B cells expressing IL-10 mRNA modulate memory T cells after DNA-Hsp65 immunization

In DNA vaccines, the gene of interest is cloned into a bacterial plasmid that is engineered to induce protein production for long periods in eukaryotic cells. Previous research has shown that the intramuscular immunization of BALB/c mice with a naked plasmid DNA fragment encoding the Mycobacterium leprae 65-kDa heat-shock protein (pcDNA3-Hsp65) induces protection against M. tuberculosis challenge. A key stage in the protective immune response after immunization is the generation of memory T cells. Previously, we have shown that B cells capture plasmid DNA-Hsp65 and thereby modulate the formation of CD8+ memory T cells after M. tuberculosis challenge in mice. Therefore, clarifying how B cells act as part of the protective immune response after DNA immunization is important for the development of more-effective vaccines. The aim of this study was to investigate the mechanisms by which B cells modulate memory T cells after DNA-Hsp65 immunization. C57BL/6 and BKO mice were injected three times, at 15-day intervals, with 100 µg naked pcDNA-Hsp65 per mouse. Thirty days after immunization, the percentages of effector memory T (TEM) cells (CD4+ and CD8+/CD44high/CD62Llow) and memory CD8+ T cells (CD8+/CD44high/CD62Llow/CD127+) were measured with flow cytometry. Interferon γ, interleukin 12 (IL-12), and IL-10 mRNAs were also quantified in whole spleen cells and purified B cells (CD43−) with real-time qPCR. Our data suggest that a B-cell subpopulation expressing IL-10 downregulated proinflammatory cytokine expression in the spleen, increasing the survival of CD4+ TEM cells and CD8+ TEM/CD127+ cells.

Deoxynivalenol (DON) degradation and peroxidase enzyme activity in submerged fermentation

This work aims to evaluate deoxynivalenol degradation by Aspergillus oryzae and Rhizopus oryzae in a submerged fermentation system and to correlate it to the activity of oxydo-reductase enzymes. The submerged medium consisted of sterile distilled water contaminated with 50 μg of DON and 4 × 10(6) spore.mL-1 inoculum of Aspergillus oryzae and Rhizopus oryzae species, respectively in each experiment. Sampling was performed every 24 hours for monitoring the peroxidase specific activity, and every 48 hours for determining mycotoxin levels. Results showed that the fungi species were able to decrease DON levels as the peroxidase activity increased. The 48 hours fermentation interval presented the highest peroxidase specific activity (ΔABS/minute.μg.protein-1), 800 and 198, while the highest DON degradation velocity was 10.8 and 12.4 ppb/hour, respectively in both cases for Rhizopus oryzae and Aspergillus oryzae.

Color degradation kinetics in low-calorie strawberry and guava jellies

The purpose of this study was to follow-up color changes in low-calorie strawberry and guava jellies during storage. To this end, one formulation of each flavor was prepared varying the application of hydrocolloids (pectin and modified starch). The jellies were studied regarding pH, soluble solids, water activity and syneresis. In order to follow-up color changes, the samples remained stored for 180 days in chambers with controlled temperatures of 10 °C (control) and 25 °C (commercial), and color instrumental analyses (L*, a*, and b*) were performed every 30 days. Arrhenius model was applied to reaction speeds (k) at different temperatures, where light strawberry and guava jellies showed greater color changes when stored at 25 °C compared to the samples stored at 10 °C. Activation energy values between 13 and 15 kcal.mol-1 and Q10 values between 2.1 and 2.3 were obtained for light strawberry jelly and light guava jelly, respectively. Therefore, it was concluded that, with respect to color changes, every 10 °C temperature increase reduces light jellies shelf-life by half.

