986 resultados para RT-nested PCR


Relevância:

40.00% 40.00%

Publicador:

Resumo:

O Bidens mosaic virus (BiMV) é uma espécie tentativa do gênero Potyvirus, que infecta alface (Lactuca sativa). Na ausência de métodos eficientes para diagnose deste vírus, o objetivo do trabalho foi a síntese de oligonucleotídeos específicos e sua otimização em testes de RT-PCR em uma só etapa, partindo-se de extrações de RNA total. Os oligonucleotídeos 8851sens (5'AGG CAG TTC GCA CGG CAT AC 3´) e 9211ant (5´ CTT CAT CTG GAT GTG TGC TTC 3´) permitem a eficiente detecção do vírus e possibilitaram a descoberta de uma nova hospedeira do vírus, a planta Galinsoga parviflora, comumente encontrada em canteiros de produção comercial de alface.

Relevância:

40.00% 40.00%

Publicador:

Resumo:

Twelve Brazilian isolates and one reference vaccine strain of avian infectious bronchitis virus (IBV) were propagated in embryonating chicken eggs. The entire S1 glycoprotein gene of these viruses was analysed by reverse-transcriptase-polymerase chain reaction and restriction fragment length polymorphism (RT-PCR-RFLP), using the restriction enzymes HaeIII, XcmI and BstyI. The RFLP patterns led to the classification of these isolates into five distinct genotypes: A, B, C, D and Massachusetts. Five of twelve isolates were grouped in Massachusetts genotype and the remaining seven viruses were classified into four distinct genotypes: A (2), B (2), C (2) or D (1). Such genotyping classification agreed with previous immunological analysis for most of these viruses, highlighting the occurrence of a relevant variability among the IBV strains that are circulating in Brazilian commercial poultry flocks.

Relevância:

40.00% 40.00%

Publicador:

Resumo:

The inflammatory response elicited by various stimuli such as microbial products or cytokines is determined by differences in the pattern of cellular gene expression. We have used the differential display RT-PCR (DDRT-PCR) strategy to identify mRNAs that are differentially expressed in various murine cell types stimulated with pro-inflammatory cytokines, microbial products or anti-inflammatory drugs. Mouse embryonic fibroblasts (MEFs) were treated with IFNs, TNF, or sodium salicylate. Also, peritoneal macrophages from C3H/Hej mice were stimulated with T. cruzi-derived GPI-mucin and/or IFN-g. After DDRT-PCR, various cDNA fragments that were differentially represented on the sequencing gel were recovered, cloned and sequenced. Here, we describe a summary of several experiments and show that, when 16 of a total of 28 recovered fragments were tested for differential expression, 5 (31%) were found to represent mRNAs whose steady-state levels are indeed modulated by the original stimuli. Some of the identified cDNAs encode for known proteins that were not previously associated with the inflammatory process triggered by the original stimuli. Other cDNA fragments (8 of 21 sequences, or 38%) showed no significant homology with known sequences and represent new mouse genes whose characterization might contribute to our understanding of inflammation. In conclusion, DDRT-PCR has proven to be a potent technology that will allow us to identify genes that are differentially expressed when cells are subjected to changes in culture conditions or isolated from different organs.

Relevância:

40.00% 40.00%

Publicador:

Resumo:

Vertebrate gap junctions are aggregates of transmembrane channels which are composed of connexin (Cx) proteins encoded by at least fourteen distinct genes in mammals. Since the same Cx type can be expressed in different tissues and more than one Cx type can be expressed by the same cell, the thorough identification of which connexin is in which cell type and how connexin expression changes after experimental manipulation has become quite laborious. Here we describe an efficient, rapid and simple method by which connexin type(s) can be identified in mammalian tissue and cultured cells using endonuclease cleavage of RT-PCR products generated from "multi primers" (sense primer, degenerate oligonucleotide corresponding to a region of the first extracellular domain; antisense primer, degenerate oligonucleotide complementary to the second extracellular domain) that amplify the cytoplasmic loop regions of all known connexins except Cx36. In addition, we provide sequence information on RT-PCR primers used in our laboratory to screen individual connexins and predictions of extension of the "multi primer" method to several human connexins.

