972 resultados para Random Amplified Polymorphic DNA Technique


Relevância:

30.00% 30.00%

Publicador:

Resumo:

A technique based on the polymerase chain reaction (PCR) for the specific detection of Phytophthora medicaginis was developed using nucleotide sequence information of the ribosomal DNA (rDNA) regions. The complete IGS 2 region between the 5 S gene of one rDNA repeat and the small subunit of the adjacent repeat was sequenced for P. medicaginis and related species. The entire nucleotide sequence length of the IGS 2 of P. medicaginis was 3566 bp. A pair of oligonucleotide primers (PPED04 and PPED05), which allowed amplification of a specific fragment (364 bp) within the IGS 2 of P. medicaginis using the PCR, was designed. Specific amplification of this fragment from P. medicaginis was highly sensitive, detecting template DNA as low as 4 ng and in a host-pathogen DNA ratio of 1000000:1. Specific PCR amplification using PPED04 and PPED05 was successful in detecting P. medicaginis in lucerne stems infected under glasshouse conditions and field infected lucerne roots. The procedures developed in this work have application to improved identification and detection of a wide range of Phytophthora spp. in plants and soil.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Fragile sites are nonstaining gaps in chromosomes induced by specific tissue culture conditions. They vary both in population frequency and in the culture conditions required for induction. Folate-sensitive fragile sites are due to expansion of p(CCG)(n) trinucleotide repeats; however, the relationship between sequence composition and the chemistry of induction of fragile sites is unclear. To clarify this relationship, the distamycin A-sensitive fragile site FRA16B was isolated by positional cloning and found to be an expanded 33 bp AT-rich minisatellite repeat, p(ATATATTATATATTATATCTAATAATATAT(C)/(A)TA)(n) (consistent with DNA sequence binding preferences of chemicals that induce its cytogenetic expression). Therefore the mutation mechanism associated with trinucleotide repeats is also a property of minisatellite repeats (variable number tandem repeats).