Changes in breaded chicken and oil degradation during discontinuous frying with cottonseed oil

Discontinuous frying of breaded chicken in cottonseed oil was evaluated. Three 400 g batches of foodstuff were fried daily in a 28 L fryer at 182 °C for 4.5 minutes for 7-8 days, and the experiment was repeated three times. The total polar compounds in the oil were determined by the conventional method. Changes in the oil were determined by the quick tests Testo 265, Viscofrit and Fri-check based on physical constants, and the results were compared with those of total polar compounds obtained by the conventional method. The free fatty acids, conjugated dienes, Lovibond color, oxidative stability, fatty acid composition, and polymeric compounds were also determined. During frying, the oil samples presented 6.0-39.2% total polar compounds, 0.0-12.9% polymerized triacylglycerols, 1.3-14.5% oxidized triacylglycerols, 2.8-11.0% diacylglycerols, and 1.6-2.6% fatty acids and unsaponifiable polar compounds. The breaded chicken samples lost moisture, absorbed oil up to approximately 6%, and there were small changes in the fatty acid composition and low formation of trans-isomers. The best method for monitoring and discarding the oil was that used for the determination of total polar compounds.

Padronização da metodologia do RT-PCR utilizado para identificação do mRNA da alfa-amilase em sementes de milho

Durante a germinação das sementes, os carboidratos de reserva são degradados pela atividade de a-amilase. A identificação de mRNA é uma ferramenta fundamental para a definição da cinética de síntese de alfa-amilase. Objetivou-se padronizar a metodologia do RT-PCR para identificar o mRNA do gene de a-amilase em sementes de milho. Após três dias de germinação das cultivares Saracura-BRS 4154 e CATI-AL34, extraiu-se o RNA total pelo método do tiocianato de guanidina-fenol-clorofórmio, com algumas modificações. A partir do RNA total extraído foi obtido cDNA com utilização de "random primers". A amplificação por PCR de uma porção do gene da alfa-amilase foi realizada com os "primers": "sense" - CGACATCGACCACCTCAAC; "antisense" - TTGACCAGCTCCTGCCTGTC; gelatina; DMSO e 1,25 unidades de Taq DNA polimerase por reação e completados com água tratada com DEPC. Os ciclos para a amplificação foram 94ºC durante 4 minutos, seguidos por 34 ciclos de 94ºC durante 1 minuto, 42ºC durante 1 minuto e 72ºC durante 1,5 minutos e, finalmente, 72ºC por 5 minutos. O produto do RT-PCR apresentou uma banda de 249 pares de base (pb) bem definida, para as duas cultivares estudadas, não ocorrendo bandas inespecíficas. A técnica do RT-PCR mostrou ser uma metodologia eficiente para a identificação da expressão de alfa-amilase durante a germinação das sementes e pode ser usado para estudo qualitativo e quantitativo da cinética de síntese dessa enzima em experimentos de germinação.

Performance Degradation Modelling and Techno-Economic Analysis of Lithium-Ion Battery Energy Storage Systems

Transmission system operators and distribution system operators are experiencing new challenges in terms of reliability, power quality, and cost efficiency. Although the potential of energy storages to face those challenges is recognized, the economic implications are still obscure, which introduce the risk into the business models. This thesis aims to investigate the technical and economic value indicators of lithium-ion battery energy storage systems (BESS) in grid-scale applications. In order to do that, a comprehensive performance lithium-ion BESS model with degradation effects estimation is developed. The model development process implies literature review on lifetime modelling, use, and modification of previous study progress, building the additional system parts and integrating it into a complete tool. The constructed model is capable of describing the dynamic behavior of the BESS voltage, state of charge, temperature and capacity loss. Five control strategies for BESS unit providing primary frequency regulation are implemented, in addition to the model. The questions related to BESS dimensioning and the end of life (EoL) criterion are addressed. Simulations are performed with one-month real frequency data acquired from Fingrid. The lifetime and cost-benefit analysis of the simulation results allow to compare and determine the preferable control strategy. Finally, the study performs the sensitivity analysis of economic profitability with variable size, EoL and system price. The research reports that BESS can be profitable in certain cases and presents the recommendations.