Relevância:

40.00% 40.00%

Publicador:

Resumo:

IFN-gamma mRNA expression was evaluated in nonstimulated peripheral blood mononuclear cells (PBMC) of HIV-infected and seronegative individuals using quantitative competitive and semiquantitative RT-PCR and the sensitivity of these methods was compared. A significant correlation was found between quantitative competitive and semiquantitative RT-PCR in samples of both HIV-seronegative (P = 0.004) and HIV-infected individuals (P = 0.0004). PBMC from HIV-infected individuals presented a remarkable increase of IFN-gamma mRNA expression, as determined by both types of RT-PCR methods. Semiquantitative RT-PCR even without an internal standard is also acceptable for measuring cytokine mRNA expression, but less reliable if small amounts are quantified. Moreover, we found that increased IFN-gammamRNA expression is independent of CD4+ cell count in AIDS-free HIV-infected patients.

Relevância:

40.00% 40.00%

Publicador:

Resumo:

The reverse transcription-polymerase chain reaction (RT-PCR) is the most sensitive method used to evaluate gene expression. Although many advances have been made since quantitative RT-PCR was first described, few reports deal with the mathematical bases of this technique. The aim of the present study was to develop and standardize a competitive PCR method using standard-curves to quantify transcripts of the myogenic regulatory factors MyoD, Myf-5, Myogenin and MRF4 in chicken embryos. Competitor cDNA molecules were constructed for each gene under study using deletion primers, which were designed to maintain the anchorage sites for the primers used to amplify target cDNAs. Standard-curves were prepared by co-amplification of different amounts of target cDNA with a constant amount of competitor. The content of specific mRNAs in embryo cDNAs was determined after PCR with a known amount of competitor and comparison to standard-curves. Transcripts of the housekeeping ß-actin gene were measured to normalize the results. As predicted by the model, most of the standard-curves showed a slope close to 1, while intercepts varied depending on the relative efficiency of competitor amplification. The sensitivity of the RT-PCR method permitted the detection of as few as 60 MyoD/Myf-5 molecules per reaction but approximately 600 molecules of MRF4/Myogenin mRNAS were necessary to produce a measurable signal. A coefficient of variation of 6 to 19% was estimated for the different genes analyzed (6 to 9 repetitions). The competitive RT-PCR assay described here is sensitive, precise and allows quantification of up to 9 transcripts from a single cDNA sample.

Relevância:

40.00% 40.00%

Publicador:

Resumo:

Durante a germinação das sementes, os carboidratos de reserva são degradados pela atividade de a-amilase. A identificação de mRNA é uma ferramenta fundamental para a definição da cinética de síntese de alfa-amilase. Objetivou-se padronizar a metodologia do RT-PCR para identificar o mRNA do gene de a-amilase em sementes de milho. Após três dias de germinação das cultivares Saracura-BRS 4154 e CATI-AL34, extraiu-se o RNA total pelo método do tiocianato de guanidina-fenol-clorofórmio, com algumas modificações. A partir do RNA total extraído foi obtido cDNA com utilização de "random primers". A amplificação por PCR de uma porção do gene da alfa-amilase foi realizada com os "primers": "sense" - CGACATCGACCACCTCAAC; "antisense" - TTGACCAGCTCCTGCCTGTC; gelatina; DMSO e 1,25 unidades de Taq DNA polimerase por reação e completados com água tratada com DEPC. Os ciclos para a amplificação foram 94ºC durante 4 minutos, seguidos por 34 ciclos de 94ºC durante 1 minuto, 42ºC durante 1 minuto e 72ºC durante 1,5 minutos e, finalmente, 72ºC por 5 minutos. O produto do RT-PCR apresentou uma banda de 249 pares de base (pb) bem definida, para as duas cultivares estudadas, não ocorrendo bandas inespecíficas. A técnica do RT-PCR mostrou ser uma metodologia eficiente para a identificação da expressão de alfa-amilase durante a germinação das sementes e pode ser usado para estudo qualitativo e quantitativo da cinética de síntese dessa enzima em experimentos de germinação.

Relevância:

40.00% 40.00%

Publicador:

Resumo:

Tesis (Doctora en Ciencias con Especialidad en Biotecnología) U.A.N.L. Facultad de Ciencias Biológicas, 2007.

