900 resultados para EPITHERMAL NEUTRON-SPECTRUM


Relevância:

20.00% 20.00%

Publicador:

Resumo:

Objective: To examine the properties of the Social Communication Questionnaire (SCQ) in a population cohort of children with autism spectrum disorders (ASDs) and in the general population, Method: SCQ data were collected from three samples: the Special Needs and Autism Project (SNAP) cohort of 9- to 10-year-old children with special educational needs with and without ASD and two similar but separate age groups of children from the general population (n = 411 and n = 247). Diagnostic assessments were completed on a stratified subsample (n = 255) of the special educational needs group. A sample-weighting procedure enabled us to estimate characteristics of the SCQ in the total ASD population. Diagnostic status of cases in the general population samples were extracted from child health records. Results: The SCQ showed strong discrimination between ASD and non-ASD cases (sensitivity 0.88, specificity 0.72) and between autism and nonautism cases (sensitivity 0.90, specificity 0.86). Findings were not affected by child IQ or parental education. In the general population samples between 4% and 5% of children scored above the ASD cutoff including 1.5% who scored above the autism cutoff. Although many of these high-scoring children had an ASD diagnosis, almost all (similar to 90%) of them had a diagnosed neurodevelopmental disorder. Conclusions: This study confirms the utility of the SCQ as a,first-level screen for ASD in at-risk samples of school-age children.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Background Recent reports have suggested that the prevalence of autism and related spectrum disorders (ASDs) is substantially higher than previously recognised. We sought to quantify prevalence of ASDs in children in South Thames, UK. Methods Within a total population cohort of 56946 children aged 9-10 years, we screened all those with a current clinical diagnosis of ASD (n=255) or those judged to be at risk for being an undetected case (n=1515). A stratified subsample (n=255) received a comprehensive diagnostic assessment, including standardised clinical observation, and parent interview assessments of autistic symptoms, language, and intelligence quotient (IQ). Clinical consensus diagnoses of childhood autism and other ASDs were derived. We used a sample weighting procedure to estimate prevalence. Findings The prevalence of childhood autism was 38.9 per 10000 (95% CI 29.9-47.8) and that of other ASDs was 77.2 per 10000 (52.1-102.3), making the total prevalence of all AS Ds 116.1 per 10000 (90.4-141.8). A narrower definition of childhood autism, which combined clinical consensus with instrument criteria for past and current presentation, provided a prevalence of 24.8 per 10 000 (17.6-32.0). The rate of previous local identification was lowest for children of less educated parents. Interpretation Prevalence of autism and related ASDs is substantially greater than previously recognised. Whether the increase is due to better ascertainment, broadening diagnostic criteria, or increased incidence is unclear. Services in health, education, and social care will need to recognise the needs of children with some form of ASD, who constitute 1% of the child population.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Objective: To test the hypothesis that measles vaccination was involved in the pathogenesis of autism spectrum disorders (ASD) as evidenced by signs of a persistent measles infection or abnormally persistent immune response shown by circulating measles virus or raised antibody titres in children with ASD who had been vaccinated against measles, mumps and rubella (MMR) compared with controls. Design: Case-control study, community based. Methods: A community sample of vaccinated children aged 10-12 years in the UK with ASD (n = 98) and two control groups of similar age, one with special educational needs but no ASD (n = 52) and one typically developing group (n = 90), were tested for measles virus and antibody response to measles in the serum. Results: No difference was found between cases and controls for measles antibody response. There was no dose-response relationship between autism symptoms and antibody concentrations. Measles virus nucleic acid was amplified by reverse transcriptase-PCR in peripheral blood mononuclear cells from one patient with autism and two typically developing children. There was no evidence of a differential response to measles virus or the measles component of the MMR in children with ASD, with or without regression, and controls who had either one or two doses of MMR. Only one child from the control group had clinical symptoms of possible enterocolitis. Conclusion: No association between measles vaccination and ASD was shown.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

