968 resultados para Filme de gelatina


Relevância:

10.00% 10.00%

Publicador:

Resumo:

Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Considerando-se que os critérios fotointerpretativos têm muito de subjetivo, com resultados que variam segundo o fotointérprete, pretendeu-se neste trabalho, ressaltar a utilização da densitometria como auxiliar na fotointerpretação da vegetação. No estudo foram utilizadas fotografias aéreas coloridas (transparências 23 x 23 cm) na escala 1:6.000. O filme colorido utilizado foi o Kodak Ektachrome MS Aerographic Film 2448. Desde que as fotografias estavam numa escala grande, foi bastante fácil identificar as culturas existentes na área bem como a vegetação natural. Cada categoria de vegetação foi classificada pela notação de Munsell. A densidade ótica foi medida por intermédio de um microdensitômetro de transmissão, marca Weston, modelo 877. Para cada item identificado nas fotografias foram feitas leituras de densidade ótica, para posterior comparação. Os dados obtidos foram utilizados para avaliar a importância das leituras densitométricas nas transparências coloridas, obtendo-se as seguintes conclusões principais: a) as medidas densitométricas ofereceram resultados mais consistentes que os obtidos por fotointerpretação convencional; b) a utilização do filme infravermelho colorido sugere a possibilidade de ampliar a resposta das leituras densitométricas.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

O uso de malhas pigmentadas em cultivos de hortaliças folhosas permite a melhor adequação do ambiente às plantas, com destaque para a rúcula. Essa hortaliça vem conquistando maior espaço no mercado consumidor brasileiro desde o final da década de 90. Essa pesquisa teve por objetivo avaliar as condições ambientais proporcionadas pelo uso de telas pigmentadas na cobertura de túneis de cultivo, relacionando com as respostas agronômicas da rúcula, cultivada dentro desses túneis sobre diferentes coberturas de solo. As coberturas de túneis foram: a Chromatinet® azul, Chromatinet® vermelha, tela aluminizada prata, Sombrite® 50% e filme plástico transparente de polietileno de baixa densidade de 100µ. As coberturas de solo, também denominadas mulchings, dentro dos túneis foram: o filme plástico de polietileno de cor preta; de polietileno de dupla-face nas cores preta e branca, com a face branca voltada para cima; casca de arroz e a ausência de mulching. O delineamento utilizado foi o de blocos ao acaso com 24 tratamentos e três repetições. Nas condições do experimento, o emprego de algumas coberturas de túnel e de solo modificou o ambiente e melhorou as respostas agronômicas das plantas de rúcula.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Compararam-se os efeitos da enxertia nas trocas gasosas de dois híbridos de berinjela em pé franco e enxertado. Conduziu-se um ensaio em ambiente protegido, na FCA/UNESP, em estrutura simples, tipo arco com 7 m de largura, 40 m de comprimento e 3 m de pé direito, cobertos por filme plástico de 100 micrometros. Foram utilizados os híbridos de berinjela Nápoli e Kokuyo, enxertados em porta-enxerto específico (híbrido Taibyo VF) para esta espécie. O delineamento experimental utilizado foi inteiramente casualizado, com quatro tratamentos (Nápoli pé franco, Nápoli enxertada, Kokuyo pé franco e Kokuyo enxertada) com dez repetições. A assimilação líquida de CO2 (A), transpiração (E), condutância estomática (g s) e eficiência no uso de água (EUA), obtida pela relação (A/E), foram determinadas às 09:00; 12:00; 14:00 e 16:00 horas em um dia sem nebulosidade com fluxo de fótons fotossinteticamente ativos (FFFA) de 937±126 mmol m-2 s-1, com um sistema fechado portátil de fotossíntese, IRGA, modelo LI-6200 (LI-COR). Observou-se que as plantas do híbrido Kokuyo apresentaram maiores valores para as variáveis A, E, g s e EUA que o híbrido Nápoli. A enxertia não afetou a capacidade fotossintética dos híbridos, porém, esta resultou em menores valores de E e g s nos dois híbridos, levando à maior EUA, efeito este que na prática pode resultar em menor demanda de água pelas plantas.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq)

Relevância:

10.00% 10.00%

Publicador:

Resumo:

O objetivo deste trabalho foi avaliar o efeito da cobertura do solo com aveia preta e manutenção da palha sobre o terreno, bem como cobertura do solo com filme de polietileno preto, sobre a produção de biomassa e teores de Mn e Zn em alface cultivada no sistema orgânico, por dois anos consecutivos. Utilizaram-se cinco tratamentos: solo sem cobertura, coberto com filme de polietileno preto, coberto com aveia acamada, coberto com aveia ceifada e solo coberto com aveia na sua forma natural, para o cultivo de três cultivares de alface. O experimento seguiu delineamento experimental de blocos ao acaso, com quatro repetições e análise estatística com parcelas subdivididas. Concluiu-se que o cultivo de alface em sucessão à aveia preta, sobre a palha, promoveu produção satisfatória e apresentou adequados teores de manganês e zinco, equivalentes àqueles encontrados na literatura em diferentes sistemas de cultivo, e a cobertura do solo com plástico preto promoveu produção satisfatória com maior acúmulo de Zn no primeiro ano e menor de Mn no segundo.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq)

Relevância:

10.00% 10.00%

Publicador:

Resumo:

The objective of this research was to evaluate the effect of the soil covering with black oats straw, and soil covered with black plastic, in phosphorous and potassium content, and biomass production of lettuce in organic system, over two years. There have been defined five handling systems for soil covering: without cover, covered with black plastic, covered with laying oats, covered with harvested oats, and covered with oats straw in natural form, for growing three cultivars of lettuce. It was used the randomized blocks design in split plot system, with four replications. It has been concluded that butter head lettuce showed biggest phosphorous content, the soils covered with oats straw promoted higher potassium accumulation and lettuce production in second year, while soil covered with black plastic promoted best lettuce production in first year.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Multiphase flows in ducts can adopt several morphologies depending on the mass fluxes and the fluids properties. Annular flow is one of the most frequently encountered flow patterns in industrial applications. For gas liquid systems, it consists of a liquid film flowing adjacent to the wall and a gas core flowing in the center of the duct. This work presents a numerical study of this flow pattern in gas liquid systems in vertical ducts. For this, a solution algorithm was developed and implemented in FORTRAN 90 to numerically solve the governing transport equations. The mass and momentum conservation equations are solved simultaneously from the wall to the center of the duct, using the Finite Volumes Technique. Momentum conservation in the gas liquid interface is enforced using an equivalent effective viscosity, which also allows for the solution of both velocity fields in a single system of equations. In this way, the velocity distributions across the gas core and the liquid film are obtained iteratively, together with the global pressure gradient and the liquid film thickness. Convergence criteria are based upon satisfaction of mass balance within the liquid film and the gas core. For system closure, two different approaches are presented for the calculation of the radial turbulent viscosity distribution within the liquid film and the gas core. The first one combines a k- Ɛ one-equation model and a low Reynolds k-Ɛ model. The second one uses a low Reynolds k- Ɛ model to compute the eddy viscosity profile from the center of the duct right to the wall. Appropriate interfacial values for k e Ɛ are proposed, based on concepts and ideas previously used, with success, in stratified gas liquid flow. The proposed approaches are compared with an algebraic model found in the literature, specifically devised for annular gas liquid flow, using available experimental results. This also serves as a validation of the solution algorithm

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Annular flow is the prevailing pattern in transport and energy conversion systems and therefore, one of the most important patterns in multiphase flow in ducts. The correct prediction of the pressure gradient and heat transfer coefficient is essential for optimizing the system s capacity. The objective of this work is to develop and implement a numerical algorithm capable of predicting hydrodynamic and thermal characteristics for upflow, vertical, annular flow. The numerical algorithm is then complemented with the physical modeling of phenomena that occurs in this flow pattern. These are, turbulence, entrainment and deposition and phase change. For the development of the numerical model, axial diffusion of heat and momentum is neglected. In this way the time-averaged equations are solved in their parabolic form obtaining the velocity and temperature profiles for each axial step at a time, together with the global parameters, namely, pressure gradient, mean film thickness and heat transfer coefficient, as well as their variation in the axial direction. The model is validated for the following conditions: fully-developed laminar flow with no entrainment; fully developed laminar flow with heat transfer, fully-developed turbulent flow with entrained drops, developing turbulent annular flow with entrained drops, and turbulent flow with heat transfer and phase change

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Fuel is a material used to produce heat or power by burning, and lubricity is the capacity for reducing friction. The aim of this work is evaluate the lubricity of eight fossil and renewable fuels used in Diesel engines, by means of a HFRR tester, following the ASTM D 6079-04 Standard. In this conception, a sphere of AISI 52100 steel (diameter of 6,000,05 mm, Ra 0,050,005 μm, E = 210 GPa, HRC 624, HV0,2 63147) is submitted to a reciprocating motion under a normal load of 2 N and 50 Hz frequency to promote a wear track length of 1.10.1mm in a plan disc of AISI 52100 steel (HV0,05 18410, Ra 0,020,005 μm). The testing extent time was 75 minutes, 225,000 cycles. Each one test was repeated six times to furnish the results, by means of intrinsic signatures from the signals of the lubricant film percentage, friction coefficient, contact heating, Sound Pressure Level, SPL [dB]. These signal signatures were obtained by two thermocouples and a portable decibelmeter coupled to a data acquisition system and to the HFRR system. The wettability of droplet of the diesel fuel in thermal equilibrium on a horizontal surface of a virgin plan disc of 52100 steel, Ra 0,02  0,005 μm, were measured by its contact angle of 7,0  3,5o, while the results obtained for the biodiesel B5, B20 and B100 blends originated by the ethylic transesterification of soybean oil were, respectively, 7,5  3,5o, 13,5  3,5o e 19,0  1,0o; for the distilled water, 78,0  6,0o; the biodiesel B5, B20 and B100 blends originated by the ethylic transesterification of sunflower oil were, respectively, 7,0  4,0o, 8,5  4,5o e 19,5  2,5o. Different thickness of lubricant film were formed and measured by their percentage by means of the contact resistance technique, suggesting several regimes, since the boundary until the hydrodynamic lubrication. All oils analyzed in this study promoted the ball wear scars with diameters smaller than 400 μm. The lowest values were observed in the scar balls lubricated by mixtures B100, B20 and B5 of sunflower and B20 and B5 of soybean oils (WSD < 215 μm)

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Os polímeros biodegradáveis, como o poliácido láctico (PLA) apesar de consolidado nos campos farmacêuticos, médico e biomédico como biomateriais úteis para aplicações variadas, porém, depende da necessidade de funcionalizar a sua superfície estudando suas propriedades tais como hidrofilidade e hidrofobicidade favorecendo a interação do polímero com os materiais de aplicação farmacêutica, médica e biomédica. Este trabalho tem como objetivo produzir um material com características diferentes em cada um de seus lados, sendo um lado hidrofílico e o outro hidrofóbico. O substrato têxtil utilizado neste estudo foi um tecido de malha de composição 100% PLA que é biodegradável e biocompatível, o que possibilita sua aplicação na área biomédica. Para modificação superficial foi utilizado o tratamento a plasma de baixa pressão. A técnica de modificação de superfície por plasma foi escolhida por ser uma tecnologia limpa, anticorrosiva e não tóxica ao contrario de muitos processos químicos convencionais utilizados na indústria têxtil, além disso, não afeta as propriedades de massa do substrato. Neste estudo, um lado da superfície do substrato foi tratado com plasma oxigênio, argônio e nitrogênio, para o trabalho de melhoria da hidrofilidade da superfície e metano para a hidrofobicidade da amostra. A espectroscopia de emissão ótica (OEE) foi utilizada para fazer o diagnóstico das espécies do plasma durante o tratamento. Após o tratamento a plasma as amostras foram caracterizadas por medidas de ângulo de contato, microscopia eletrônica de varredura (MEV), Espectroscopia de fotoelétrons de raios-X (XPS), Infravermelho com Transformada de Fourier (FTIR) de reflexão total atenuada (ATR), medidas da área de espalhamento do líquido e arraste vertical. Onde foi caracterizado o aumento e diminuição da molhabilidade das amostras tratadas por plasma bem como as variáveis que contribuíram para tal efeito. O tratamento das amostras de PLA com O2 + CH4 apresenta comportamento hidrofílico no lado tratado com O2, apresentando aumento de rugosidade e grupos funcionais e no lado tratado com CH4, apresentando a formação de um filme polimérico formado sobre a superfície da amostra. O tratamento com N2 + CH4 apresenta comportamento hidrofóbico, porém com variações no fluxo do CH4 tem-se um controle da molhabilidade na superfície das amostras, podendo ir de hidrofóbico a hidrofílico, neste tratamento as amostras apresentaram pequenas diferenças de molhabilidade entre os lados tratados com plasma de N2 e com plasma de CH4

