricate regulatory network that governs the tissue-specific expression of cartilage genes is not yet available. We have taken a computational approach to identify cis-regulatory, transcription factor (TF) binding motifs in a set of cartilage characteristic genes to better define the transcriptional regulatory networks that regulate chondrogenesis. Our computational methods have identified several TFs, whose binding profiles are available in the TRANSFAC database, as important to chondrogenesis. In addition, a cartilage-specific SOX-binding profile was constructed and used to identify both known, and novel, functional paired SOX-binding motifs in chondrocyte genes. Using DNA pattern-recognition algorithms, we have also identified cis-regulatory elements for unknown TFs. We have validated our computational predictions through mutational analyses in cell transfection experiments. One novel regulatory motif, N1, found at high frequency in the COL2A1 promoter, was found to bind to chondrocyte nuclear proteins. Mutational analyses suggest that this motif binds a repressive factor that regulates basal levels of the COL2A1 promoter.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Numerous proteins in intracellular signaling pathways are known to be covalently modified by long chain fatty acids. The objective of this project was to identify potentially novel components of the protein kinase C signaling pathway by virtue of their fatty acylation. A 64 kDa palmitoylated protein (p64) was identified that became deacylated following stimulation of quiescent cells with serum, FGF, or PDBu, suggesting that stimulus-dependent deacylation might alter interactions between p64 and other membrane/cytoskeletal components. A myristoylated protein of 68 kDa observed during these studies was identified as the "80K" PKC substrate. This protein was acylated cotranslationally with myristate through an amide linkage. The majority of the 80K protein was tightly associated with the plasma membrane, with approximately 20% in the cytosol. Although phosphorylation of the membrane-bound and soluble forms of the protein was increased 6-fold in response to PDBu, no changes in the subcellular distribution or myristoylation of the protein were observed. A cDNA encoding the murine form of this protein was cloned, and its deduced amino acid sequence revealed the presence of an N-terminal myristoylation consensus and five potential sites for phosphorylation by PKC. A mutant in which the N-terminal glycine residue was changed to alanine was no longer a substrate for NMT and consequently lost its membrane-binding potential. However, its ability to be phosphorylated in response to purified growth factors and phorbol esters was unimpaired. These results indicate that the myristoylated N-terminus of the 80K protein is required for its association with the plasma membrane, and that the cytoplasmic form of the protein can be phosphorylated independently of the membrane-bound form. Mutants of PKC were constructed in which the regulatory domain was removed and replaced by the N-terminus of the 80K or Al proteins. Unexpectedly, both the myristoylated and nonmyristoylated fusion proteins were tightly associated with the nuclear envelope. Further deletion analyses mapped nuclear targeting signals to the hinge region and a portion of the catalytic domain of PKC, explaining the ability of PKC to be translocated to the nucleus in response to certain stimuli. ^