Analyses, persistence an degradation of the synthetic pyrethroid insecticides permethrin and fenvalerate

Studies on persistence and degradation of the synthetic pyrethroid insecticides, permethrin and fenvalerate, were carried out under natural environmental conditions of the Niagara Peninsula. Permethrin and fenvalerate were treated on apple foliage atrat~s of 0.21 kg(AI)!ha and 0.14 kg(AI)/ha, respectively. The initial cis- and trans-permethrin spray deposits were found to be 13.5 ppm and 19.2 ppm, respectively and 38.0 ppm was observed for the fenvalerate treated sample. Twenty-three days and 84 days after spray application, permethrin residues were 4.0 ppm and 2.7 ppm for the cis-isomer, whereas they were 7.9 ppm and 4.7 ppm for the trans-isomer, respectively. Residues of fenvalerate 23 days and 84 days after spray application were 13.4 ppm and 8.0 ppm, respectively. The values of observed half-life of cis-permethrin, trans-permethrin and fenvalerate were found to be 42 days, 46 days and 51 days, respectively. Studies were extended to quantitatively determine some of the major degradation compounds of permethrin and fenvalerate, which were expected to be produced as results of ester cleavage of the parent compounds. A permethrin treated sample, 84 days after initial spray application, showed 0.25 and 0.8 ppm of cis- and trans-3-(2,2-dichlorovinyl)-2,2-dimethylcyclopropanecarboxylic acid (C12CA (18), respectively. These two acids were not found as free acids, but found as conjugated compounds. The other expected degradation compounds, 3-phenoxybenzyl alcohol (PBalc (~)),3-phenoxybenz.aldehyde (PBald (38)) and 2- (4-chlorophenyl) isovaleric acid (CPIA (31)) were not detected by the methods employed in this study. The results indicate that these degradation compounds were not present, or, if they were present, their concentrations were too low to detect by the methods used.

The identification, distribution and persistence of oxamyl and its degradation products in planted corn seed, seedling root and soil from oxamyl-treated corn seeds

A simple method was developed for treating corn seeds with oxamyl. It involved soaking the seeds to ensure oxamyl uptake, centrifugation to draw off excess solution, and drying under a stream of air to prevent the formation of fungus. The seeds were found to have an even distribution of oxamyl. Seeds remained fungus-free even 12 months after treatment. The highest nonphytotoxic treatment level was obtained by using a 4.00 mg/mL oxamyl solution. Extraction methods for the determination of oxamyl (methyl-N'N'-dimethyl-N-[(methylcarbamoyl)oxy]-l-thiooxamimidate), its oxime (methyl-N',N'-dimethyl-N-hydroxy-1-thiooxamimidate), and DMCF (N,N-dimethyl-1-cyanoformanade) in seed" root, and soil were developed. Seeds were processed by homogenizing, then shaking in methanol. Significantly more oxamyl was extracted from hydrated seeds as opposed to dry seeds. Soils were extracted by tumbling in methanol; recoveries range~ from 86 - 87% for oxamyl. Root was extracted to 93% efficiency for oxamyl by homogenizing the tissue in methanol. NucharAttaclay column cleanup afforded suitable extracts for analysis by RP-HPLC on a C18 column and UV detection at 254 nm. In the degradation study, oxamyl was found to dissipate from the seed down into the soil. It was also detected in the root. Oxime was detected in both the seed and soil, but not in the root. DMCF was detected in small amounts only in the seed.

A Survey of hMLH1 mRNA Splicing Profiles in Human Cell Lines: Comparing Primary Cultured Fibroblasts Before and After Oxidative Stress and Transiently versus Stably Demethylated Colon Cancer Derived Cell Lines

Most human genes undergo alternative splicing and loss of splicing fidelity is associated with disease. Epigenetic silencing of hMLH 1 via promoter cytosine methylation is causally linked to a subset of sporadic non-polyposis colon cancer and is reversible by 5-aza-2' -deoxycytidine treatment. Here I investigated changes in hMLHI mRNA splicing profiles in normal fibroblasts and colon cancer-derived human cell lines. I established the types and frequencies of hMLHI mRNA transcripts generated under baseline conditions, after hydrogen peroxide induced oxidative stress, and in acutely 5-aza-2' -deoxycytidine-treated and stably derepressed cancer cell lines. I found that hMLHI is extensively spliced under all conditions including baseline (50% splice variants), the splice variant distribution changes in response to oxidative stress, and certain splice variants are sensitive to 5- aza-2' -deoxycytidine treatment: Splice variant diversity and frequency of exon 17 skipping correlates with the level of hMLHI promoter methylation suggesting a link between promoter methylation and mRNA splicing.

