919 resultados para Human-induced Loads


Relevância:

30.00% 30.00%

Publicador:

Resumo:

Fragile sites are nonstaining gaps in chromosomes induced by specific tissue culture conditions. They vary both in population frequency and in the culture conditions required for induction. Folate-sensitive fragile sites are due to expansion of p(CCG)(n) trinucleotide repeats; however, the relationship between sequence composition and the chemistry of induction of fragile sites is unclear. To clarify this relationship, the distamycin A-sensitive fragile site FRA16B was isolated by positional cloning and found to be an expanded 33 bp AT-rich minisatellite repeat, p(ATATATTATATATTATATCTAATAATATAT(C)/(A)TA)(n) (consistent with DNA sequence binding preferences of chemicals that induce its cytogenetic expression). Therefore the mutation mechanism associated with trinucleotide repeats is also a property of minisatellite repeats (variable number tandem repeats).

Relevância:

30.00% 30.00%

Publicador:

Resumo:

P>Human immunodeficiency virus (HIV)-1 protease is a known target of CD8+ T cell responses, but it is the only HIV-1 protein in which no fully characterized HIV-1 protease CD4 epitopes have been identified to date. We investigated the recognition of HIV-1 protease by CD4+ T cells from 75 HIV-1-infected, protease inhibitor (PI)-treated patients, using the 5,6-carboxyfluorescein diacetate succinimidyl ester-based proliferation assay. In order to identify putative promiscuous CD4+ T cell epitopes, we used the TEPITOPE algorithm to scan the sequence of the HXB2 HIV-1 protease. Protease regions 4-23, 45-64 and 73-95 were identified; 32 sequence variants of the mentioned regions, encoding frequent PI-induced mutations and polymorphisms, were also tested. On average, each peptide bound to five of 15 tested common human leucocyte antigen D-related (HLA-DR) molecules. More than 80% of the patients displayed CD4+ as well as CD8+ T cell recognition of at least one of the protease peptides. All 35 peptides were recognized. The response was not associated with particular HLA-DR or -DQ alleles. Our results thus indicate that protease is a frequent target of CD4+ along with CD8+ proliferative T cell responses by the majority of HIV-1-infected patients under PI therapy. The frequent finding of matching CD4+ and CD8+ T cell responses to the same peptides may indicate that CD4+ T cells provide cognate T cell help for the maintenance of long-living protease-specific functional CD8+ T cells.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Elevated concentrations of plasma tumour necrosis factor (TNF)-alpha, interleukin (IL)-1 and IL-6 have been detected in patients with alcoholic hepatitis and have been implicated in the pathogenesis of hepatocyte necrosis. The present study used a rat model to conduct a detailed histological and biochemical examination of the expression of various pro-inflammatory cytokines and associated liver pathology in ethanol-potentiated lipopolysaccharide (LPS)-induced liver injury. Male Wistar rats were pair-fed either the control or ethanol-containing (36% of caloric intake as ethanol) form of the Lieber-DeCarli liquid diet for 6 weeks. Liver injury was induced by the i.v. injection of LPS (1 mu g/g bodyweight), with animals being killed at O, 1, 3, 6, 12 and 24 h after injection. At the later time points, plasma transaminase and transpeptidase activities were significantly elevated in ethanol-fed LPS-treated rats compared with control-fed LPS-treated animals. At these times after LPS treatment, hepatocytes in ethanol-fed animals displayed fatty change and necrosis with an associated neutrophil polymorph infiltrate. Time course analysis revealed that plasma TNF-alpha (1-3 h post-LPS) and IL-6 (3 h post-LPS) bioactivity was significantly elevated in ethanol-fed compared with control-fed animals. No difference was seen in plasma IL-1 alpha concentration (maximal in both groups 6 h post-LPS). The expression of TNF-alpha, IL-1 alpha, IL-1 beta and IL-6 mRNA were elevated between 1 and 6 h post-LPS in the livers of both control and ethanol-fed rats. However, ethanol-fed LPS-treated animals exhibited significantly higher maximal expression of IL-1 and IL-6 mRNA. Comparison of the appearance of cytokine mRNA and plasma bioactivity indicated an effect of ethanol feeding on post-transcriptional processing and/or the kinetics of the circulating cytokines. Elevated levels of both hepatic cytokine mRNA expression and the preceding plasma cytokines are presumably a necessary prerequisite for hepatic injury seen in this model and, therefore, possibly for the damage seen in human alcoholics. Further studies using this model may lead to significant advances in our understanding of the pathogenic mechanisms of alcoholic liver disease in humans.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