Relevância:

40.00% 40.00%

Publicador:

Resumo:

A dengue é a mais importante doença viral transmitida por mosquitos, no que diz respeito à morbidade e mortalidade, que afeta os seres humanos. Este vírus é transmitido pelos vetores Aedes albopictus e Aedes aegypti, este último é o principal vetor nas Américas. O controle da doença se baseia na vigilância laboratorial e vigilância entomológica. A vigilância laboratorial visa aprimorar a capacidade do diagnóstico, detectando precocemente a circulação viral e monitorando os sorotipos circulantes. Dentro deste tipo de vigilância, a RT-PCR é um método bastante usado no diagnóstico da doença em humanos e mosquitos, porém, a má conservação do material pode comprometer a integridade do RNA e trazer resultados falso-negativos. O desenvolvimento de melhores métodos de vigilância do vírus dengue (DENV) em mosquitos é de grande valor para os programas de controle. Desta maneira, o presente projeto visou otimizar a técnica de RT-PCR Multiplex para detecção de DENV em amostras de Ae. aegypti infectadas artificialmente pelo vírus. Primers que amplificam uma região de 80 pb do gene rpL8 de mosquito foram desenhados no site Primer3 e avaliados na ferramenta online Multiple Primer Analyzer, junto com primers que amplificam os sorotipos DENV. Não houve competição de primers e foi observado bandas distintas no gel de agarose. Foi avaliado o efeito de diferentes formas de preservação do material genético das amostras (RNAlater®, freezer -80°C e nitrogênio líquido) por 7 dias, onde não houve diferenças significativas em relação à integridade do RNA. O efeito de diferentes formas de extração de RNA (Kit da QIAGEN® , TRIzol® e Chomczymski-Sacchi) também foi avaliado e o método ChomczymskiSacchi obteve o melhor desempenho. A otimização desta técnica permitirá uma maior confiabilidade nos resultados, já que além da detecção dos sorotipos, haverá uma confirmação da qualidade do RNA, aprimorando a capacidade do diagnóstico e auxiliando a prevenção e controle da transmissão da dengue.

Relevância:

40.00% 40.00%

Publicador:

Resumo:

TMV was tried to recover from a variety of branded cigarettes and cigars. Tobacco from six different brands of cigarettes and cigar were processed and reverse transcriptase polymerase chain reaction was employed for the detection of TMV. RTPCR confirmed the presence of TMV in tobacco from one brand of cigarette and one brand of cigar. Bean plants (Phaseolus vulgaris) were inoculated manually with tobacco sap of cigarettes resulting in the production of localized disease lesions. Together, these results showed that tobacco used to make cigarettes and cigars can function as an effective disease vector, potentially aiding the movement of infectious TMV between countries. This is an important finding prompting a need to test smoking tobacco for other virus particles that infect tobacco plants and survive processing as well as considering biosecurity measures to limit virus transmission

Relevância:

40.00% 40.00%

Publicador:

Resumo:

Quantitative reverse-transcription polymerase chain reaction (qRT-PCR) is a standard assay in molecular medicine for gene expression analysis. Samples from incisional/needle biopsies, laser-microdissected tumor cells and other biologic sources, normally available in clinical cancer studies, generate very small amounts of RNA that are restrictive for expression analysis. As a consequence, an RNA amplification procedure is required to assess the gene expression levels of such sample types. The reproducibility and accuracy of relative gene expression data produced by sensitive methodology as qRT-PCR when cDNA converted from amplified (A) RNA is used as template has not yet been properly addressed. In this study, to properly evaluate this issue, we performed 1 round of linear RNA amplification in 2 breast cell lines (C5.2 and HB4a) and assessed the relative expression of 34 genes using cDNA converted from both nonamplified (NA) and A RNA. Relative gene expression was obtained from beta actin or glyceraldehyde 3-phosphate dehydrogenase normalized data using different dilutions of cDNA, wherein the variability and fold-change differences in the expression of the 2 methods were compared. Our data showed that 1 round of linear RNA amplification, even with suboptimal-quality RNA, is appropriate to generate reproducible and high-fidelity qRT-PCR relative expression data that have similar confidence levels as those from NA samples. The use of cDNA that is converted from both A and NA RNA in a single qRT-PCR experiment clearly creates bias in relative gene expression data.

Relevância:

40.00% 40.00%

Publicador:

Resumo:

Current knowledge of the pathogenic hantavirus indicates that wild rodents are its primary natural reservoir. Specific primers to detect the presence of viral genomes were developed using an SYBR-Green-based real-time RT-PCR protocol. One hundred sixty-four rodents native to the Atlantic Forest biome were captured in So Paulo State, Brazil, and their tissues were tested. The presence of hantavirus RNA was detected in sixteen rodents: three specimens of Akodon montensis, three of Akodon cursor, two of Necromys lasiurus, one of Juliomys sp., one of Thaptomys nigrita, five of Oligoryzomys nigripes, and one of Oryzomys sp. This SYBR Green real-time RT-PCR method for detection of hantavirus may be useful for surveying hantaviruses in Brazil.