The shunt from the cyclooxygenase to lipoxygenase pathway in human osteoarthritic subchondral osteoblasts is linked with a variable expression of the 5-lipoxygenase-activating protein

Affiliation: Unité de recherche en Arthrose, Centre de recherche du Centre Hospitalier de l'Université de Montréal, Hôpital Notre-Dame

Requirements for the selective degradation of CD4 receptor molecules by the human immunodeficiency virus type 1 Vpu protein in the endoplasmic reticulum.

BACKGROUND: HIV-1 Vpu targets newly synthesized CD4 receptor for rapid degradation by a process reminiscent of endoplasmic reticulum (ER)-associated protein degradation (ERAD). Vpu is thought to act as an adaptor protein, connecting CD4 to the ubiquitin (Ub)-proteasome degradative system through an interaction with beta-TrCP, a component of the SCFbeta-TrCP E3 Ub ligase complex. RESULTS: Here, we provide direct evidence indicating that Vpu promotes trans-ubiquitination of CD4 through recruitment of SCFbeta-TrCP in human cells. To examine whether Ub conjugation occurs on the cytosolic tail of CD4, we substituted all four Ub acceptor lysine residues for arginines. Replacement of cytosolic lysine residues reduced but did not prevent Vpu-mediated CD4 degradation and ubiquitination, suggesting that Vpu-mediated CD4 degradation is not entirely dependent on the ubiquitination of cytosolic lysines and as such might also involve ubiquitination of other sites. Cell fractionation studies revealed that Vpu enhanced the levels of ubiquitinated forms of CD4 detected in association with not only the ER membrane but also the cytosol. Interestingly, significant amounts of membrane-associated ubiquitinated CD4 appeared to be fully dislocated since they could be recovered following sodium carbonate salt treatment. Finally, expression of a transdominant negative mutant of the AAA ATPase Cdc48/p97 involved in the extraction of ERAD substrates from the ER membrane inhibited Vpu-mediated CD4 degradation. CONCLUSION: Taken together, these results are consistent with a model whereby HIV-1 Vpu targets CD4 for degradation by an ERAD-like process involving most likely poly-ubiquitination of the CD4 cytosolic tail by SCFbeta-TrCP prior to dislocation of receptor molecules across the ER membrane by a process that depends on the AAA ATPase Cdc48/p97.

Régulation de la proprotéine convertase subtilisine / kexine type 9 (PCSK9) dans les cellules intestinales Caco-2/15

La proprotéine convertase subtilisine/kexine type 9 (PCSK9) favorise la dégradation post-transcriptionnelle du récepteur des lipoprotéines de faible densité (LDLr) dans les hépatocytes et augmente le LDL-cholestérol dans le plasma. Cependant, il n’est pas clair si la PCSK9 joue un rôle dans l’intestin. Dans cette étude, nous caractérisons les variations de la PCSK9 et du LDLr dans les cellules Caco-2/15 différentiées en fonction d’une variété d’effecteurs potentiels. Le cholestérol (100 µM) lié à l’albumine ou présenté en micelles a réduit de façon significative l’expression génique (30%, p<0,05) et l’expression protéique (50%, p<0,05) de la PCSK9. Étonnamment, une diminution similaire dans le LDLr protéique a été enregistrée (45%, p<0,05). Les cellules traitées avec le 25-hydroxycholestérol (50 µM) présentent également des réductions significatives dans l’ARNm (37%, p<0,01) et la protéine (75%, p<0,001) de la PCSK9. Une baisse des expressions génique (30%, p<0,05) et protéique (57%, p<0,01) a également été constatée dans le LDLr. Des diminutions ont aussi été observées pour la HMG CoA réductase et la protéine liant l’élément de réponse aux stérols SREBP-2. Il a été démontré que le SREBP-2 peut activer transcriptionnellement la PCSK9 par le biais de la liaison de SREBP-2 à son élément de réponse aux stérols situé dans la région proximale du promoteur de la PCSK9. Inversement, la déplétion du contenu cellulaire en cholestérol par l’hydroxypropyl-β-cyclodextrine a augmenté l’expression génique de la PCSK9 (20%, p<0,05) et son contenu protéique (540%, p<0,001), en parallèle avec les niveaux protéiques de SREBP-2. L’ajout des acides biliaires taurocholate et déoxycholate dans le milieu apical des cellules intestinales Caco-2/15 a provoqué une baisse d’expression génique (30%, p<0,01) et une hausse d’expression protéique (43%, p<0,01) de la PCSK9 respectivement, probablement via la modulation du FXR (farnesoid X receptor). Ces données combinées semblent donc indiquer que la PCSK9 fonctionne comme un senseur de stérols dans le petit intestin.

