818 resultados para lectron back-scattered diffraction


Relevância:

20.00% 20.00%

Publicador:

Resumo:

Advances made over the past decade in structure determination from powder diffraction data are reviewed with particular emphasis on algorithmic developments and the successes and limitations of the technique. While global optimization methods have been successful in the solution of molecular crystal structures, new methods are required to make the solution of inorganic crystal structures more routine. The use of complementary techniques such as NMR to assist structure solution is discussed and the potential for the combined use of X-ray and neutron diffraction data for structure verification is explored. Structures that have proved difficult to solve from powder diffraction data are reviewed and the limitations of structure determination from powder diffraction data are discussed. Furthermore, the prospects of solving small protein crystal structures over the next decade are assessed.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Recent developments in instrumentation and facilities for sample preparation have resulted in sharply increased interest in the application of neutron diffraction. Of particular interest are combined approaches in which neutron methods are used in parallel with X-ray techniques. Two distinct examples are given. The first is a single-crystal study of an A-DNA structure formed by the oligonucleotide d(AGGGGCCCCT)2, showing evidence of unusual base protonation that is not visible by X-ray crystallography. The second is a solution scattering study of the interaction of a bisacridine derivative with the human telomeric sequence d(AGGGTTAGGGTTAGGGTTAGGG) and illustrates the differing effects of NaCl and KCl on this interaction.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The ability to display and inspect powder diffraction data quickly and efficiently is a central part of the data analysis process. Whilst many computer programs are capable of displaying powder data, their focus is typically on advanced operations such as structure solution or Rietveld refinement. This article describes a lightweight software package, Jpowder, whose focus is fast and convenient visualization and comparison of powder data sets in a variety of formats from computers with network access. Jpowder is written in Java and uses its associated Web Start technology to allow ‘single-click deployment’ from a web page, http://www.jpowder.org. Jpowder is open source, free and available for use by anyone.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The structure of single wall peptide nanotubes is presented for the model surfactant-like peptide A6K. Capillary flow alignment of a sample in the nematic phase at high concentration in water leads to oriented X-ray diffraction patterns. Analysis of these, accompanied by molecular dynamics simulations, suggests the favourable self-assembly of antiparallel peptide dimers into beta-sheet ribbons that wrap helically to form the nanotube wall.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The low-energy electron diffraction (LEED) pattern of the step-kinked Pt{531} surface at 200 K shows energy-dependent cancellation of diffraction spots over unusually large energy ranges, up to 100 eV. This cannot be reproduced theoretically when a flat surface geometry is assumed. A relatively simple model of roughening, however, involving 0.25 ML of vacancies and adatoms leads to very good agreement with the experiment. The cancellation of intensities within a very narrow range of adatom or vacancy coverages is caused by the interference of electrons emerging from different heights but similar local environments. This is a rare example where the energy dependence of integrated LEED spot intensities is dramatically affected by the long-range arrangement of atoms.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

We describe a FORTRAN-90 program that computes scattering t-matrices for a molecule. These can be used in a Low-Energy Electron Diffraction program to solve the molecular structural problem very efficiently. The intramolecular multiple scattering is computed within a Dyson-like approach, using free space Green propagators in a basis of spherical waves. The advantage of this approach is related to exploiting the chemical identity of the molecule, and to the simplicity to translate and rotate these t-matrices without performing a new multiple-scattering calculation for each configuration. FORTRAN-90 routines for rotating the resulting t-matrices using Wigner matrices are also provided.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

We describe a FORTRAN-90 program to compute low-energy electron diffraction I(V) curves. Plane-waves and layer doubling are used to compute the inter-layer multiple-scattering, while the intra-layer multiple-scattering is computed in the standard way expanding the wavefield on a basis of spherical waves. The program is kept as general as possible, in order to allow testing different parts of multiple-scattering calculations. In particular, it can handle non-diagonal t-matrices describing the scattering of non-spherical potentials, anisotropic vibrations, anharmonicity, etc. The program does not use old FORTRAN flavours, and has been written keeping in mind the advantage for parallelism brought forward by FORTRAN-90.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The aim of this paper is to show the feasibility of the use of functional electrical stimulation (FES) applied to the lower back muscles for pressure sores prevention in paraplegia. The hypothesis under study is that FES induces a change in the pressure distribution on the contact area during sitting. Tests were conducted on a paraplegic subject (T5), sitting on a standard wheelchair and cushion. Trunk extensors (mainly the erector spinae) were stimulated using surface electrodes placed on the skin. A pressure mapping system was used to measure the pressure on the sitting surface in four situations: (a) no stimulation; (b) stimulation on one side of the spine only; (c) stimulation on both sides, at different levels; and (d) stimulation at the same level on both sides, during pressure-relief manoeuvres. A session of prolonged stimulation was also conducted. The experimental results show that the stimulation of the erector spinae on one side of the spine can induce a trunk rotation on the sagittal plane, which causes a change in the pressure distribution. A decrease of pressure on the side opposite to the stimulation was recorded. The phenomenon is intensified when different levels of stimulation are applied to the two sides, and such change can be sustained for a considerable time (around 5 minutes). The stimulation did not induce changes during pressure-relief manoeuvres. Finally, from this research we can conclude that the stimulation of the trunk extensors can be a useful tool for pressure sores prevention, and can potentially be used in a routine for pressure sores prevention based on periodical weight shifts.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

YqjH is a cytoplasmic FAD-containing protein from Escherichia coli; based on homology to ViuB of Vibrio cholerae, it potentially acts as a ferri-siderophore reductase. This work describes its overexpression, purification, crystallization and structure solution at 3.0 A resolution. YqjH shares high sequence similarity with a number of known siderophore-interacting proteins and its structure was solved by molecular replacement using the siderophore-interacting protein from Shewanella putrefaciens as the search model. The YqjH structure resembles those of other members of the NAD(P)H:flavin oxidoreductase superfamily.

Relevância:

20.00% 20.00%

Publicador: