537 resultados para Amplificação heterologa


Relevância:

10.00% 10.00%

Publicador:

Resumo:

Pós-graduação em Ciências Biológicas (Zoologia) - IBB

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq)

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Pós-graduação em Medicina Veterinária - FMVZ

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Pós-graduação em Ciências Biológicas (Genética) - IBB

Relevância:

10.00% 10.00%

Publicador:

Resumo:

A pesquisa de infecções por Giardia e a caracterização genotípica deste protozoário foi realizada em primatas não humanos (PNH) mantidos em Zoológico a fim de avaliar o seu potencial zoonótico. As amostras dos animais consistiram de fezes colhidas do piso de 22 baias onde eram mantidos 47 primatas de 18 diferentes espécies. Exames coproparasitológicos foram realizados pelos métodos de concentração por sedimentação e centrífugo-flutuação e revelaram a presença dos seguintes parasitas e suas respectivas frequências: Giardia (18%); Entamoeba spp. (18%); Endolimax nana (4.5%); Iodamoeba spp. (4.5%); oxiurídeos (4.5%) e estrongilídeos (4.5%). O DNA extraído de todas as amostras fecais foi submetido à técnica de PCR para a amplificação dos genes gdh e tpi de Giardia, porém, só foram obtidos amplicons das quatro amostras positivas provenientes de Ateles belzebuth, Alouatta caraya, Alouatta fusca and Alouatta seniculus. O seqüenciamento dos fragmentos amplificados foi possível apenas para as amostras oriundas de Ateles belzebuth (BA1), Alouatta fusca (BA2) e Alouatta caraya (BA3), cuja análise fenética de ambos os genes revelou pertencerem ao genótipo A. As análises das sequências de tpi revelaram que todas as amostras pertencem ao subgenótipo AII. No que se refere ao gene gdh as análises revelaram uma amostra pertencente ao subgenótipo AII (BA3) e duas ao subgenótipo A1 (BA1 e BA2). Considerando o potencial zoonótico do genótipo A e o fato de que os animais não apresentavam sintomas de infecção, os dados do presente trabalho salientam a importância de se realizar, periodicamente, exames coproparasitológicos dos animais de zoológico, para implementação de medidas preventivas para resguardar a saúde dos animais em cativeiro, a de seus tratadores e dos visitantes de parques zoológicos.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Chlamydophila psittaci is a bacterium that causes respiratory or systemic disease in birds and humans. Owing to the risk of transmission from asymptomatic birds to humans, the objective of this study was to detect the presence of Chlamydophila spp. in asymptomatic birds. Four hundred and three fecal samples or cloacal swabs were collected from domestic, wild or exotic birds. The 403 samples were examined by real time PCR specific for the 16S subunit of rRNA gene using SsoFastEvaGreen®SupermixTM (Bio-Rad) and melting curve analysis. Hemi-nested PCR specific for the OMP-A gene, accomplished in real-time PCR positive samples, was followed by sequencing of the amplified fragments to determine the genotype of C. psittaci. Real-time PCR was positive in 17 (4.21%) samples. Hemi-nested PCR revealed positivity in two samples previously positive by real-time PCR. Sequencing of the fragment amplified by hemi-nested PCR allowed for the identification of genotype A of C. psittaci in one sample. The results of this experiment show that the real-time PCR targeting the 16S rRNA gene followed by melting curve analysis can be used for diagnosis of Chlamydophila sp. in fecal samples of asymptomatic birds. The classification of the Chlamydophila species and the genotype of C. psittaci must be accomplished by PCR targeting the ompA gene and sequencing of the amplified fragments.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