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Bacillus anthracis plasmid pXO1 carries genes for three anthrax toxin proteins, pag (protective antigen), cya (edema factor), and lef (lethal factor). Expression of the toxin genes is enhanced by two signals: CO$\sb2$/bicarbonate and temperature. The CO$\sb2$/bicarbonate effect requires the presence of pXO1. I hypothesized that pXO1 harbors a trans-acting regulatory gene(s) required for CO$\sb2$/bicarbonate-enhanced expression of the toxin genes. Characterization of such a gene(s) will lead to increased understanding of the mechanisms by which B. anthracis senses and responds to host environments.^ A regulatory gene (atxA) on pXO1 was identified. Transcription of all three toxin genes is decreased in an atxA-null mutant. There are two transcriptional start sites for pag. Transcription from the major site, P1, is enhanced in elevated CO$\sb2$. Only P1 transcripts are significantly decreased in the atxA mutant. Deletion analysis of the pag upstream region indicates that the 111-bp region upstream of the P1 site is sufficient for atxA-mediated increase of this transcript. The cya and lef genes each have one apparent transcriptional start site. The cya and lef transcripts are significantly decreased in the atxA mutant. The atxA mutant is avirulent in mice. The antibody response to all three toxin proteins is significantly decreased in atxA mutant-infected mice. These data suggest that the atxA gene product activates expression of the toxin genes and is essential for virulence.^ Since expression of the toxin genes is dependent on atxA, whether increased toxin gene expression in response to CO$\sb2$/bicarbonate and temperature is associated with increased atxA expression was investigated. I monitored steady state levels of atxA mRNA and AtxA protein in different growth conditions. The results indicate that expression of atxA is not influenced by CO$\sb2$/bicarbonate. Steady state levels of atxA mRNA and AtxA protein are higher at 37$\sp\circ$C than 28$\sp\circ$C. However, increased pag expression at high temperature can not be attributed directly to increased atxA expression.^ There is evidence that an additional factor(s) may be involved in regulation of pag. Expression of pag in strains overproducing AtxA is significantly decreased compared to the wildtype strain. A specific interaction of tagged-AtxA with the pag upstream DNA has not been demonstrated. Furthermore, four proteins in B. anthracis extract can be co-immunoprecipitated with tagged-AtxA. Amino-terminal sequence of one protein has been determined and found highly homologous to chaperonins of GroEL family. Studies are under way to determine if this GroEL-like protein interactions with AtxA and plays any role in atxA-mediated activation of toxin genes. ^

Relevância:

30.00% 30.00%

Publicador:

Resumo:

The 220 abundantly equipped burials from the Late Iron Age cemetery of Münsingen (420 – 240 BC) marked a milestone for Iron Age research. The evident horizontal spread throughout the time of occupancy laid the foundation for the chronology system of the Late Iron Age. Today the skulls of 77 individuals and some postcranial bones are still preserved. The aim was to obtain information about nutrition, social stratification and migration of the individuals from Münsingen. Stable isotope ratios of carbon, nitrogen and sulphur were analysed. The results of 63 individuals show that all consumed C3 plants as staple food with significant differences between males and females in δ13C and δ15N values. The results indicate a gender restriction in access to animal protein. Stable isotope values of one male buried with weapons and meat as grave goods suggest a diet with more animal proteins than the other individuals. It is possible that he was privileged due to high status. Furthermore, the δ34S values indicate minor mobility. Assuming that the subadults represent the local signal of δ34S it is very likely that adults with enriched δ34S could have migrated to Münsingen at some point during their lives. This study presents stable isotope values of one of the most important Late Iron Age burial sites in Central Europe. The presented data provide new insight into diet, migration and social stratification of the population from Münsingen.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Chlorophyll (chl) breakdown during senescence is an integral part of plant development and leads to the accumulation of colorless catabolites. The loss of green pigment is due to an oxygenolytic opening of the porphyrin macrocycle of pheophorbide (pheide) a followed by a reduction to yield a fluorescent chl catabolite. This step is comprised of the interaction of two enzymes, pheide a oxygenase (PaO) and red chl catabolite reductase. PaO activity is found only during senescence, hence PaO seems to be a key regulator of chl catabolism. Whereas red chl catabolite reductase has been cloned, the nature of PaO has remained elusive. Here we report on the identification of the PaO gene of Arabidopsis thaliana (AtPaO). AtPaO is a Rieske-type iron–sulfur cluster-containing enzyme that is identical to Arabidopsis accelerated cell death 1 and homologous to lethal leaf spot 1 (LLS1) of maize. Biochemical properties of recombinant AtPaO were identical to PaO isolated from a natural source. Production of fluorescent chl catabolite-1 required ferredoxin as an electron source and both substrates, pheide a and molecular oxygen. By using a maize lls1 mutant, the in vivo function of PaO, i.e., degradation of pheide a during senescence, could be confirmed. Thus, lls1 leaves stayed green during dark incubation and accumulated pheide a that caused a light-dependent lesion mimic phenotype. Whereas proteins were degraded similarly in wild type and lls1, a chl-binding protein was selectively retained in the mutant. PaO expression correlated positively with senescence, but the enzyme appeared to be post-translationally regulated as well.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

The paracaspase MALT1 plays an important role in immune receptor-driven signaling pathways leading to NF-κB activation. MALT1 promotes signaling by acting as a scaffold, recruiting downstream signaling proteins, as well as by proteolytic cleavage of multiple substrates. However, the relative contributions of these two different activities to T and B cell function are not well understood. To investigate how MALT1 proteolytic activity contributes to overall immune cell regulation, we generated MALT1 protease-deficient mice (Malt1(PD/PD)) and compared their phenotype with that of MALT1 knockout animals (Malt1(-/-)). Malt1(PD/PD) mice displayed defects in multiple cell types including marginal zone B cells, B1 B cells, IL-10-producing B cells, regulatory T cells, and mature T and B cells. In general, immune defects were more pronounced in Malt1(-/-) animals. Both mouse lines showed abrogated B cell responses upon immunization with T-dependent and T-independent Ags. In vitro, inactivation of MALT1 protease activity caused reduced stimulation-induced T cell proliferation, impaired IL-2 and TNF-α production, as well as defective Th17 differentiation. Consequently, Malt1(PD/PD) mice were protected in a Th17-dependent experimental autoimmune encephalomyelitis model. Surprisingly, Malt1(PD/PD) animals developed a multiorgan inflammatory pathology, characterized by Th1 and Th2/0 responses and enhanced IgG1 and IgE levels, which was delayed by wild-type regulatory T cell reconstitution. We therefore propose that the pathology characterizing Malt1(PD/PD) animals arises from an immune imbalance featuring pathogenic Th1- and Th2/0-skewed effector responses and reduced immunosuppressive compartments. These data uncover a previously unappreciated key function of MALT1 protease activity in immune homeostasis and underline its relevance in human health and disease.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Osteoclasts originate from the hematopoietic stem cell and share a differentiation pathway with the cells of the monocyte/macrophage lineages. Development and activation of osteoclasts, and as a consequence regulation of bone resorption, depend on two growth factors: macrophage colony-stimulating factor and receptor activator of NF-κB ligand. Furthermore, cell development and activity are modulated by a microenvironment composed of cytokines and growth factors and of the extracellular matrix. Membrane transporters are a means for cells to interact with their environment. Within this study, the expression of proteins regulating cellular iron homeostasis in osteoclast-like cells grown from bone marrow-derived progenitors was compared to the expression of this set of proteins by monocyte/macrophage lineage cells. In differentiating osteoclasts, levels of transcripts encoding transferrin receptor 1 and divalent metal transporter 1 (Slc11A2) were increased, while levels of transcripts encoding ferroportin (Slc40A1) and natural resistance-associated macrophage protein 1 (Slc11A1) were decreased. Supplementation of the culture media with exogenous iron led to an increase in the proliferation of osteoclast progenitor cells and to the expression of a macrophage-like phenotype, while the development of osteoclasts was reduced. Upon transfer of mature OC onto a CaP substrate, iron depletion of the medium with the Fe(3+)-chelator Deferoxamine Mesylate decreased CaP dissolution by ~30 %, which could be restored by addition of exogenous iron. During the 24 h of the assay, no effects were observed on total TRAP activity. The data demonstrate transcriptional regulation of the components of cellular iron transporters during OC development and suggests that iron homeostasis may contribute to fine-tuning of the RANKL-induced OC development.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Adenosine 5′-phosphosulfate reductase (APR) catalyzes the two-electron reduction of adenosine 5′-phosphosulfate to sulfite and AMP, which represents the key step of sulfate assimilation in higher plants. Recombinant APRs from both Lemna minorand Arabidopsis thaliana were overexpressed inEscherichia coli and isolated as yellow-brown proteins. UV-visible spectra of these recombinant proteins indicated the presence of iron-sulfur centers, whereas flavin was absent. This result was confirmed by quantitative analysis of iron and acid-labile sulfide, suggesting a 4Fe-4S cluster as the cofactor. EPR spectroscopy of freshly purified enzyme showed, however, only a minor signal at g = 2.01. Therefore, Mössbauer spectra of 57Fe-enriched APR were obtained at 4.2 K in magnetic fields of up to 7 tesla, which were assigned to a diamagnetic 4Fe-4S2+ cluster. This cluster was unusual because only three of the iron sites exhibited the same Mössbauer parameters. The fourth iron site gave, because of the bistability of the fit, a significantly smaller isomer shift or larger quadrupole splitting than the other three sites. Thus, plant assimilatory APR represents a novel type of adenosine 5′-phosphosulfate reductase with a 4Fe-4S center as the sole cofactor, which is clearly different from the dissimilatory adenosine 5′-phosphosulfate reductases found in sulfate reducing bacteria.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

