988 resultados para Promoter Region


Relevância:

60.00% 60.00%

Publicador:

Resumo:

The p38 mitogen‑activated protein kinase (MAPK) signaling pathways have been proposed to participate in the pathological process of cancer by affecting inflammation, proliferation, metastasis and cell survival. A single nucleotide polymorphism (SNP; rs2235356, ‑1628A→G) in the promoter region of the p38β gene has been proposed as a genetic modifier for colorectal cancer (CRC) in a Chinese population. The present study evaluated the susceptibility of patients possessing this SNP to CRC, in addition to determining its association with clinical parameters in Swedish patients with CRC. Using the LightSNiP genotyping assay, this SNP was screened in 389 patients with CRC and 517 control subjects. No significant difference in the genotype distribution or in the allelic frequencies was identified between the two groups nor was any association identified with the clinical parameters. These findings indicate that the ‑1628A→G polymorphism of the p38β gene is not significantly associated with a susceptibility to CRC in a Swedish population.

Relevância:

40.00% 40.00%

Publicador:

Resumo:

Activation of the immune response in hantavirus cardiopulmonary syndrome (HCPS) leads to a high TNF production, probably contributing to the disease. The polymorphic TNF2 allele (TNF -308G/A) has been associated with increased cytokine production. We investigated the association of the TNF2 allele with the outcome of hantavirus infection in Brazilian patients. A total of 122 hantavirus-exposed individuals (26 presenting HCPS and 96 only hantavirus seroconversion) were studied. The TNF2 allele was more frequently found in HCPS patients than in individuals with positive serology for hantavirus but without a history of HCPS illness, suggesting that the TNF2 allele could represent a risk factor for developing HCPS.

Relevância:

40.00% 40.00%

Publicador:

Resumo:

Early-life stress (ELS) induces long-lasting changes in gene expression conferring an increased risk for the development of stress-related mental disorders. Glucocorticoid receptors (GR) mediate the negative feedback actions of glucocorticoids (GC) in the paraventricular nucleus (PVN) of the hypothalamus and anterior pituitary and therefore play a key role in the regulation of the hypothalamic-pituitary-adrenal (HPA) axis and the endocrine response to stress. We here show that ELS programs the expression of the GR gene (Nr3c1) by site-specific hypermethylation at the CpG island (CGI) shore in hypothalamic neurons that produce corticotropin-releasing hormone (Crh), thus preventing Crh upregulation under conditions of chronic stress. CpGs mapping to the Nr3c1 CGI shore region are dynamically regulated by ELS and underpin methylation-sensitive control of this region's insulation-like function via Ying Yang 1 (YY1) binding. Our results provide new insight into how a genomic element integrates experience-dependent epigenetic programming of the composite proximal Nr3c1 promoter, and assigns an insulating role to the CGI shore.

Relevância:

40.00% 40.00%

Publicador:

Resumo:

Cloning and characterization of the mouse neu gene revealed the presence of positive and negative cis-acting regulatory elements in the mouse neu promoter. An upstream region located between the SmaI and SphI sites of the promoter appeared to contribute significantly to negative regulation of the mouse neu gene, since deletion of this region led to a marked increase in transcriptional activity. To further characterize the mouse neu promoter I conducted a more exhaustive study on this cis-acting region which had not previously been studied in either human or rat neu promoters.^ The SmaI-SphI region was paced in front of the minimal thymidine kinase promoter where it inhibited transcription in both NIH3T3 and Hela cells. Physical association of nuclear proteins with this region was confirmed by electro-mobility shift assays. Four specific protein-DNA complexes were detected which involved interaction of proteins with various portions of the SmaI-SphI region. The most dominant protein complexes could be competed by SmaI-NruI and PstI-SphI subregions. Subsequent gel-shifts using SmaI-NruI and PstI-SphI as probes further confirmed the requirement of these two regions for the formation of the three fastest migrating complexes. Methylation interference and DNase I footprinting analyses were performed to determine the specific DNA sequences required for protein interaction. The two sequences identified were a 28 bp sequence, GAGCTTTCTTGGCTTAGTTCCAGACTCA, from the SmaI-NruI region (SN element) and a 23 bp sequence, AGGGACACCTTTGATCTGACCTTTA, from the PstI-SphI fragment (PS element). The PS and SN elements identified by footprinting were used as probes in gel-shift assays. Both oligonucleotides were capable of forming specific complexes with nuclear proteins. Sequence analysis of the SmaI-SphI region indicated that another sequence similar to PS element was located 330 bp upstream of the PS element. The identified SN and PS elements were subcloned into pMNSphICAT and transfected into NIH3T3 cells. Measurement of CAT activity indicated that both elements were sufficient to inhibit transcription from the mouse neu promoter. Both elements appeared to mediate binding in all cell types examined. Thus, I have identified two silencer elements from an upstream region of the mouse neu promoter which appear to regulate transcription in various cell lines. ^