We report rates of regression and associated findings in a population derived group of 255 children aged 9-14 years, participating in a prevalence study of autism spectrum disorders (ASD); 53 with narrowly defined autism, 105 with broader ASD and 97 with non-ASD neurodevelopmental problems, drawn from those with special educational needs within a population of 56,946 children. Language regression was reported in 30% with narrowly defined autism, 8% with broader ASD and less than 3% with developmental problems without ASD. A smaller group of children were identified who underwent a less clear setback. Regression was associated with higher rates of autistic symptoms and a deviation in developmental trajectory. Regression was not associated with epilepsy or gastrointestinal problems.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

In this study, for the first time, prospective memory was investigated in 11 school-aged children with autism spectrum disorders and 11 matched neurotypical controls. A computerised time-based prospective memory task was embedded in a visuospatial working memory test and required participants to remember to respond to certain target times. Controls had significantly more correct prospective memory responses than the autism spectrum group. Moreover, controls checked the time more often and increased time-monitoring more steeply as the target times approached. These differences in time-checking may suggest that prospective memory in autism spectrum disorders is affected by reduced self-initiated processing as indicated by reduced task monitoring.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

A Neural Mass model is coupled with a novel method to generate realistic Phase reset ERPs. The power spectra of these synthetic ERPs are compared with the spectra of real ERPs and synthetic ERPs generated via the Additive model. Real ERP spectra show similarities with synthetic Phase reset ERPs and synthetic Additive ERPs.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

This paper investigates the application of the Hilbert spectrum (HS), which is a recent tool for the analysis of nonlinear and nonstationary time-series, to the study of electromyographic (EMG) signals. The HS allows for the visualization of the energy of signals through a joint time-frequency representation. In this work we illustrate the use of the HS in two distinct applications. The first is for feature extraction from EMG signals. Our results showed that the instantaneous mean frequency (IMNF) estimated from the HS is a relevant feature to clinical practice. We found that the median of the IMNF reduces when the force level of the muscle contraction increases. In the second application we investigated the use of the HS for detection of motor unit action potentials (MUAPs). The detection of MUAPs is a basic step in EMG decomposition tools, which provide relevant information about the neuromuscular system through the morphology and firing time of MUAPs. We compared, visually, how MUAP activity is perceived on the HS with visualizations provided by some traditional (e.g. scalogram, spectrogram, Wigner-Ville) time-frequency distributions. Furthermore, an alternative visualization to the HS, for detection of MUAPs, is proposed and compared to a similar approach based on the continuous wavelet transform (CWT). Our results showed that both the proposed technique and the CWT allowed for a clear visualization of MUAP activity on the time-frequency distributions, whereas results obtained with the HS were the most difficult to interpret as they were extremely affected by spurious energy activity. (c) 2008 Elsevier Inc. All rights reserved.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

It has been proposed that there is a core impairment in autism spectrum conditions (ASC) to the mirror neuron system (MNS): If observed actions cannot be mapped onto the motor commands required for performance, higher order sociocognitive functions that involve understanding another person's perspective, such as theory of mind, may be impaired. However, evidence of MNS impairment in ASC is mixed. The present study used an 'automatic imitation' paradigm to assess MNS functioning in adults with ASC and matched controls, when observing emotional facial actions. Participants performed a pre-specified angry or surprised facial action in response to observed angry or surprised facial actions, and the speed of their action was measured with motion tracking equipment. Both the ASC and control groups demonstrated automatic imitation of the facial actions, such that responding was faster when they acted with the same emotional expression that they had observed. There was no difference between the two groups in the magnitude of the effect. These findings suggest that previous apparent demonstrations of impairments to the MNS in ASC may be driven by a lack of visual attention to the stimuli or motor sequencing impairments, and therefore that there is, in fact, no MNS impairment in ASC. We discuss these findings with reference to the literature on MNS functioning and imitation in ASC, as well as theories of the role of the MNS in sociocognitive functioning in typical development.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