To understand how a eukaryote achieves differential transcription of genes in precise spatial patterns, the molecular details of tissue specific expression of the Strongylocentrotus purpuratus Spec2a gene were investigated by functional studies of the cis-regulatory components in the upstream enhancer. Regional activation of Spec2a in the aboral ectoderm is conferred by a combination of activators and repressors. The positive regulators include previously identified SpOtx and a trans-regulatory factor binding at the CCAAT site in the Spec2a enhancer. The nuclear protein binding to the CCAAT box was determined to be the heterotrimeric CCAAT binding factor (SpCBF). SpCBF also mediates general activation in the ectoderm. The negative regulators consist of an oral ectoderm repressor (OER), an endoderm repressor (ENR), and an S. Purpuratus goosecoid homologue (SpGsc). OER functions to prevent expression in the oral ectoderm, while ENR is required to repress endoderm expression. SpGsc antagonizes the SpOtx function by competing for binding at SpOtx target genes in oral ectoderm, where it functions as an active repressor. Thus, SpOtx and SpGsc perform collectively to establish and maintain the oral-aboral axis. Finally, purification of ENR and OER proteins from sea urchin blastula stage nuclear extracts was performed using site-specific DNA-affmity chromatography. ^

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Chromatin, composed of repeating nucleosome units, is the genetic polymer of life. To aid in DNA compaction and organized storage, the double helix wraps around a core complex of histone proteins to form the nucleosome, and is therefore no longer freely accessible to cellular proteins for the processes of transcription, replication and DNA repair. Over the course of evolution, DNA-based applications have developed routes to access DNA bound up in chromatin, and further, have actually utilized the chromatin structure to create another level of complexity and information storage. The histone molecules that DNA surrounds have free-floating tails that extend out of the nucleosome. These tails are post-translationally modified to create docking sites for the proteins involved in transcription, replication and repair, thus providing one prominent way that specific genomic sequences are accessed and manipulated. Adding another degree of information storage, histone tail-modifications paint the genome in precise manners to influence a state of transcriptional activity or repression, to generate euchromatin, containing gene-dense regions, or heterochromatin, containing repeat sequences and low-density gene regions. The work presented here is the study of histone tail modifications, how they are written and how they are read, divided into two projects. Both begin with protein microarray experiments where we discover the protein domains that can bind modified histone tails, and how multiple tail modifications can influence this binding. Project one then looks deeper into the enzymes that lay down the tail modifications. Specifically, we studied histone-tail arginine methylation by PRMT6. We found that methylation of a specific histone residue by PRMT6, arginine 2 of H3, can antagonize the binding of protein domains to the H3 tail and therefore affect transcription of genes regulated by the H3-tail binding proteins. Project two focuses on a protein we identified to bind modified histone tails, PHF20, and was an endeavor to discover the biological role of this protein. Thus, in total, we are looking at a complete process: (1) histone tail modification by an enzyme (here, PRMT6), (2) how this and other modifications are bound by conserved protein domains, and (3) by using PHF20 as an example, the functional outcome of binding through investigating the biological role of a chromatin reader. ^

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Transcription of the Bacillus anthracis structural genes for the anthrax toxin proteins and biosynthetic operon for capsule are positively regulated by AtxA, a transcription regulator with unique properties. Consistent with the role of atxA in virulence factor expression, a B. anthracis atxA-null mutant is avirulent in a murine model for anthrax. In batch culture, multiple signals impact atxA transcript levels, and the timing and steady state level of atxA expression is critical for optimal toxin and capsule synthesis. Despite the apparent complex control of atxA transcription, only one trans-acting protein, the transition state regulator AbrB, has been demonstrated to directly interact with the atxA promoter. The AbrB-binding site has been described, but additional cis-acting control sequences have not been defined. Using transcriptional lacZ fusions, electrophoretic mobility shift assays, and Western blot analysis, the cis-acting elements and trans-acting factors involved in regulation of atxA in B. anthracis strains containing either both virulence plasmids, pXO1 and pXO2, or only one plasmid, pXO1, were studied. This work demonstrates that atxA transcription from the major start site P1 is dependent upon a consensus sequence for the housekeeping sigma factor SigA, and an A+T-rich upstream element (UP-element) for RNA polymerase (RNAP). In addition, the data show that a trans-acting protein(s) other than AbrB negatively impacts atxA transcription when it binds specifically to a 9-bp palindrome within atxA promoter sequences located downstream of P1. Mutation of the palindrome prevents binding of the trans-acting protein(s) and results in a corresponding increase in AtxA and anthrax toxin production in a strain- and culture-dependent manner. The identity of the trans-acting repressor protein(s) remains elusive; however, phenotypes associated with mutation of the repressor binding site have revealed that the trans-acting repressor protein(s) indirectly controls B. anthracis development. Mutation of the repressor binding site results in misregulation and overexpression of AtxA in conditions conducive for development, leading to a marked sporulation defect that is both atxA- and pXO2-61-dependent. pXO2-61 is homologous to the sensor domain of sporulation sensor histidine kinases and is proposed to titrate an activating signal away from the sporulation phosphorelay when overexpressed by AtxA. These results indicate that AtxA is not only a master virulence regulator, but also a modulator of proper B. anthracis development. Also demonstrated in this work is the impact of the developmental regulators AbrB, Spo0A, and SigH on atxA expression and anthrax toxin production in a genetically incomplete (pXO1+, pXO2-) and genetically complete (pXO1+, pXO2+) strain background. AtxA and anthrax toxin production resulting from deletion of the developmental regulators are strain-dependent suggesting that factors on pXO2 are involved in control of atxA. The only developmental deletion mutant that resulted in a prominent and consistent strain-independent increase in AtxA protein levels was an abrB-null mutant. As a result of increased AtxA levels, there is early and increased production of anthrax toxins in an abrB-null mutant. In addition, the abrB-null mutant exhibited an increase in virulence in a murine model for anthrax. In contrast, virulence of the atxA promoter mutant was unaffected in a murine model for anthrax despite the production of 5-fold more AtxA than the abrB-null mutant. These results imply that AtxA is not the only factor impacting pathogenesis in an abrB-null mutant. Overall, this work highlights the complex regulatory network that governs expression of atxA and provides an additional role for AtxA in B. anthracis development.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Cloning and characterization of the mouse neu gene revealed the presence of positive and negative cis-acting regulatory elements in the mouse neu promoter. An upstream region located between the SmaI and SphI sites of the promoter appeared to contribute significantly to negative regulation of the mouse neu gene, since deletion of this region led to a marked increase in transcriptional activity. To further characterize the mouse neu promoter I conducted a more exhaustive study on this cis-acting region which had not previously been studied in either human or rat neu promoters.^ The SmaI-SphI region was paced in front of the minimal thymidine kinase promoter where it inhibited transcription in both NIH3T3 and Hela cells. Physical association of nuclear proteins with this region was confirmed by electro-mobility shift assays. Four specific protein-DNA complexes were detected which involved interaction of proteins with various portions of the SmaI-SphI region. The most dominant protein complexes could be competed by SmaI-NruI and PstI-SphI subregions. Subsequent gel-shifts using SmaI-NruI and PstI-SphI as probes further confirmed the requirement of these two regions for the formation of the three fastest migrating complexes. Methylation interference and DNase I footprinting analyses were performed to determine the specific DNA sequences required for protein interaction. The two sequences identified were a 28 bp sequence, GAGCTTTCTTGGCTTAGTTCCAGACTCA, from the SmaI-NruI region (SN element) and a 23 bp sequence, AGGGACACCTTTGATCTGACCTTTA, from the PstI-SphI fragment (PS element). The PS and SN elements identified by footprinting were used as probes in gel-shift assays. Both oligonucleotides were capable of forming specific complexes with nuclear proteins. Sequence analysis of the SmaI-SphI region indicated that another sequence similar to PS element was located 330 bp upstream of the PS element. The identified SN and PS elements were subcloned into pMNSphICAT and transfected into NIH3T3 cells. Measurement of CAT activity indicated that both elements were sufficient to inhibit transcription from the mouse neu promoter. Both elements appeared to mediate binding in all cell types examined. Thus, I have identified two silencer elements from an upstream region of the mouse neu promoter which appear to regulate transcription in various cell lines. ^