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Six Burkholderia solanacearum (formerly Pseudomonas solanacearum) genomic DNA fragments were isolated, using RAPD techniques and cloning, from the three genetically diverse strains: ACH092 (Biovar 4), ACH0158 (Biovar 2) and ACH0171 (Biovar 3) (1). One of these cloned fragments was selected because it was present constantly in all bacterial strains analysed. The remaining five clones were selected because Southern hybridisation revealed that each showed partial or complete specificity towards the strain of origin. A seventh genomic fragment showing a strain-specific distribution in Southern hybridisations was obtained by differential restriction, hybridisation and cloning of genomic DNA. Each of these clones was sequenced and primers to amplify the insert were designed. When DNA from the strain of origin was used as template, PCR amplification for each of these fragments yielded a single band on gel analysis. One pair of primers amplified the species-constant fragment of 281 bp from DNA of all B. solanacearum strains investigated, from DNA of the closely related bacterium which causes ''blood disease'' of banana (BDB) and in P. syzigii. The sensitivity of detection of B. solanacearum using these ubiquitous primers was between 1.3 and 20 bacterial cells. The feasibility and reliability of a PCR approach to detection and identification of B. solanacearum was tested in diverse strains of the bacterium in several countries and laboratories.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Lineage-survival oncogenes are activated by somatic DNA alterations in cancers arising from the cell lineages in which these genes play a role in normal development(1,2). Here we show that a peak of genomic amplification on chromosome 3q26.33 found in squamous cell carcinomas (SCCs) of the lung and esophagus contains the transcription factor gene SOX2, which is mutated in hereditary human esophageal malformations(3), is necessary for normal esophageal squamous development(4), promotes differentiation and proliferation of basal tracheal cells(5) and cooperates in induction of pluripotent stem cells(6-8). SOX2 expression is required for proliferation and anchorage-independent growth of lung and esophageal cell lines, as shown by RNA interference experiments. Furthermore, ectopic expression of SOX2 here cooperated with FOXE1 or FGFR2 to transform immortalized tracheobronchial epithelial cells. SOX2-driven tumors show expression of markers of both squamous differentiation and pluripotency. These characteristics identify SOX2 as a lineage-survival oncogene in lung and esophageal SCC.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Objective: Prostate cancer (PCa) is the most frequent tumor in males in Brazil. Single nucleotide polymorphisms (SNP) have been demonstrated in the promoter region of matrix metalloproteinases (MMPs) genes and have been associated with development and progression of some cancers. In this study, our aim was to investigate a possible relation between polymorphism of the promoter region of the MMP2 gene and classical prognostic parameters in prostate cancer. Materials and methods: Genomic DNA was extracted using conventional protocols. The DNA sequence containing the polymorphic site was amplified by real-time polymerase chain reaction, using fluorescent probes (TaqMan). Results: In patients with tumors of a higher stage (pT3), a polymorphic allele in the MMP2 gene was more frequent (P = 0.026) than in patients with lower tumor stage. A polymorphic allele in the MMP2 gene was more frequent in Gleason >= 7 than in Gleason <= 6 (P = 0.042). Conclusions: We conclude that MMP2 polymorphism can be used together with pathological stage and Gleason score to identify patients with worse prognosis. Our results illustrate the potential use of MMP2 SNP as a molecular marker for prostate cancer. (C) 2010 Elsevier Inc. All rights reserved.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Purpose: Prostate cancer is the most common tumor in males in Brazil. Single nucleotide polymorphisms have been demonstrated to exist in the promoter regions of matrix metalloproteinase genes and they are associated with the development and progression of some cancers. We investigated the correlation between MMP1, 2, 7 and 9 polymorphisms with susceptibility to prostate cancer, and classic prognostic parameters of prostate cancer. Materials and Methods: Genomic DNA was extracted using conventional protocols. The DNA sequence containing the polymorphic site was amplified by realtime polymerase chain reaction using TaqMan (R) fluorescent probes. Results: For the MMP1 gene the polymorphic allele was more common in the control group than in the prostate cancer group (p <0.001). For the MMP9 gene the incidence of the polymorphic homozygote genotype was higher in the prostate cancer group (p <0.001). For higher stage tumors (pT3) a polymorphic allele in the MMP2 gene was more common (p = 0.026). When considering Gleason score, the polymorphic homozygote genotype of MMP9 was more common in Gleason 6 or less tumors (p = 0.003), while a polymorphic allele in the MMP2 gene was more common in Gleason 7 or greater tumors (p = 0.042). Conclusions: MMP1 and MMP2 may protect against prostate cancer development and MMP9 may be related to higher risk. In contrast, MMP9 polymorphism was associated with a lower Gleason score and MMP2 polymorphism was associated with nonorgan confined disease.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Gene amplification occurs in Bradysia hygida salivary glands, at the end of the fourth larval instar. The hormone 20-hydroxyecdysone (20E) triggers this process, which results in DNA puff formation. Amplified genes are activated in two distinct groups. The activity of the first group is dependent on high levels of 20E, while the second group needs low hormone levels. Consequently, the salivary glands of B. hygida constitute an interesting biological model to study how 20E, and its receptors, affect gene amplification and activity. We produced polyclonal antibodies against B. hygida EcR (BhEcR). In western blots a polypeptide of about 66 kDa was detected in salivary gland extracts. The antibodies were also used for indirect immune-localization of BhEcR in polytene chromosomes. RNA-polymerase II was also immune-detected. We did not detect the receptor in chromosome C where the first and second groups of DNA puffs form during DNA puff anlage formation, but it was present during puff expansion. During the active phase of both groups of DNA puffs, RNA polymerase II co-localized with BhEcR. After puff regression, these antigens were not detected. Apparently, EcR plays a direct role in the transcription of amplified genes, but its role in gene amplification remains enigmatic.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Impaired DNA repair efficiency in systematic lupus erythematosus (SLE) patients has been reported ill some studies, mainly regarding the repair of oxidative damage, but little is known about repair kinetics towards primarily single-stranded DNA breaks. In the present study, we aimed to investigate: (a) the efficiency of SLE peripheral blood leucocytes in repairing DNA damage induced by ionizing radiation and (b) the association of DNA repair gene (XRCC1 Arg399Gln, XRCC3 Thr241Met and XRCC4 Ile401Thr) polymorphisms in SLE patients, considering the whole group, or stratified sub-groups according to clinical and laboratory features. A total of 163 SLE patients and 125 healthy control were studied. The kinetics of DNA strand break repair was evaluated by the comet assay, and genotyping for DNA repair genes was performed by PCR-RFLP. Compared with controls. SLE leucocytes exhibited decreased efficiency of DNA repair evaluated at 30 min following irradiation. A significant association with DNA repair gene polymorphisms was not observed for the whole group of SLE patients; however, the XRCC1Arg399Gln polymorphism was associated with the presence of anti-dsDNA antibody. The concomitance of two DNA repair polymorphic sites was associated with the presence of neuropsychiatric manifestations and antiphospholipid antibody syndrome. Taken together, these results indicated that SLE leucocytes repair less efficiently the radiation-induced DNA damage, and DNA repair polymorphic sites may predispose to the development of particular clinical and laboratory features. Lupus (2008) 17, 988-995.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Concurrent deletion at 1p/19q is a common signature of oligodendrogliomas, and it may, be identified in low-grade tumours (grade II) suggesting it represents an early event in the development of these brain neoplasms. Additional non-random changes primarily involve CDKN2A, PTEN and EGFR. Identification of all of these genetic changes has become an additional parameter in the evaluation of the clinical patients` prognosis, including good response to conventional chemotherapy. Multiple ligation-dependent probe amplification (MLPA) analysis is a new methodology that allows an easy identification of the oligodendrogliomas` abnormalities in a single step. No need of the respective constitutional DNA from each patient is another advantage of this method. We used MLPA kits P088 and P105 to determine the molecular characteristics of a series of 40 oligodendrogliomas. Deletions at I p and 19q were identified in 45% and 65% of cases, respectively. Alterations of EGFR, CDKN2A, ERBB2, PTEN and TP53 were also identified in variable frequencies among 7% to 35% of tumours. These findings demonstrate that MLPA is a reliable technique to the detection of molecular genetic changes in oligodendrogliomas.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Background Imunoglobulin (Ig) and T cell receptor (TCR) gene rearrangements function as specific markers for minimal residual disease (MRD) which is one of the best predictors of outcome in childhood acute lymphoblastic leukemia (ALL) We recently reported on the prognostic value of MRD during the induction of remission through a simplified PCR method Here we report on gene rearrangement frequencies and offer guidelines for the application of the technique Procedure Two hundred thirty three children had DNA extracted from bone marrow Ig and TCR gene rearrangements were amplified using consensus primers and conventional PCR PCR products were submitted to homo/heteroduplex analysis A computer program was designed to define combinations of targets for clonal detection using a minimum set of primers and reactions Results At least one clonal marker could be detected in 98% of the patients and two markers in approximately 80% The most commonly rear ringed genes in precursor B cell ALL were IgH (75%) TCRD (59%) IgK (55%), and TCRG (54%) The most commonly rearranged genes for TALL were TCRG (100%) and TCRD (24%) The sensitivity of primers was limited to the detection of 1 leukemic cell among 100 normal cells Conclusions We propose that eight PCR reactions per ALL subtype would allow for the detection of two markers in most cases In addition these reactions ire suitable for MRD monitoring especially when aiming the selection of patients with high MRD levels (>= 10(-2)) at the end of induction therapy Such an approach would be very useful in centers with limited financial resources Pediatr Blood Cancer 2010 55 1278-1286 (C) 2010 Wiley Liss Inc