Les R-loops et leurs conséquences sur l'expression génique chez Escherichia coli.

Des variations importantes du surenroulement de l’ADN peuvent être générées durant la phase d’élongation de la transcription selon le modèle du « twin supercoiled domain ». Selon ce modèle, le déplacement du complexe de transcription génère du surenroulement positif à l’avant, et du surenroulement négatif à l’arrière de l’ARN polymérase. Le rôle essentiel de la topoisomérase I chez Escherichia coli est de prévenir l’accumulation de ce surenroulement négatif générée durant la transcription. En absence de topoisomérase I, l’accumulation de ce surenroulement négatif favorise la formation de R-loops qui ont pour conséquence d’inhiber la croissance bactérienne. Les R-loops sont des hybrides ARN-ADN qui se forment entre l’ARN nouvellement synthétisé et le simple brin d’ADN complémentaire. Dans les cellules déficientes en topoisomérase I, des mutations compensatoires s’accumulent dans les gènes qui codent pour la gyrase, réduisant le niveau de surenroulement négatif du chromosome et favorisant la croissance. Une des ces mutations est une gyrase thermosensible qui s’exprime à 37 °C. La RNase HI, une enzyme qui dégrade la partie ARN d’un R-loop, peut aussi restaurer la croissance en absence de topoisomérase I lorsqu’elle est produite en très grande quantité par rapport à sa concentration physiologique. En présence de topoisomérase I, des R-loops peuvent aussi se former lorsque la RNase HI est inactive. Dans ces souches mutantes, les R-loops induisent la réponse SOS et la réplication constitutive de l’ADN (cSDR). Dans notre étude, nous montrons comment les R-loops formés en absence de topoisomérase I ou RNase HI peuvent affecter négativement la croissance des cellules. Lorsque la topoisomérase I est inactivée, l’accumulation d’hypersurenroulement négatif conduit à la formation de nombreux R-loops, ce qui déclenche la dégradation de l’ARN synthétisé. Issus de la dégradation de l’ARNm de pleine longueur, des ARNm incomplets et traductibles s’accumulent et causent l’inhibition de la synthèse protéique et de la croissance. Le processus par lequel l’ARN est dégradé n’est pas encore complètement élucidé, mais nos résultats soutiennent fortement que la RNase HI présente en concentration physiologique est responsable de ce phénotype. Chose importante, la RNase E qui est l’endoribonuclease majeure de la cellule n’est pas impliquée dans ce processus, et la dégradation de l’ARN survient avant son action. Nous montrons aussi qu’une corrélation parfaite existe entre la concentration de RNase HI, l’accumulation d’hypersurenroulement négatif et l’inhibition de la croissance bactérienne. Lorsque la RNase HI est en excès, l’accumulation de surenroulement négatif est inhibée et la croissance n’est pas affectée. L’inverse se produit Lorsque la RNase HI est en concentration physiologique. En limitant l’accumulation d’hypersurenroulement négatif, la surproduction de la RNase HI prévient alors la dégradation de l’ARN et permet la croissance. Quand la RNase HI est inactivée en présence de topoisomérase I, les R-loops réduisent le niveau d’expression de nombreux gènes, incluant des gènes de résistance aux stress comme rpoH et grpE. Cette inhibition de l’expression génique n’est pas accompagnée de la dégradation de l’ARN contrairement à ce qui se produit en absence de topoisomérase I. Dans le mutant déficient en RNase HI, la diminution de l’expression génique réduit la concentration cellulaire de différentes protéines, ce qui altère négativement le taux de croissance et affecte dramatiquement la survie des cellules exposées aux stress de hautes températures et oxydatifs. Une inactivation de RecA, le facteur essentiel qui déclenche la réponse SOS et le cSDR, ne restaure pas l’expression génique. Ceci démontre que la réponse SOS et le cSDR ne sont pas impliqués dans l’inhibition de l’expression génique en absence de RNase HI. La croissance bactérienne qui est inhibée en absence de topoisomérase I, reprend lorsque l’excès de surenroulement négatif est éliminé. En absence de RNase HI et de topoisomérase I, le surenroulement négatif est très relaxé. Il semble que la réponse cellulaire suite à la formation de R-loops, soit la relaxation du surenroulement négatif. Selon le même principe, des mutations compensatoires dans la gyrase apparaissent en absence de topoisomérase I et réduisent l’accumulation de surenroulement négatif. Ceci supporte fortement l’idée que le surenroulement négatif joue un rôle primordial dans la formation de R-loop. La régulation du surenroulement négatif de l’ADN est donc une tâche essentielle pour la cellule. Elle favorise notamment l’expression génique optimale durant la croissance et l’exposition aux stress, en limitant la formation de R-loops. La topoisomérase I et la RNase HI jouent un rôle important et complémentaire dans ce processus.

