Th1 CD4+ lymphocytes delete activated macrophages through the Fas/APO-1 antigen pathway.

The Fas/APO-1 cytotoxic pathway plays an important role in the regulation of peripheral immunity. Recent evidence indicates that this regulatory function operates through deletion of activated T and B lymphocytes by CD4+ T cells expressing the Fas ligand. Because macrophages play a key role in peripheral immunity, we asked whether Fas was involved in T-cell-macrophage interactions. Two-color flow cytometry revealed that Fas receptor (FasR) was expressed on resting murine peritoneal macrophages. FasR expression was upregulated after activation of macrophages with cytokines or lipopolysaccharide, although only tumor necrosis factor-alpha rendered macrophages sensitive to anti-FasR antibody-mediated death. To determine the consequence of antigen presentation by macrophages to CD4+ T cells, macrophages were pulsed with antigen and then incubated with either Th1 or Th2 cell lines or clones. Th1, but not Th2, T cells induced lysis of 60-80% of normal macrophages, whereas macrophages obtained from mice with mutations in the FasR were totally resistant to Th1-mediated cytotoxicity. Macrophage cytotoxicity depended upon specific antigen recognition by T cells and was major histocompatibility complex restricted. These findings indicate that, in addition to deletion of activated lymphocytes, Fas plays an important role in deletion of activated macrophages after antigen presentation to Th1 CD4+ T cells. Failure to delete macrophages that constitutively present self-antigens may contribute to the expression of autoimmunity in mice deficient in FasR (lpr) or Fas ligand (gld).

Low density lipoprotein receptor-related protein mediates apolipoprotein E-dependent neurite outgrowth in a central nervous system-derived neuronal cell line.

The epsilon 4 allele of apolipoprotein E (apoE) is a major risk factor for Alzheimer disease, suggesting that apoE may directly influence neurons in the aging brain. Recent data suggest that apoE-containing lipoproteins can influence neurite outgrowth in an isoform-specific fashion. The neuronal mediators of apoE effects have not been clarified. We show here that in a central nervous system-derived neuronal cell line, apoE3 but not apoE4 increases neurite extension. The effect of apoE3 was blocked at low nanomolar concentrations by purified 39-kDa protein that regulates ligand binding to the low density lipoprotein receptor-related protein (LRP). Anti-LRP antibody also completely abolished the neurite-promoting effect of apoE3. Understanding isoform-specific cell biological processes mediated by apoE-LRP interactions in central nervous system neurons may provide insight into Alzheimer disease pathogenesis.

Interleukin 1 beta up-regulates the expression of sulfoglucuronosyl paragloboside, a ligand for L-selectin, in brain microvascular endothelial cells.

Treatment of cultured bovine brain microvascular endothelial cells (BMECs) with interleukin 1 beta (IL-1 beta), an inflammatory cytokine, was shown to induce the accumulation of sulfoglucuronosyl paragloboside (SGPG), a glycolipid bearing the HNK-1 epitope. This resulted in the attachment of a greater number of human lymphocytes to the treated than to the untreated BMEC monolayers. Attachment of human lymphocytes to the IL-1 beta-activated BMEC cells could be blocked either by incubation of the human lymphocytes with an anti-L-selectin antibody or by application of an anti-SGPG antibody to the BMECs. These results suggest that SGPG may act as an important ligand for L-selectin for the regulation of the attachment of activated lymphocytes and their subsequent invasion into the nervous system parenchyma in inflammatory disorders of the central and peripheral nervous systems.

The bacterial colicin active against tumor cells in vitro and in vivo is verotoxin 1.

We have identified verotoxin 1 (VT1) as the active component within an antineoplastic bacteriocin preparation from Escherichia coli HSC10 studied over two decades. Recombinant VT1 can simulate the toxicity of anticancer proteins (ACP), and the antineoplastic activity of ACP (and VT1) was abrogated by treatment with anti-VT1 antibody. Similarly, VT1 mimics the protective effect of ACP in a murine metastatic fibrosarcoma model. Prior immunization with VT1 B subunit prevents the effect of VT1 or ACP in this model. The activity of ACP against a variety of human ovarian cell lines was mimicked by VT1, and multidrug-resistant variants were significantly hypersensitive. Primary ovarian tumors and metastases contain elevated levels of globotriaosylceramide compared with normal ovaries, and overlay of frozen tumor sections showed selective VT binding to tumor tissue and the lumen of invading blood vessels. Our contention that VT1 could provide an additional approach to the management of certain human neoplasms is discussed.

Synergy between T-cell immunity and inhibition of paracrine stimulation causes tumor rejection.

During tumor progression, variants may arise that grow more vigorously. The fate of such variants depends upon the balance between aggressiveness of the variant and the strength of the host immunity. Although enhancing host immunity to cancer is a logical objective, eliminating host factors necessary for aggressive growth of the variant should also be considered. The present study illustrates this concept in the model of a spontaneously occurring, progressively growing variant of an ultraviolet light-induced tumor. The variant produces chemotactic factors that attract host leukocytes and is stimulated in vitro by defined growth factors that can be produced or induced by leukocytes. This study also shows that CD8+ T-cell immunity reduces the rate of tumor growth; however, the variant continues to grow and kills the host. Treatment with a monoclonal anti-granulocyte antibody that counteracts the infiltration of the tumor cell inoculum by non-T-cell leukocytes did not interfere with the CD8+ T-cell-mediated immune response but resulted in rejection of the tumor challenge, indicating a synergy between CD8+ T-cell-mediated immunity and the inhibition of paracrine stimulation.

Polyomavirus VP1 phosphorylation: coexpression with the VP2 capsid protein modulates VP1 phosphorylation in Sf9 insect cells.

The polyomavirus virion has an outer capsid comprised of 72 pentamers of the VP1 protein associated with the minor virion proteins, VP2 and VP3, and the viral minichromosome. To investigate the interaction between VP1 and VP2/VP3, we mapped VP1 phosphorylation sites and assayed VP1 recognition by anti-peptide antibodies after coexpression of VP1 with VP2 or VP3 by using recombinant baculovirus vectors. VP1, expressed either alone or with VP3, was phosphorylated on serine residues, which are not modified during polyomavirus infection of mouse cells. When VP1 was coexpressed with VP2, the nonphysiologic serine phosphorylation of VP1 was decreased, and a tryptic peptide containing Thr-63, a site modified during virus infection of mouse cells, was phosphorylated. An anti-peptide antibody directed against the VP1 BC loop domain containing Thr-63 recognized VP1 expressed alone but not VP1 coexpressed with VP2 or VP3. The change in phosphorylation resulting from coexpression of two structural proteins identifies the potential of the baculovirus system for studying protein-protein interactions and defines a functional role for the VP1-VP2 interaction.

Peptide mimicry of the meningococcal group C capsular polysaccharide.

Sequence analysis of the variable regions of the heavy and light chains of the anti-idiotypic antibody 6F9, which mimics the meningococcal group C capsular polysaccharide (MCP), was performed. The immunogenic site on 6F9 responsible for inducing an anti-MCP antibody response was determined by means of sequence and computer model analysis of these data. Complementarity-determining region 3 (CDR3) was found to be unique in that the sequence tract YRY was exposed on the surface. A synthetic peptide spanning the CDR3 domain was synthesized and complexed to proteosomes (meningococcal group B outer membrane protein). Immunizations of BALB/c mice with the peptide-proteosome complex resulted in a significant anti-MCP antibody response. Immunized mice were protected against infection with a lethal dose of Neisseria meningitidis serogroup C.

Prolactin-immunoglobulin G complexes from human serum act as costimulatory ligands causing proliferation of malignant B lymphocytes.

Several lines of evidence indicate that immunoglobulin-bound prolactin found in human serum is not a conventional complex between an anti-prolactin antibody and prolactin but a different type of association of prolactin with the Fab portion of IgG heavy chains. The complex of prolactin with IgG was purified from serum by anti-human prolactin affinity chromatography and was shown to contain close to 1 mole of N epsilon-(gamma-glutamyl)lysine crosslinks per mole of complex, a characteristic feature in structures crosslinked by transglutaminase. Interestingly, the complex caused a proliferation of cells from a subset of patients with chronic lymphocytic leukemia, while it was inactive in a cell proliferation prolactin bioassay. By contrast, human prolactin stimulated the proliferation of cells in the bioassay but had no effect on the complex-responsive cells from the patients. Competition studies with prolactin and free Fc fragment of IgG demonstrated a necessity for engaging both the prolactin and the immunoglobulin receptors for proliferation. More importantly, competition for the growth response by free prolactin and IgG suggests both possible reasons for the slow growth of this neoplasm as well as avenues for control of the disease.

A regulatory element in the promoter of the human granulocyte-macrophage colony-stimulating factor gene that has related sequences in other T-cell-expressed cytokine genes.

Granulocyte-macrophage colony-stimulating factor (GM-CSF) is a cytokine with a broad spectrum of cell-differentiating and colony-stimulating activities. It is expressed by several undifferentiated (bone marrow stromal cells, fibroblasts) and fully differentiated (T cells, macrophages, and endothelial cells) cells. Its expression in T cells is activation dependent. We have found a regulatory element in the promoter of the GM-CSF gene which contains two symmetrically nested inverted repeats (-192 CTTGGAAAGGTTCATTAATGAAAACCCCCAAG -161). In transfection assays with the human GM-CSF promoter, this element has a strong positive effect on the expression of a reporter gene by the human T-cell line Jurkat J6 upon stimulation with phorbol dibutyrate and ionomycin or anti-CD3 antibody. This element also acts as an enhancer when inserted into a minimal promoter vector. In DNA band-retardation assays this sequence produces six specific bands that involve one or the other of the inverted repeats. We have also shown that a DNA-protein complex can be formed involving both repeats and probably more than one protein. The external inverted repeat contains a core sequence CTTGG...CCAAG, which is also present in the promoters of several other T-cell-expressed human cytokines (interleukins 4, 5, and 13). The corresponding elements in GM-CSF and interleukin 5 promoters compete for the same proteins in band-retardation assays. The palindromic elements in these genes are larger than the core sequence, suggesting that some of the interacting proteins may be different for different genes. Considering the strong positive regulatory effect and their presence in several T-cell-expressed cytokine genes, these elements may be involved in the coordinated expression of these cytokines in T-helper cells.

GFP-tagged CFTR transgene is functional in the G551D cystic fibrosis mouse colon

Trafficking of the cystic fibrosis transmembrane conductance regulator (CFTR) is central to its function, with the most common mutation, DeltaF508, resulting in abnormal processing and trafficking. Therefore, there is a significant need to develop tools, which enable the trafficking of CFTR to be studied in vitro and in vivo. In previous studies it has been demonstrated that fusion of the green fluorescent protein (GFP) to the N-terminus of CFTR does lead to functional expression of CFTR chloride channels in epithelial cell lines. The aim of the present study was to examine whether it is possible to express GFP-tagged CFTR as a transgene in colonic and airway epithelial cells of cystic fibrosis (CF) mice and to correct the CF defect. Using the epithelial-specific human cytokeratin promoter K18, we generated bitransgenic mice cftr(G551D/G551D) K18-GFP-CFTR+/-, designated GFP mice. Transcripts for GFP-CFTR could be detected in bitransgenic mice by use of RT-PCR techniques. Expression of GFP-CFTR protein was detected specifically in the colonic epithelium by both direct GFP fluorescence and the use of an anti-GFP antibody. Ussing chamber studies showed that the ion transport defect in colon and airways observed in cftr(G551D/G551D) mice was partially corrected in the bitransgenic animals. Thus, K18-GFP-CFTR is functionally expressed in transgenic mice, which will be a valuable tool in studies on CFTR synthesis, processing and ion transport in native epithelial tissues.