Relevância:

30.00% 30.00%

Publicador:

Resumo:

The aim of this study was to evaluate the frequency of polymorphisms in the TYMS, XRCC1, and ERCC2 DNA repair genes in pediatric patients with acute lymphoblastic leukemia using polymerase chain reaction (PCR) and PCR-restriction fragment length polymorphism (RFLP) approaches. The study was conducted in 206 patients and 364 controls from a Brazilian population. No significant differences were observed among the analyzed groups regarding XRCC1 codon 399 and codon 194 and ERCC2 codon 751 and codon 312 polymorphisms. The TYMS 3R variant allele was significantly associated with a reduced risk of childhood ALL, represented by the sum of heterozygous and polymorphic homozygous genotypes (odds ratio 0.60; 95% confidence interval 0.37-0.99). The results suggest that polymorphism in TYMS may play a protective role against the development of childhood ALL.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Adrenocortical tumors (ACT) are rare neoplasms of the adrenal glands accounting for 0.2% of all pediatric cancers. However, the incidence of ACT in South Brazilian children is 10 to 15 times greater than the worldwide incidence. Comparative genomic hybridization studies have revealed the presence of a high degree of chromosomal instability in ACT. We evaluated 16 ACT, 8 of them carcinomas and 8 adenomas. The presence of changes in DNA copy numbers was determined by comparative genomic hybridization, and the findings were validated by real-time polymerase chain reaction on the basis of IGF-II gene expression. The adenomas showed a mean of 19.7 imbalances per case, with the most frequent gain and loss being 4p15.1-p15.3 and 20p11.2-p13.2, respectively. The carcinomas presented with a mean of 35.5 imbalances per case, with the more frequent gain being 2q14.1-q24.3 and the more frequent losses being 3q21-q26.2, 20q12-qter, and 22q11.2-q13.3. The most frequent imbalances in both adenomas and carcinomas were gains of 1p21-p31.2, 2p12-p21 and loss of 20p11.2-p12. The expression of IGF-II mRNA (11p15.5) was higher in samples that presented with a gain of this region. It has been established that great genomic instability exists in pediatric ACT.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

One hundred fifty-one Erysipelothrix spp. isolates from Brazilian swine were characterized by serotyping, determination of antimicrobial susceptibility, amplified fragment length polymorphism (AFLP), and pulsed-field gel electrophoresis (PFGE). Among all isolates, 139 were classified in 18 different serotypes and serotype 2b was the most frequent. The susceptibility profiles of the isolates were very similar among each other, which did not permit subtyping Erysipelothrix spp. isolates by the antimicrobial susceptibility testing. Despite the fact that AFLP and PFGE provided the same discriminatory index (0.98), PFGE was more discriminatory than AFLP, given the types of groups it generates. Regardless the technique employed (AFLP or PFGE), no discrimination between recent and historical isolates was established, neither a fixed epidemiologic pattern for their grouping was observed. Nevertheless, AFLP could be an interesting alternative for discriminating the Erysipelothrix species, while PFGE could be an indication for discerning this bacterium according to the serotypes. (C) 2011 Elsevier Inc. All rights reserved.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Two different regions of the infected cell protein 4 (ICP4) gene of infectious laryngotracheitis virus (ILTV) were amplified and sequenced for characterization of field isolates and tissue culture-origin (TCO) and chicken embryo-origin (CEO) vaccine strains. Phylogenetic analysis of the two regions showed differences in nucleotide and amino acid sequences between field isolates and attenuated vaccines. The PCR-RFLP results were identical to those obtained by DNA sequencing and validated their use to differentiate ILTV strains. The approach using the sequencing of the two fragments of the ICP4 gene showed to be an efficient and practical procedure to differentiate between field isolates and vaccine strains of ILTV. (C) 2009 Elsevier Ltd. All rights reserved.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

We tested the hypothesis that X-linked genes determining stature which are subject to skewed or non-random X-inactivation can account for discordance in height in monozygotic female twins. Height discordant female monozygotic adult twins (20 pairs) were identified from the Australian Twin Registry, employing the selection criteria of proven monozygosity and a measured height discordance of at least 5 cm. Differential X-inactivation was examined in genomic DNA extracted from peripheral lymphocytes by estimating differential methylation of alleles at the polymorphic CAG triplet repeat of the Androgen receptor gene (XAR). There were 17/20 MZ pairs heterozygous at this locus and informative for analysis. Of these, 10/17 both had random X-inactivation, 5/17 showed identical X-inactivation patterns of non random inactivation and 2/17 (12%) showed discordant X-inactivation. There was no relationship between inactivation patterns and self-report chorionicity. We conclude that non-random X-inactivation does not appear to be a major contributor to intra-pair height discordance in female MZ twins.