L’étude de l’interaction entre les chondrocytes et le collagène modifié par le 4-Hydroxynonénal : implication dans le développement de l’arthrose

OBJECTIF: Récemment, nous avons démontré que la modification du collagène type II (Col II) par le 4-hydroxynonénal (HNE), un produit de la peroxydation lipidique, est augmentée dans le cartilage arthrosique sans qu’on sache la signification de cette augmentation dans la pathogenèse de l’arthrose. L’objectif de cette étude vise à démontrer que cette modification affecte l’interaction chondrocytes/matrice extracellulaire (MEC) et en conséquence induit des changements phénotypiques et fonctionnels de ces cellules. METHODES: Des plaques de culture ont été préalablement cotées avec du Col II puis traitées avec du HNE (0.1-2 mM) excepté le puits contrôle. Les chondrocytes ont été ensuite ensemencés puis incubés pendant 48 heures. La viabilité des cellules est évaluée par le test MTT. Le Western blot est utilisé pour mesurer l’expression des molécules d’adhésion (l’ICAM-1 et l’intégrine α1β1), de la cyclooxygenase-2 (COX-2), du Col II ainsi que la phosphorylation de la p38 MAPK, ERK1/2 et NF-κB-p65. La RT-PCR en temps réel est utilisée pour mesurer l’expression de l’ARNm de l’ICAM-1, des intégrines α1β1, de la COX-2 et de la métalloprotéinases-13 (MMP-13). La détermination de l’expression de l’ICAM-1 à la surface des cellules est réalisée par cytométrie de flux. Des kits commerciaux ont servi pour mesurer le niveau de la MMP-13, de la prostaglandine E2 (PGE2), de l’activité de la caspase-8 et de la phosphorylation de la p38 MAPK, ERK1/2 et NF-κB-p65. RESULTATS: La modification du Col II par 0.2 mM HNE induit significativement l’expression des molécules d’adhésion telles que l’ICAM-1 et l’intégrine α1β1, de la MMP-13 sans avoir un effet sur la morphologie, la survie et le phénotype cellulaires. Nos résultats montrent aussi une forte augmentation de la phosphorylation de la p38 MAPK, d’ERK1/2 et de NF-κB-p65. Cependant, la modification du Col II par 2 mM HNE affecte la morphologie et la viabilité cellulaires et induit l’activité de la caspase-8. Elle inhibe fortement l’expression des integrines α1β1 et du Col II ainsi que la phosphorylation de l’ERK1/2 et de NF-κB-p65, mais par contre, induit significativement la production de la COX-2 et son produit la PGE2 ainsi que la phosphorylation de la p38 MAPK. Fait intéressant, le prétraitement des complexes HNE/Col II par 0.1 mM de carnosine empêche les changements phénotypiques et fonctionnels des chondrocytes. CONCLUSION : Ces nouveaux résultats suggèrent le rôle important de la modification du Col II par le HNE dans l’arthrose, en affectant le phénotype et le fonctionnement cellulaires des chondrocytes. La carnosine, par sa capacité de neutraliser le HNE, a révélé d’être un agent promoteur dans le traitement de l’arthrose.