Relevância:

40.00% 40.00%

Publicador:

Resumo:

A multiple protein–DNA complex formed at a human α-globin locus-specific regulatory element, HS-40, confers appropriate developmental expression pattern on human embryonic ζ-globin promoter activity in humans and transgenic mice. We show here that introduction of a 1-bp mutation in an NF-E2/AP1 sequence motif converts HS-40 into an erythroid-specific locus-control region. Cis-linkage with this locus-control region, in contrast to the wild-type HS-40, allows erythroid lineage-specific derepression of the silenced human ζ-globin promoter in fetal and adult transgenic mice. Furthermore, ζ-globin promoter activities in adult mice increase in proportion to the number of integrated DNA fragments even at 19 copies/genome. The mutant HS-40 in conjunction with human ζ-globin promoter thus can be used to direct position-independent and copy number-dependent expression of transgenes in adult erythroid cells. The data also supports a model in which competitive DNA binding of different members of the NF-E2/AP1 transcription factor family modulates the developmental stage specificity of an erythroid enhancer. Feasibility to reswitch on embryonic/fetal globin genes through the manipulation of nuclear factor binding at a single regulatory DNA motif is discussed.

Relevância:

40.00% 40.00%

Publicador:

Resumo:

The human β2-adrenergic receptor gene has multiple single-nucleotide polymorphisms (SNPs), but the relevance of chromosomally phased SNPs (haplotypes) is not known. The phylogeny and the in vitro and in vivo consequences of variations in the 5′ upstream and ORF were delineated in a multiethnic reference population and an asthmatic cohort. Thirteen SNPs were found organized into 12 haplotypes out of the theoretically possible 8,192 combinations. Deep divergence in the distribution of some haplotypes was noted in Caucasian, African-American, Asian, and Hispanic-Latino ethnic groups with >20-fold differences among the frequencies of the four major haplotypes. The relevance of the five most common β2-adrenergic receptor haplotype pairs was determined in vivo by assessing the bronchodilator response to β agonist in asthmatics. Mean responses by haplotype pair varied by >2-fold, and response was significantly related to the haplotype pair (P = 0.007) but not to individual SNPs. Expression vectors representing two of the haplotypes differing at eight of the SNP loci and associated with divergent in vivo responsiveness to agonist were used to transfect HEK293 cells. β2-adrenergic receptor mRNA levels and receptor density in cells transfected with the haplotype associated with the greater physiologic response were ≈50% greater than those transfected with the lower response haplotype. The results indicate that the unique interactions of multiple SNPs within a haplotype ultimately can affect biologic and therapeutic phenotype and that individual SNPs may have poor predictive power as pharmacogenetic loci.

