HPLC-FLD methods to quantify chloroaluminum phthalocyanine in nanoparticles, plasma and tissue: application in pharmacokinetic and biodistribution studies

Analytical and bioanalytical methods of high-performance liquid chromatography with fluorescence detection (HPLC-FLD) were developed and validated for the determination of chloroaluminum phthalocyanine in different formulations of polymeric nanocapsules, plasma and livers of mice. Plasma and homogenized liver samples were extracted with ethyl acetate, and zinc phthalocyanine was used as internal standard. The results indicated that the methods were linear and selective for all matrices studied. Analysis of accuracy and precision showed adequate values, with variations lower than 10% in biological samples and lower than 2% in analytical samples. The recoveries were as high as 96% and 99% in the plasma and livers, respectively. The quantification limit of the analytical method was 1.12 ng/ml, and the limits of quantification of the bioanalytical method were 15 ng/ml and 75 ng/g for plasma and liver samples, respectively. The bioanalytical method developed was sensitive in the ranges of 15-100 ng/ml in plasma and 75-500 ng/g in liver samples and was applied to studies of biodistribution and pharmacokinetics of AlClPc. (C) 2011 Elsevier B.V. All rights reserved.

Determination of fluoxetine and norfluoxetine enantiomers in human plasma by polypyrrole-coated capillary in-tube solid-phase microextraction coupled with liquid chromatography-fluorescence detection

A sensitive, selective, and reproducible in-tube polypyrrole-coated capillary (PPY) solid-phase microextraction and liquid chromatographic method for fluoxetine and norfluoxetine enantiomers analysis in plasma samples has been developed, validated, and further applied to the analysis of plasma samples from elderly patients undergoing therapy with antidepressants. Important factors in the optimization of in-tube SPME efficiency are discussed, including the sample draw/eject volume, draw/eject cycle number, draw/eject flow-rate, sample pH, and influence of plasma proteins. Separation of the analytes was achieved with a Chiralcel OD-R column and a mobile phase consisting of potassium hexafluorophosphate 7.5 mM and sodium phosphate 0.25 M solution, pH 3.0, and acetonitrile (75:25, v/v) in the isocratic mode, at a flow rate of 1.0 mL/min. Detection was carried out by fluorescence absorbance at Ex/Em 230/290 nm. The multifunctional porous surface structure of the PPY-coated film provided high precision and accuracy for enantiomers. Compared with other commercial capillaries, PPY-coated capillary showed better extraction efficiency for all the analytes. The quantification limits of the proposed method were 10 ng/mL for R- and S-fluoxetine, and 15 ng/mL for R- and S-norfluoxetine, with a coefficient of variation lower than 13%. The response of the method for enantiomers is linear over a dynamic range, from the limit of quantification to 700ng/mL, with correlation coefficients higher than 0.9940. The in-tube SPME/LC method can therefore be successfully used to analyze plasma samples from ageing patients undergoing therapy with fluoxetine. (C) 2009 Elsevier B.V. All rights reserved.

Automated determination of rifampicin in plasma samples by in-tube solid-phase microextraction coupled with liquid chromatography

A sensitive and automated method is described for determination of rifampicin in plasma samples for therapeutic drug monitoring by in-tube solid-phase microextraction coupled with liquid chromatography (in-tube SPME/LC). Important factors in the optimization of in-tube SPME are discussed, such as coating type, sample pH, sample draw/eject volume, number of draw/eject cycles, and draw/eject flow rate. Analyte pre-concentrated in the polyethylene glycol phase was directly transferred to the liquid chromatographic column by percolation of the mobile phase, without carryover. The method was linear over the 0.1-100 mu g/mL range, with a linear coefficient value (r(2)) of 0.998. The inter-assay precision presented coefficient of variation <= 1.7%. The effectiveness and practicability of the proposed method are proven by analysis of plasma samples from ageing patients undergoing therapy with rifampicin. (C) 2011 Elsevier B.V. All rights reserved.

Impact of voluntary folate fortification on plasma homocysteine and serum folate in Australia from 1995 to 2001: a population based cohort study

Study objective: To investigate the effect of the voluntary folate fortification policy in Australia on serum folate and total plasma homocysteine (tHcy) concentrations. Design: Population based cohort study. Setting: Perth, Western Australia. Participants: Men and women aged 27 to 77 years (n = 468), who were originally randomly selected from the Perth electoral roll. The cohort was surveyed in 1995/96 before widespread introduction of folate fortification of a variety of foods, and followed up on two occasions, firstly in 1998/99 and again in 2001, when a moderate number of folate fortified foods were available. Subjects with abnormal serum creatinine concentrations at baseline were excluded from this analysis. Main results: Repeated measures analysis of variance was used to determine changes in serum folate and tHcy over the three surveys and to assess whether time trends were related to age, sex, MTHFR C677T genotype, or consumption of folate fortified foods. An increase (38%) in mean serum folate (p < 0.0005) and a decrease (21%) in mean tHcy (p < 0.0005) were seen after introduction of the voluntary folate fortification policy in Australia. Serum folate was consistently higher (p = 0.032) and tHcy was consistently lower (p = 0.001) in subjects who consumed at least one folate fortified food compared with subjects who did not consume any folate fortified foods in the previous week. The time related changes in serum folate and tHcy were affected only by intake of folate fortified foods (p < 0.0005) and not by any other measured variables including age, sex, or MTHFR genotype. Conclusion: Voluntary fortification of foods with folate in Australia has been followed by a substantial increase in serum folate and decrease in tHcy in the general population.

MINERALOGY AND GENESIS OF SMECTITES IN AN ALKALINE-SALINE ENVIRONMENT OF PANTANAL WETLAND, BRAZIL

Smectite formation in alkaline-saline environments has been attributed to direct precipitation from solution and/or transformation from precursor minerals, but these mechanisms are not universally agreed upon in the literature. The objective of this work was to investigate the mineralogy of smectites in the soils surrounding a representative alkaline-saline lake of Nhecolandia, a sub-region of the Pantanal wetland, Brazil, and then to identify the mechanisms of their formation. Soils were sampled along a toposequence and analyzed by X-ray diffraction, transmission electron microscopy-energy dispersive X-ray analysis, and inductively coupled plasma-mass spectrometry. Water was collected along a transect involving the studied toposequence and equilibrium diagrams were calculated using the databases PHREEQC and AQUA. The fine-clay fraction is dominated by smectite, mica, and kaolinite. Smectites are concentrated at two places in the toposequence: an upper zone, which includes the soil horizons rarely reached by the lake-level variation; and a lower zone, which includes the surface horizon within the area of seasonal lake-level variation. Within the upper zone, the smectite is dioctahedral, rich in Al and Fe, and is classified as ferribeidellite. This phase is interstratified with mica and vermiculite and has an Fe content similar to that of the mica identified. These characteristics suggest that the ferribeidellite originates from transformation of micas and that vermiculite is an intermediate phase in this transformation. Within the lower zone, smectites are dominantly trioctahedral, Mg-rich, and are saponitic and stevensitic minerals. In addition, samples enriched in these minerals have much smaller rare-earth element (REE) contents than other soil samples. The water chemistry shows a geochemical control of Mg and saturation with respect to Mg-smectites in the more saline waters. The REE contents, water chemistry, and the presence of Mg-smectite where maximum evaporation is expected, suggest that saponitic and stevensitic minerals originate by chemical precipitation from the water column of the alkaline-saline lake.

Geospatial clustering in data-rich environments: Features and issues

Geospatial clustering must be designed in such a way that it takes into account the special features of geoinformation and the peculiar nature of geographical environments in order to successfully derive geospatially interesting global concentrations and localized excesses. This paper examines families of geospaital clustering recently proposed in the data mining community and identifies several features and issues especially important to geospatial clustering in data-rich environments.

Metabolic syndrome features small, apolipoprotein A-I-poor, triglyceride-rich HDL3 particles with defective anti-apoptotic activity

The metabolic syndrome (MetS) phenotype is typically characterized by visceral obesity, insulin resistance, atherogenic dyslipidemia involving hypertriglyceridemia and subnormal levels of high density lipoprotein-cholesterol (HDL-C), oxidative stress and elevated cardiovascular risk. The potent antioxidative activity of small HDL3 is defective in MetS [Hansel B, et al. J Clin Endocrinol Metab 2004;89:4963-71]. We evaluated the functional capacity of small HDL3 particles from MetS subjects to protect endothelial cells from apoptosis induced by mildly oxidized low-density lipoprotein (oxLDL). MetS subjects presented an insulin-resistant obese phenotype, with hypertriglyceridemia, elevated apolipoprotein B and insulin levels, but subnormal HDL-C concentrations and chronic low grade inflammation (threefold elevation of C-reactive protein). When human microvascular endothelial cells (HMEC-1) were incubated with oxLDL (200 jig apolipoprotein B/ml) in the presence or absence of control HDL subfiractions (25 mu g protein/ml), small, dense HDL3b and 3c significantly inhibited cellular annexin V binding and intracellular generation of reactive oxygen species. The potent anti-apoptotic activity of small HDL3c particles was reduced (-35%; p < 0.05) in MetS subjects (n = 16) relative to normolipidemic controls (n = 7). The attenuated anti-apoptotic activity of HDL3c correlated with abdominal obesity, atherogenic dyslipidemia and systemic oxidative stress (p < 0.05), and was intimately associated with altered physicochemical properties of apolipoprotein A-I (apoA-I-poor HDL3c, involving core cholesteryl ester depletion and triglyceride enrichment. We conclude that in MetS, apoA-I-poor, small, dense HDL3c exert defective protection of endothelial cells from oxLDL-induced apoptosis, potentially reflecting functional anomalies intimately associated with abnormal neutral lipid core content. (c) 2007 Elsevier Ireland Ltd. All rights reserved.

Elevated plasma membrane and sarcoplasmic reticulum Ca2+ pump mRNA levels in cultured aortic smooth muscle cells from spontaneously hypertensive rats

We have observed previously that Ca2+ pump-mediated Ca2+ efflux is elevated in cultured aortic smooth muscle cells from spontaneously hypertensive rats compared to those from Wistar-Kyoto rat controls. The objective of this work was to determine if these strains differ in mRNA levels for the PMCA1 isoform of the plasma membrane Ca2+-ATPase and the SERCA2 isoform of the sarcoplasmic reticulum Ca2+-ATPase. mRNA levels were compared in cultured aortic smooth muscle cells from 10-week-old male rats. PMCA1 and SERCA2 mRNA levels were elevated in SHR compared to WKY. Angiotensin II increased the level of PMCA1 and SERCA2 mRNA in both strains. These studies provide further evidence for alterered Ca2+ homeostasis in hypertension at the level of Ca2+ transporting ATPases in the spontaneously hypertensive rat model. These data are also consistent with the hypothesis that the expression of these two Ca2+ pumps may be linked. (C) 1997 Academic Press

Human chromosomal fragile site FRA16B is an amplified AT-rich minisatellite repeat

Fragile sites are nonstaining gaps in chromosomes induced by specific tissue culture conditions. They vary both in population frequency and in the culture conditions required for induction. Folate-sensitive fragile sites are due to expansion of p(CCG)(n) trinucleotide repeats; however, the relationship between sequence composition and the chemistry of induction of fragile sites is unclear. To clarify this relationship, the distamycin A-sensitive fragile site FRA16B was isolated by positional cloning and found to be an expanded 33 bp AT-rich minisatellite repeat, p(ATATATTATATATTATATCTAATAATATAT(C)/(A)TA)(n) (consistent with DNA sequence binding preferences of chemicals that induce its cytogenetic expression). Therefore the mutation mechanism associated with trinucleotide repeats is also a property of minisatellite repeats (variable number tandem repeats).

Problems associated with spray drying of sugar-rich foods

Stickiness is a major reason that limits the spray drying of various sugar-rich food products. Higher hygroscopicity of amorphous powder, increase in solubility of sugars with temperature, and lower melting point and glass transition temperature, contribute to the stickiness problem. So far, the glass transition temperature has been widely accepted as a best indicator for stickiness. There are various manoeuvres that have been applied to spray dry such products. Some of them are the addition of drying aids, modification of drier design and use of mild drying temperature conditions. This review paper highlights the major research works that deal with the stickiness property of sugar-rich foods.

Uptake by breast carcinoma of a lipidic nanoemulsion after intralesional injection into the patients: A new strategy for neoadjuvant chemotherapy

Objective. Previously we showed that after intravenous injection a lipidic nanoemulsion concentrates in breast carcinoma tissue and other solid tumors and may carry drugs directed against neoplastic tissues. Use of the nanoemulsion decreases toxicity of the chemotherapeutic agents without decreasing the anticancer action. Currently, the hypothesis was tested whether the nanoemulsion concentrates in breast carcinoma tissue after locoregional injection. Methods. Three different techniques of injection of the nanoemulsion were tested in patients scheduled for surgical treatment: G1 (n=4) into the mammary tissue 5 cm away from the tumor; G2 (n=4) into the peritumoral mammary tissue; G3 (n=6) into the tumoral tissue. The nanoemulsion labeled with radioactive cholesteryl oleate was injected 12 h before surgery; plasma decay of the label was determined from blood samples collected over 24 h and the tissue fragments excised during the surgery were analyzed for radioactivity uptake. Results. Among the three nanoemulsion injection techniques, G3 showed the greatest uptake (data expressed in c.p.m/g of tissue) by the tumor (44,769 +/- 54,749) and by the lymph node (2356 +/- 2966), as well as the greatest concentration in tumor compared to normal tissue (844 +/- 1673). In G1 and G2, uptakes were, respectively, tumor: 60 +/- 71 and 843 +/- 1526; lymph node: 263 +/- 375 and 102 +/- 74; normal tissue: 139 +/- 102 and 217 +/- 413. Conclusions. Therefore, with intralesional injection of the nanoemulsion, a great concentration effect can be achieved. This injection technique may be thus a promising approach for drug-targeting in neoadjuvant chemotherapy in breast cancer treatment. (C) 2008 Published by Elsevier Inc.

Development of a synthetic 7-ketocholesterol- rich emulsion resembling chylomicrons

Lipid emulsions that mimic natural lipoproteins help to understand the metabolism and the constitutional organization of circulating lipids. Chylomicrons synthesised by enterocyte cells usually contain oxysterols such as 7-ketocholesterol (7-KC). Here we describe the development of a 7-KC-containing emulsion as a model for oxisterol-rich chylomicron. Different amounts of 7-KC were used. Emulsion characteristics as effective diameter, lipid saturation with radiolabeled lipids was evaluated. In conclusion, the production of a synthetic 7-KC-rich emulsion resembling hylomicrons was feasible, being a model for in vivo metabolism studies.