In a previous paper (J. of Differential Equations, Vol. 249 (2010), 3081-3098) we examined a family of periodic Sturm-Liouville problems with boundary and interior singularities which are highly non-self-adjoint but have only real eigenvalues. We now establish Schatten class properties of the associated resolvent operator.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Recent developments in instrumentation and facilities for sample preparation have resulted in sharply increased interest in the application of neutron diffraction. Of particular interest are combined approaches in which neutron methods are used in parallel with X-ray techniques. Two distinct examples are given. The first is a single-crystal study of an A-DNA structure formed by the oligonucleotide d(AGGGGCCCCT)2, showing evidence of unusual base protonation that is not visible by X-ray crystallography. The second is a solution scattering study of the interaction of a bisacridine derivative with the human telomeric sequence d(AGGGTTAGGGTTAGGGTTAGGG) and illustrates the differing effects of NaCl and KCl on this interaction.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The correlated k-distribution (CKD) method is widely used in the radiative transfer schemes of atmospheric models and involves dividing the spectrum into a number of bands and then reordering the gaseous absorption coefficients within each one. The fluxes and heating rates for each band may then be computed by discretizing the reordered spectrum into of order 10 quadrature points per major gas and performing a monochromatic radiation calculation for each point. In this presentation it is shown that for clear-sky longwave calculations, sufficient accuracy for most applications can be achieved without the need for bands: reordering may be performed on the entire longwave spectrum. The resulting full-spectrum correlated k (FSCK) method requires significantly fewer monochromatic calculations than standard CKD to achieve a given accuracy. The concept is first demonstrated by comparing with line-by-line calculations for an atmosphere containing only water vapor, in which it is shown that the accuracy of heating-rate calculations improves approximately in proportion to the square of the number of quadrature points. For more than around 20 points, the root-mean-squared error flattens out at around 0.015 K/day due to the imperfect rank correlation of absorption spectra at different pressures in the profile. The spectral overlap of m different gases is treated by considering an m-dimensional hypercube where each axis corresponds to the reordered spectrum of one of the gases. This hypercube is then divided up into a number of volumes, each approximated by a single quadrature point, such that the total number of quadrature points is slightly fewer than the sum of the number that would be required to treat each of the gases separately. The gaseous absorptions for each quadrature point are optimized such that they minimize a cost function expressing the deviation of the heating rates and fluxes calculated by the FSCK method from line-by-line calculations for a number of training profiles. This approach is validated for atmospheres containing water vapor, carbon dioxide, and ozone, in which it is found that in the troposphere and most of the stratosphere, heating-rate errors of less than 0.2 K/day can be achieved using a total of 23 quadrature points, decreasing to less than 0.1 K/day for 32 quadrature points. It would be relatively straightforward to extend the method to include other gases.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The correlated k-distribution (CKD) method is widely used in the radiative transfer schemes of atmospheric models, and involves dividing the spectrum into a number of bands and then reordering the gaseous absorption coefficients within each one. The fluxes and heating rates for each band may then be computed by discretizing the reordered spectrum into of order 10 quadrature points per major gas, and performing a pseudo-monochromatic radiation calculation for each point. In this paper it is first argued that for clear-sky longwave calculations, sufficient accuracy for most applications can be achieved without the need for bands: reordering may be performed on the entire longwave spectrum. The resulting full-spectrum correlated k (FSCK) method requires significantly fewer pseudo-monochromatic calculations than standard CKD to achieve a given accuracy. The concept is first demonstrated by comparing with line-by-line calculations for an atmosphere containing only water vapor, in which it is shown that the accuracy of heating-rate calculations improves approximately in proportion to the square of the number of quadrature points. For more than around 20 points, the root-mean-squared error flattens out at around 0.015 K d−1 due to the imperfect rank correlation of absorption spectra at different pressures in the profile. The spectral overlap of m different gases is treated by considering an m-dimensional hypercube where each axis corresponds to the reordered spectrum of one of the gases. This hypercube is then divided up into a number of volumes, each approximated by a single quadrature point, such that the total number of quadrature points is slightly fewer than the sum of the number that would be required to treat each of the gases separately. The gaseous absorptions for each quadrature point are optimized such they minimize a cost function expressing the deviation of the heating rates and fluxes calculated by the FSCK method from line-by-line calculations for a number of training profiles. This approach is validated for atmospheres containing water vapor, carbon dioxide and ozone, in which it is found that in the troposphere and most of the stratosphere, heating-rate errors of less than 0.2 K d−1 can be achieved using a total of 23 quadrature points, decreasing to less than 0.1 K d−1 for 32 quadrature points. It would be relatively straightforward to extend the method to include other gases.