OBJETIVO:Relatar o caso de um lactente com citomegalovírus congênito e disacusia neurossensorial progressiva, analisado por três métodos de avaliação auditiva.DESCRIÇÃO DO CASO:Na primeira avaliação auditiva, aos quatro meses de idade, o lactente apresentou ausência de Emissões Otoacústicas (EOA) e Potencial Evocado Auditivo de Tronco Encefálico (PEATE) dentro dos padrões de normalidade para a faixa etária, com limiar eletrofisiológico em 30dBnHL, bilateralmente. Com seis meses, apresentou ausência de PEATE bilateral em 100dBnHL. A avaliação comportamental da audição mostrou-se prejudicada devido ao atraso no desenvolvimento neuropsicomotor. Aos oito meses, foi submetido ao exame de Resposta Auditiva de Estado Estável (RAEE) e os limiares encontrados foram 50, 70, ausente em 110 e em 100dB, respectivamente para 500, 1.000, 2.000 e 4.000Hz, à direita, e 70, 90, 90 e ausente em 100dB, respectivamente para 500, 1.000, 2.000 e 4.000Hz, à esquerda.COMENTÁRIOS:Na primeira avaliação, o lactente apresentou alteração auditiva no exame de EOA e PEATE normal, que passou a ser alterado aos seis meses de idade. A intensidade da perda auditiva só pôde ser identificada pelo exame de RAEE, permitindo estabelecer a melhor conduta na adaptação de aparelho de amplificação sonora individual. Ressalta-se a importância do acompanhamento audiológico para crianças com CMV congênito.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

This study was performed in order to evaluate the detection limit of PCR with fluorescent capillary electrophoresis for Brucella abortus diagnosis in bovine semen. Negative bovine semen samples were artificially contaminated with B. abortus (10(0) to 10(7) bacteria/mL) and DNA was extracted by phenol/chloroform protocol. DNA was amplified by PCR with oligonucleotides previously described BF-5'gcgctcaggctgccgacgcaa3' (6-FAM labeled) and BR-5'accagccattgcggtcggta3' for B. abortus. Oligonucleotides generated DNA fragments of 193 bp. DNA fragments visualization was done under UV light at silver stained 8% poliacrylamide gel, and fluorescent capillary electrophoresis performed in an automatic DNA fragment analyzer. The detection limit of capillary electrophoresis for B. abortus was 10³ bacteria/mL, while for silver stained 8% poliacrylamide gel it was 10(5) bacteria/mL. PCR with fluorescent capillary electrophoresis is fast, efficient and highly sensitive test for DNA detection of Brucella in bovine semen, and itcan be an important tool for health evaluation of the herd and semen sanitary control in artificial insemination centers.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

We studied the molecular epidemiology of Staphylococcus aureus strains potentially toxigenic, isolated from the production process of Minas frescal cheese in a small dairy plant in the state of São Paulo. For this, samples were taken during the period from June 2008 to July 2009. Samples were collected from the surface of the receiving and storage tanks of raw milk, the surface of the balance tank of pasteurized milk, the water supply system, the pipes and equipments, the hands of the handler and from the packaged cheese, totaling 140 samples. The colonies isolated on Baird-Parker Agar confirmed as Gram positive and positive for catalase, coagulase and acetoin production, were submitted to extraction of bacterial DNA using the Invitek - Uniscience® kit. Confirmation of the isolated species and enterotoxins SEA, SEB, SEC, SED and TSST-1 toxin was carried out through the amplification of specific fragments of chromosomal DNA. Among the 74 strains of isolated coagulase-positive staphylococci, only 41 (55.4%) strains were confirmed as Staphylococcus aureus, of which 25 (61.0%) were positive to the presence of staphylococcal toxins. The most frequently identified enterotoxin was SEA. The toxigenic strains of Staphylococcus aureus were more frequently isolated from hands of the handler (16.0%), raw milk receiving tank (12.0%), pasteurized milk for cheese making (12.0%) and fresh white cheese ready for consumption (12.0%).

Relevância:

10.00% 10.00%

Publicador:

Resumo:

The aim of the study was to test the molecular and serological prevalence of Anaplasma marginale in water buffaloes of the Marajó Island, State of Pará, Brazil. For serologic research were randomly selected 800 buffaloes and for molecular research 50 of these animals were randomly chosen. To quantify the serological prevalence we used the indirect enzyme linked immunosorbent assay (iELISA) with total antigen containing proteins outer surface. To quantify the prevalence molecular was used the polymerase chain reaction (PCR) involving gene amplification fragment larger surface protein 5 (MSP5). The prevalence of positive animals in iELISA was 25% (200/800). In the PCR we detected the presence of A. marginale in 2% (1/50) of animals. Although only one animal was positive in PCR, we found that it was negative in ELISA. The presence of the agent, even in low prevalence, shows that buffaloes can act as an important reservoir for transmission of the pathogen to cattle in northern Brazil.