Gene expression during early ascidian metamorphosis requires signaling by Hemps, an EGF-like protein

Hemps, a novel epidermal growth factor (EGF)-like protein, is expressed during larval development and early metamorphosis in the ascidian Herdmania curvata and plays a direct role in triggering metamorphosis. In order to identify downstream genes in the Hemps pathway we used a gene expression profiling approach, in which we compared post-larvae undergoing normal metamorphosis with larval metamorphosis blocked with an anti-Hemps antibody. Molecular profiling revealed that there are dynamic changes in gene expression within the first 30 minutes of normal metamorphosis with a significant portion of the genome (approximately 49%) being activated or repressed. A more detailed analysis of the expression of 15 of these differentially expressed genes through embryogenesis, larval development and metamorphosis revealed that while there is a diversity of temporal expression patterns, a number of genes are transiently expressed during larval development and metamorphosis. These and other differentially expressed genes were localised to a range of specific cell and tissue types in Herdmania larvae and post-larvae. The expression of approximately 24% of the genes that were differentially expressed during early metamorphosis was affected in larvae treated with the anti-Hemps antibody. Knockdown of Hemps activity affected the expression of a range of genes within 30 minutes of induction, suggesting that the Hemps pathway directly regulates early response genes at metamorphosis. In most cases, it appears that the Hemps pathway contributes to the modulation of gene expression, rather than initial gene activation or repression. A total of 151 genes that displayed the greatest alterations in expression in response to anti-Hemps antibody were sequenced. These genes were implicated in a range of developmental and physiological roles, including innate immunity, signal transduction and in the regulation of gene transcription. These results suggest that there is significant gene activity during the very early stages of H. curvata metamorphosis and that the Hemps pathway plays a key role in regulating the expression of many of these genes.

Human growth hormone presented by K14hGH-transgenic skin grafts induces a strong immune response but no graft rejection

Although immune responses leading to rejection of transplantable tumours have been well studied, requirements for epithelial tumour rejection are unclear. Here, we use human growth hormone (hGH) expressed in epithelial cells (skin keratinocytes) as a model neo-self antigen to investigate the consequences of antigen presentation from epithelial cells. Mice transgenic for hGH driven from the keratin 14 promoter express hGH in skin keratinocytes. This hGH-transgenic skin is not rejected by syngeneic non-transgenic recipients, although an antibody response to hGH develops in grafted animals. Systemic immunization of graft recipients with hGH peptides, or local administration of stimulatory anti-CD40 antibody, induces temporary macroscopic graft inflammation, and an obvious dermal infiltrate of inflammatory cells, but not graft rejection. These results suggest that a neo-self antigen expressed in somatic cells in skin can induce an immune response that can be enhanced further by induction of specific immunity systemically or non-specific immunity locally. However, immune responses do not always lead to rejection, despite induction of local inflammatory changes. Therefore, in vitro immune responses and in vivo delayed type hypersensitivity are not surrogate markers for immune responses effective against epithelial cells expressing neoantigens.

Nedd4-2 functionally interacts with ClC-5 - Involvement in constitutive albumin endocytosis in proximal tubule cells