Relevância:

40.00% 40.00%

Publicador:

Resumo:

G6PC3 is a widely expressed isoform of glucose-6-phosphatase, found in many foetal and adult tissues. Mutations in this gene cause developmental abnormalities and severe neutropenia due to abolition of glucose recycling between the cytoplasm and endoplasmic reticulum. Low G6PC3 expression as a result of promoter polymorphisms or dysregulation could produce similar outcomes. Here we investigated the regulation of human G6PC3 promoter activity. HeLa and H4IIE cells were transiently transfected with G6PC3 promoter coupled to the firefly luciferase gene, and promoter activity was measured by dual luciferase assay. Activity was highest in a 453 bp segment of the G6PC3 promoter, from − 455 to − 3 relative to the transcriptional start site. This promoter was unresponsive to glucostatic hormones. Its activity increased significantly between 1 and 5.5 mM glucose, and was not elevated further by glucose concentrations up to 25 mM. Pyruvate increased its activity, but β-hydroxybutyrate and sodium acetate did not. Promoter activity was reduced by inhibitors of hexokinase, glyceraldehyde phosphate dehydrogenase and the oxidative branch of the pentose phosphate pathway, but not by a transketolase inhibitor. Deletion of two adjacent Enhancer-boxes (− 274 to − 279 and − 299 to − 304) reduced promoter activity and abolished the glucose effect, suggesting they could function as a glucose response element. Deletion of an additional downstream 140 bp (− 140 to − 306) restored activity, but not the glucose response, suggesting the presence of repressor elements in this region. 5-Aminoimidazole-4-carboxamide 1-β-d-ribofuranoside (AICAR) reduced promoter activity, showing dependence on AMP-kinase. Regulation of the G6PC3 promoter is thus radically different to that of the hepatic isoform, G6PC. It is sensitive to carbohydrate, but not to fatty acid metabolites, and at much lower physiological concentrations. Based on these findings, we speculate that reduced G6PC3 expression could occur during hypoglycemic episodes in vivo, which are common in utero and in the postnatal period. If such episodes lower G6PC3 expression they could place the foetus or infant at risk of impaired immune function and development, and this possibility requires further examination both in vitro and in vivo.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Background: Much is known about how genes regulated by nuclear receptors (NRs) are switched on in the presence of a ligand. However, the molecular mechanism for gene down-regulation by liganded NRs remains a conundrum. The interaction between two zinc-finger transcription factors, Nuclear Receptor and GATA, was described almost a decade ago as a strategy adopted by the cell to up-or down-regulate gene expression. More recently, cell-based assays have shown that the Zn-finger region of GATA2 (GATA2-Zf) has an important role in down-regulation of the thyrotropin gene (TSH beta) by liganded thyroid hormone receptor (TR). Methodology/Principal Findings: In an effort to better understand the mechanism that drives TSH beta down-regulation by a liganded TR and GATA2, we have carried out equilibrium binding assays using fluorescence anisotropy to study the interaction of recombinant TR and GATA2-Zf with regulatory elements present in the TSH beta promoter. Surprisingly, we observed that ligand (T3) weakens TR binding to a negative regulatory element (NRE) present in the TSH beta promoter. We also show that TR may interact with GATA2-Zf in the absence of ligand, but T3 is crucial for increasing the affinity of this complex for different GATA response elements (GATA-REs). Importantly, these results indicate that TR complex formation enhances DNA binding of the TR-GATA2 in a ligand-dependent manner. Conclusions: Our findings extend previous results obtained in vivo, further improving our understanding of how liganded nuclear receptors down-regulate gene transcription, with the cooperative binding of transcription factors to DNA forming the core of this process.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Human N-acetyltransferase Type I (NAT1) catalyses the acetylation of many aromatic amine and hydrazine compounds and it has been implicated in the catabolism of folic acid. The enzyme is widely expressed in the body, although there are considerable differences in the level of activity between tissues. A search of the mRNA databases revealed the presence of several NAT1 transcripts in human tissue that appear to be derived from different promoters. Because little is known about NAT1 gene regulation, the present study was undertaken to characterize one of the putative promoter sequences of the NAT1 gene located just upstream of the coding region. We show with reverse-transcriptase PCR that mRNA transcribed from this promoter (Promoter 1) is present in a variety of human cell-lines, but not in quiescent peripheral blood mononuclear cells. Using deletion mutant constructs, we identified a 20 bp sequence located 245 bases upstream of the translation start site which was sufficient for basal NAT1 expression. It comprised an AP-1 (activator protein 1)-binding site, flanked on either side by a TCATT motif. Mutational analysis showed that the AP-1 site and the 3' TCATT sequence were necessary for gene expression, whereas the 5' TCATT appeared to attenuate promoter activity. Electromobility shift assays revealed two specific bands made up by complexes of c-Fos/Fra, c-Jun, YY-1 (Yin and Yang 1) and possibly Oct-1. PMA treatment enhanced expression from the NAT1 promoter via the AP-1-binding site. Furthermore, in peripheral blood mononuclear cells, PMA increased endogenous NAT1 activity and induced mRNA expression from Promoter I, suggesting that it is functional in vivo.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Objective: To assess whether the -11391G > A polymorphism in the regulatory region of the adiponectin gene (ADIPOQ) is associated with birth size, postnatal growth, adiponectinemia, and cardiometabolic risk in adult life. Design: Case-control study nested within a prospective cohort of 2063 community subjects born in 1978/1979 and followed since birth to date. Methods: ADIPOQ -11391G > A genotype-phenotype associations were evaluated in 116 subjects born large for gestational age (LGA) and 392 gender-matched controls at birth (birth size), at 8-10 years (catch-down growth), and at 23-25 years of age (cardiometabolic profile). Results: The -11391A variant allele frequency was higher in LGA subjects (P=0.04). AA genotype was associated with augmented probability of being born LGA (odds ratio=4.14; 95% confidence interval: 1.16-16.7; P=0.03). This polymorphism was associated neither with body composition nor with postnatal growth pattern. At the age of 23-25 years, the -11391A variant allele was associated with higher serum adiponectin levels (GG: 10.7 +/- 6.2 versus GA: 12.2 +/- 6.5 versus AA: 14.2 +/- 6.8 mu g/ml; P < 0.01). Subjects born LGA presented higher body mass index (BMI; P=0.01), abdominal circumference (P=0.04), blood pressure (P=0.04), and homeostasis assessment model for insulin resistance (P=0.01) than adequate for gestational age. Symmetry at birth did not influence these variables. The occurrence of catch-down of weight was associated with lower BMI and abdominal circumference (P < 0.001) at 23-25 years. Conclusions: The -11391A ADIPOQ gene variant was associated with increased chance of being born LGA and with higher adiponectin levels in early adult life.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Approximately 50% of all melanoma families worldwide show linkage to 9p21-22, but only about half of these have been shown to contain germ line CDKN2A mutations. It has been hypothesized that a proportion of these families carry mutations in the noncoding regions of CDKN2A. Several Canadian families have been reported to carry a mutation in the 5' UTR, at position -34 relative to the start site, which gives rise to a novel AUG translation initiation codon that markedly decreases translation from the wild-type AUG (Liu et al., 1999). Haplotype sharing in these Canadian families suggested that this mutation is of British origin. We sequenced 1,327 base pairs (bp) of CDKN2A, making up 1,116 bp of the 5' UTR and promoter, all of exon 1, and 61 bp of intron 1, in at least one melanoma case from 110 Australian families with three or more affected members known not to carry mutations within the p16 coding region. In addition, 431 bp upstream of the start codon was sequenced in an additional 253 affected probands from two-case melanoma families for which the CDKN2A mutation status was unknown. Several known polymorphisms at positions -33, -191, -493, and -735 were detected, in addition to four novel variants at positions 120, -252, -347, and -981 relative to the start codon. One of the probands from a two-case family was found to have the previously reported Q50R mutation. No family member was found to carry the mutation at position -34 or any other disease-associated mutation. For further investigation of noncoding CDKN2A mutations that may affect transcription, allele-specific expression analysis was carried out in 31 of the families with at least three affected members who showed either complete or indeterminate 9p haplotype sharing without CDKN2A exonic mutations. Reverse transcription polymerase chain reaction and automated sequencing showed expression of both CDKN2A alleles in all family members tested. The lack of CDKN2A promoter mutations and the absence of transcriptional silencing in the germ line of this cohort of families suggest that mutations in the promoter and 5' UTR play a very limited role in melanoma predisposition. (C) 2001 Wiley-Liss, Inc.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

SOX9 is a transcription factor that plays a key role in chondrogenesis, Aggrecan is one of the major structural components in cartilage; however, the molecular mechanism of aggrecan gene regulation has not yet been fully elucidated, TC6 is a clonal chondrocytic cell line derived from articular cartilage, The purpose of this study was to examine whether SOX9 modulates aggrecan gene expression and to further identify molecules that regulate Sox9 expression in TC6 cells. SOX9 overexpression in TC6 cells enhanced by similar to 3-fold the transcriptional activity of the AgCAT-8 construct containing S-kilobase (kb) promoter/first exon/first intron fragments of the aggrecan gene. SOX9 enhancement of aggrecan promoter activity was lost when we deleted a 4.5-kb fragment from the 3'-end of the 8-kb fragment corresponding to the region including the first intron, In TC6 cells, SOX9 enhanced the transcriptional activity of a reporter construct containing the Sry/Sox consensus sequence >10-fold. SOX9 enhancement of aggrecan gene promoter activity and SOX9 transactivation through the Sry/Sox consensus sequence were not observed in osteoblastic osteosarcoma cells (ROS17/2.8), indicating the dependence on the cellular background. Northern blot analysis indicated that TC6 cells constitutively express Sox9 mRNA at relatively low levels. To examine regulation of Sox9 gene expression, we investigated the effects of calciotropic hormones and cytokines, Among these, retinoic acid (RA) specifically enhanced Sox9 mRNA expression in TC6 cells. The basal levels of Sox9 expression and its enhancement by RA were observed similarly at both permissive (33 degrees C) and nonpermissive (39 degrees C) temperatures. Furthermore, RA treatment enhanced the transcriptional activity of a reporter construct containing the Sry/Sox consensus sequence in TC6 cells. Moreover, RA treatment also enhanced the transcriptional activity of another reporter construct containing the enhancer region of the type II procollagen gene in TC6 cells. These observations indicate that SOX9 enhances aggrecan promoter activity and that its expression is up-regulated by RA in TC6 cells.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Inherited susceptibility to breast cancer results from germline mutations in one of a number of genes including BRCA1. A significant number of BRCA1-linked familial breast cancer patients, however, have no detectable BRCA1 mutation. This could be due in part to the inability of commonly used mutation-detection techniques to identify mutations outside the BRCA1 coding region. This paper addresses the hypothesis that non coding region mutations, specifically in the BRCA1 promoter, account for some of these cases. We describe a new and detailed restriction map of the 5' region of the BRCA1 gene including the nearby NBR2, psiBRCA1, and NBR1 genes and the isolation of a number of new informative hybridization probes suitable for Southern analysis. Using this information we screened DNA from lymphoblastoid cell-lines made from 114 UK familial breast cancer patients and detected one large deletion in the 5' region of BRCA1. We show that the breakpoints for this deletion are in BRCA1 intron 2 and between NBR2 and exon 2 of psiBRCA1, raising the possibility that this deletion arose via a novel mechanism involving BRCA1:psiBRCA1 recombination. We have also screened 60 familial breast cancer patients from the Australian population, using an amplification refractory mutation system (ARMS) technique described previously by our group, and found one patient with a genotype consistent with a BRCA1 promoter deletion. These findings indicate that germline BRCA1 promoter deletions are a rare and yet significant mutation event and that they could arise via a novel genetic mechanism. Hum Mutat 19:435-442, 2002. (C) 2002 Wiley-Liss, Inc.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

João Vinagre, Vasco Pinto and Ricardo Celestino contributed equally to the manuscript.