Relevância:

30.00% 30.00%

Publicador:

Resumo:

In the high-nutrient, low-chlorophyll waters of the Gulf of Alaska, microcosm manipulation experiments were used to assess the effect of CO2 on growth and primary production under iron-limited and iron-replete conditions. As expected, iron had a strong effect on growth and photosynthesis. A modest and variable stimulation of growth and biomass production by CO2 (high CO2: 77-122 Pa; low CO2: 11-17 Pa) was observed under both iron-replete and iron-limited conditions, though near the limit of precision of our measurements in slow-growing low-iron experiments. Physiological acclimations responsible for the changes in growth were assessed. Under iron-limited conditions, growth stimulation at high CO2 appeared to result from an increase in photosynthetic efficiency, which we attribute to energy savings from down-regulation of the carbon concentrating mechanisms. In some cases, iron-rich photosynthetic proteins (PsbA, PsaC, and cytochrome b6) were down-regulated at elevated CO2in iron-limited controls. Under iron-replete conditions, there was an increase in growth rate and biomass at high CO2 in some experiments. This increase was unexpectedly supported by reductions in cellular carbon loss, most likely decreased respiration. We speculate that this effect may be due to acclimation to decreased pH rather than high CO2. The variability in responses to CO2 among experiments did not appear to be caused by differences in phytoplankton community structure and may reflect the sensitivity of the net response of phytoplankton to antagonistic effects of the several parameters that co-vary with CO2.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Neutrophil gelatinase associated lipocalin (NGAL) protein is attracting a great interest because of its antibacterial properties played upon modulating iron content in competition against iron acquisition processes developed by pathogenic bacteria that bind selective ferric iron chelators (siderophores). Besides its known high affinity to enterobactin, the most important siderophore, it has been recently shown that NGAL is able to bind Fe(III) coordinated by catechols. The selective binding of Fe(III)-catechol ligands to NGAL is here studied by using iron coordination structures with one, two, and three catecholate ligands. By means of a computational approach that consists of B3LYP/6-311G(d,p) quantum calculations for geometries, electron properties and electrostatic potentials of ligands, protein–ligand flexible docking calculations, analyses of protein–ligand interfaces, and Poisson–Boltzmann electrostatic potentials for proteins, we study the binding of iron catecholate ligands to NGAL as a central member of the lipocalin family of proteins. This approach provides a modeling basis for exploring in silico the selective binding of iron catecholates ligands giving a detailed picture of their interactions in terms of electrostatic effects and a network of hydrogen bonds in the protein binding pocket.