Constitutive albumin uptake by the proximal tubule is achieved by a receptor-mediated process in which the Cl- channel, ClC-5, plays an obligate role. Here we investigated the functional interaction between ClC-5 and ubiquitin ligases Nedd4 and Nedd4-2 and their role in albumin uptake in opossum kidney proximal tubule (OK) cells. In vivo immunoprecipitation using an anti-HECT antibody demonstrated that ClC-5 bound to ubiquitin ligases, whereas glutathione S-transferase pull-downs confirmed that the C terminus of ClC-5 bound both Nedd4 and Nedd4-2. Nedd4-2 alone was able to alter ClC-5 currents in Xenopus oocytes by decreasing cell surface expression of ClC-5. In OK cells, a physiological concentration of albumin (10 mug/ml) rapidly increased cell surface expression of ClC-5, which was also accompanied by the ubiquitination of ClC-5. Albumin uptake was reduced by inhibiting either the lysosome or proteasome. Total levels of Nedd4-2 and proteasome activity also increased rapidly in response to albumin. Overexpression of ligase defective Nedd4-2 or knockdown of endogenous Nedd4-2 with small interfering RNA resulted in significant decreases in albumin uptake. In contrast, pathophysiological concentrations of albumin (100 and 1000 mug/ml) reduced the levels of ClC-5 and Nedd4-2 and the activity of the proteasome to the levels seen in the absence of albumin. These data demonstrate that normal constitutive uptake of albumin by the proximal tubule requires Nedd4-2, which may act via ubiquitination to shunt ClC-5 into the endocytic pathway.

Delipidation of a hepadnavirus: Viral inactivation and vaccine development

Many viruses including HIV, hepatitis C and hepatitis B, have an outer lipid envelope which maintains inserted viral peptides in the “correct” functional conformation and orientation. Disruption of the lipid envelope by most solvents destroys infectivity and often results in a loss of antigenicity. This communication outlines a novel approach to viral inactivation by specific solvent delipidation which modifies the whole virion rendering it non-infective, but antigenic. Duck hepatitis B virus (DHBV) was delipidated using a diisopropylether (DIPE) and butanol mixture and residual infectivity tested by inoculation into day-old ducks. Delipidation completely inactivated the DHBV (p < 0.001). Delipidated DHBV was then used to vaccinate ducks. Three doses of delipidated DHBV induced anti-DHBs antibody production and prevented high dose challenge infection in five out of six ducks. In comparison, five of six ducks vaccinated with undelipidated DHBV and four of four ducks vaccinated with glutaraldehyde inactivated DHBV were unprotected (p < 0.05). Although this solvent system completely inactivated DHBV, viral antigens were retained in an appropriate form to induce immunity. Delipidation of enveloped viruses with specific organic solvents has potential as the basis for development of vaccines.

Flagellin of Pseudomonas aeruginosa inhibits Na+ transport in airway epithelia

Pseudomonas aeruginosa causes severe life-threatening airway infections that are a frequent cause for hospitalization of cystic fibrosis (CF) patients. These Gram-negative pathogens possess flagella that contain the protein flagellin as a major structural component. Flagellin binds to the host cell glycolipid asialoGM1 (ASGM1), which appears enriched in luminal membranes of respiratory epithelial cells. We demonstrate that in mouse airways, luminal exposure to flagellin leads to inhibition of Na+ absorption by the epithelial Na+ channel ENaC, but does not directly induce a secretory response. Inhibition of ENaC was observed in tracheas of wild-type mice and was attenuated in mice homozygous for the frequent cystic fibrosis conductance regulator (CFTR) mutation G551D. Similar to flagellin, anti-ASGM1 antibody also inhibited ENaC. The inhibitory effects of flagellin on ENaC were attenuated by blockers of the purinergic signaling pathway, although an increase in the intracellular Ca2+ concentration by recombinant or purified flagellin or whole flagella was not observed. Because an inhibitor of the mitogen-activated protein kinase (MAPK) pathway also attenuated the effects of flagellin on Na+ absorption, we conclude that flagellin exclusively inhibits ENaC, probably due to release of ATP and activation of purinergic receptors of the P2Y subtype. Stimulation of these receptors activates the MAPK pathway, thereby leading to inhibition of ENaC. Thus, P. aeruginosa reduces Na+ absorption, which could enhance local mucociliary clearance, a mechanism that seem to be attenuated in CF.