Relevância:

40.00% 40.00%

Publicador:

Resumo:

O enrolamento do arroz é uma doença viral emergente no Brasil causada pelo Rice stripe necrosis virus (RSNV) que é transmitido pelo protozoário Polymyxa graminis. RSNV é um membro do gênero Benyvirus com genoma dividido em 4 RNAs de fita simples no sentido positivo (ssRNA +). Em função da falta de conhecimento sobre a seqüência de nucleotídeos do seu genoma, a detecção de RSNV através de métodos moleculares não é utilizada. O objetivo deste trabalho foi identificar seqüências do genoma de RSNV que possibilitassem sua detecção em plantas de arroz através da técnica de transcrição reversa seguida da reação em cadeia da polimerase (RT-PCR). As seqüências do genoma foram identificadas a partir de clones de uma biblioteca de cDNAs obtidos de uma amostra do vírus parcialmente purificado. Os clones que hibridizaram com sondas sintetizadas a partir de RNA de plantas infectadas com RSNV foram seqüenciados e comparados às seqüências do GenBank. Um fragmento de 957 nt da extremidade 3’ da fita de um dos 4 RNAs genômicos de RSNV foi obtido. A análise da seqüência nucleotídeos desse fragmento não revelou qualquer similaridade com seqüências conhecidas, tampouco indicou uma possível função. Um par de oligonucleotídeos iniciadores foi desenhado a partir de um clone que potencialmente contém uma seqüência de RSNV. A especificidade e a sensibilidade da RT-PCR utilizando esse par de oligonucleotídeos iniciadores, bem como sua eficiência na detecção do vírus em diferentes partes da planta de arroz, foram avaliadas. Os resultados indicam que a RT-PCR é específica para RSNV e pode detectar o vírus em tecido oriundo das raízes, do colo e de folhas com distorção. Comparada ao diagnóstico da doença através da observação de sintomas e de estruturas do vetor, a RT-PCR é uma ferramenta confiável para a diagnose do enrolamento do arroz.

Relevância:

40.00% 40.00%

Publicador:

Resumo:

Lettuce mottle virus (LeMoV) and dandelion yellow mosaic virus (DaYMV) infect lettuce in South America and Europe, respectively. LeMoV and DaYMV possess isometric particles, occur at low concentrations in plants and have narrow host ranges. Partial genome sequences of both viruses were obtained using purified viral preparations and universal primers for members of the family Sequiviridae. DaYMV and LeMoV sequences were analyzed and showed identity with other members of the family. Universal primers that detect both viruses and specific primers for LeMoV and DaYMV were designed and used in RT-PCR-based diagnostic assays. These results provide the first molecular data on the LeMoV and DaYMV genomes and suggest that LeMoV is a member of the genus Sequivirus, probably distinct from DaYMV.

Relevância:

40.00% 40.00%

Publicador:

Resumo:

Durante a germinação das sementes, os carboidratos de reserva são degradados pela atividade de a-amilase. A identificação de mRNA é uma ferramenta fundamental para a definição da cinética de síntese de alfa-amilase. Objetivou-se padronizar a metodologia do RT-PCR para identificar o mRNA do gene de a-amilase em sementes de milho. Após três dias de germinação das cultivares Saracura-BRS 4154 e CATI-AL34, extraiu-se o RNA total pelo método do tiocianato de guanidina-fenol-clorofórmio, com algumas modificações. A partir do RNA total extraído foi obtido cDNA com utilização de random primers. A amplificação por PCR de uma porção do gene da alfa-amilase foi realizada com os primers: sense - CGACATCGACCACCTCAAC; antisense - TTGACCAGCTCCTGCCTGTC; gelatina; DMSO e 1,25 unidades de Taq DNA polimerase por reação e completados com água tratada com DEPC. Os ciclos para a amplificação foram 94ºC durante 4 minutos, seguidos por 34 ciclos de 94ºC durante 1 minuto, 42ºC durante 1 minuto e 72ºC durante 1,5 minutos e, finalmente, 72ºC por 5 minutos. O produto do RT-PCR apresentou uma banda de 249 pares de base (pb) bem definida, para as duas cultivares estudadas, não ocorrendo bandas inespecíficas. A técnica do RT-PCR mostrou ser uma metodologia eficiente para a identificação da expressão de alfa-amilase durante a germinação das sementes e pode ser usado para estudo qualitativo e quantitativo da cinética de síntese dessa enzima em experimentos de germinação.