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Currently, vegetable oils have been studied for bio-lubricants base that fits the new environmental standards. Since, in a world full of finite natural resources, mineral oils bring consequences to the environment due to its low biodegradability and toxicity, also it is important to consider that synthetic oils have a high cost The aim of this work is to obtain a biolubricant additived with oxide nanoparticles (ZnO and CuO) for better resistance to friction and wear, which is not toxic to the environment and have better adherence under boundary lubrication. The methodology consisted in the synthesis of bio-lubricants (soybean and sunflower base) by epoxidation reaction. Then, some physical-chemical analysis in bio-lubricants are made to characterize theses lubricants, such as, density, acidity, iodine value, viscosity, viscosity index. Later, the lubricants were additive with nanoparticles. The tribological performance was evaluated by the equipment HFRR (High Frequency Reciprocating Rig) consisting of a wear test ball-plan type. The characterization of wear analysis was performed by SEM / EDS. The results show that bio-lubricants may be synthesized by reaction of epoxidation with good conversion. Tribological point of view, the epoxidized oils are more effective than lubricant additived with the oxide nanoparticles, they had lower coefficients of friction and better rate of film formation in the study. However, because they are environmentally friendly, bio-lubricants gain the relevant importance in tribological field

Relevância:

10.00% 10.00%

Publicador:

Resumo:

The cashew, a fruit from Brazilian Northeast is used to produce juice due to its flavor and vitamin C richness. However, its acceptance is limited due to its astringency. Cajuína is a derivate product appreciated by its characteristic flavor, freshness and lack of astringency, due to tannin removal. Cajuína is a light yellow beverage made from clarified cashew juice and sterilized after bottling. It differs from the integral and concentrated juice by the clarification and thermal treatment steps. Many problems such as haze and excessive browning could appear if these steps are not controlled. The objective of this work was divided into two stages with the aim to supply process information in order to obtain a good quality product with uniform characteristics (sensory and nutritional). Polyphenol-protein interaction was studied at the clarification step, which is an empirical process, to provide values on the amount of clarifying solution (gelatin) that must be added to achieve a complete juice clarification. Clarification essays were performed with juice dilutions of 1:2 and 1:10 and the effect of metabissulfite and tannic acid addition was evaluated. It was not possible to establish a clarification point. Metabissulfite did not influenced the clarification process however tannic acid addition displaced the clarification point, showing the difficulty visual monitoring of the process. Thermal treatment of clarified juice was studied at 88, 100, 111 e 121 °C. To evaluate the non-enzymatic browning, vitamin C, 5-hidroximetilfurfural (5-HMF) and sugar variation were correlated with color parameters (reflectance spectra, color difference and CIELAB). Kinetic models were obtained for reflectance spectra, ascorbic acid and 5-HMF. It was observed that 5-HMF introduction followed a first order kinetic rate at the beginning of the thermal treatment and a zero order kinetic at later process stages. An inverse correlation was observed between absorbance at 420 nm and ascorbic acid degradation, which indicates that ascorbic acid might be the principal factor on cajuína non-enzymatic browning. Constant sugar concentration showed that this parameter did not contribute directly to the nonenzymatic browning. Optimization techniques showed showed that to obtain a high vitamin C and a low 5-HMF content, the process must be done at 120 ºC. With the water-bath thermal treatment, the 90 °C temperature promoted a lower ascorbic acid degradation at the expense of a higher 5-HMF level

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Durante a germinação das sementes, os carboidratos de reserva são degradados pela atividade de a-amilase. A identificação de mRNA é uma ferramenta fundamental para a definição da cinética de síntese de alfa-amilase. Objetivou-se padronizar a metodologia do RT-PCR para identificar o mRNA do gene de a-amilase em sementes de milho. Após três dias de germinação das cultivares Saracura-BRS 4154 e CATI-AL34, extraiu-se o RNA total pelo método do tiocianato de guanidina-fenol-clorofórmio, com algumas modificações. A partir do RNA total extraído foi obtido cDNA com utilização de random primers. A amplificação por PCR de uma porção do gene da alfa-amilase foi realizada com os primers: sense - CGACATCGACCACCTCAAC; antisense - TTGACCAGCTCCTGCCTGTC; gelatina; DMSO e 1,25 unidades de Taq DNA polimerase por reação e completados com água tratada com DEPC. Os ciclos para a amplificação foram 94ºC durante 4 minutos, seguidos por 34 ciclos de 94ºC durante 1 minuto, 42ºC durante 1 minuto e 72ºC durante 1,5 minutos e, finalmente, 72ºC por 5 minutos. O produto do RT-PCR apresentou uma banda de 249 pares de base (pb) bem definida, para as duas cultivares estudadas, não ocorrendo bandas inespecíficas. A técnica do RT-PCR mostrou ser uma metodologia eficiente para a identificação da expressão de alfa-amilase durante a germinação das sementes e pode ser usado para estudo qualitativo e quantitativo da cinética de síntese dessa enzima em experimentos de germinação.