While many studies have addressed the direct effects of 1 alpha,25(OH)(2)D(3) on breast cancer (BC) cells, stromal-epithelial interactions, which are important for the tumor development, have been largely ignored. In addition, high concentrations of the hormone, which cannot be attained in vivo, have been used. Our aim was to establish a more physiological breast cancer model, represented by BC tissue slices, which maintain epithelial-mesenchymal interactions, cultured with a relatively low 1 alpha,25(OH)(2)D(3) concentration, in order to evaluate the vitamin D pathway. Freshly excised human BC samples were sliced and cultured in complete culture media containing vehicle, 0.5 nM or 100 nM 1 alpha,25(OH)(2)D(3) for 24 h. BC slices remained viable for at least 24 h, as evaluated by preserved tissue morphology in hematoxylin and eosin (HE) stained sections and bromodeoxyuridine (BrdU) incorporation by 10% of tumor cells. VDR mRNA expression was detected in all samples and CYP24A1 mRNA expression was induced by 1 alpha,25(OH)(2)D(3) in both concentrations (but mainly with 100 nM). Our results indicate that the vitamin D signaling pathway is functional in BC slices, a model which preserves stromal-epithelial interactions and mimics in vivo conditions. (C) 2010 Elsevier Ltd. All rights reserved.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

In a previous study, we found that the cytokine (human) leukemia inhibitory factor (hLIF) significantly reduced plasma cholesterol levels and the accumulation of lipid in aortic tissues of cholesterol-fed rabbits after 4 weeks of treatment. The mechanisms by which this occurs were investigated in the present study. This involved examining the effect of hLIF on (1) the level of plasma cholesterol at different times throughout the 4-week treatment and diet period; (2) smooth muscle cell (SMC) and macrophage-derived foam cell formation in vitro; and (3) LDL receptor expression and uptake in the human hepatoma cell line HepG2. At time zero, an osmotic minipump (2-mL capacity; infusion rate, 2.5 mu L/h; 28 days) containing either hLIF (30 mu g.kg(-1).d(-1)) or saline was inserted into the peritoneal cavity of New Zealand White rabbits (N=24). Rabbits were divided into four groups of six animals each. Group 1 received a normal diet/saline; group 2, a normal diet/hLIF; group 3, a 1% cholesterol diet/saline; and group 4, a 1% cholesterol diet/hLIF. hLIF had no effect on the plasma lipids or artery wall of group 2 rabbits (normal diet). However, in group 4 rabbits, plasma cholesterol levels and the percent surface area of thoracic aorta covered by fatty streaks was decreased by approximate to 30% and 80%, respectively, throughout all stages of the 4-week treatment period. In vitro, hLIF failed to prevent lipoprotein uptake by either SMCs or macrophages (foam cell formation) when the cells were exposed to P-VLDL for 24 hours. In contrast, hLIF (100 ng/mL) added to cultured human hepatoma HepG2 cells induced a twofold or threefold increase in intracellular lipid accumulation in the medium containing 10% lipoprotein-deficient serum or 10% fetal calf serum, respectively. This was accompanied by a significant non-dose-dependent increase in LDL receptor expression in hLIF-treated HepG2 cells incubated with LDL (20 mu g/mL) when compared with controls (P

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Objectives: To examine the effects of triiodothyronine (T(3)), 17 beta-estradiol (E(2)), and tamoxifen (TAM) on transforming growth factor (TGF)-alpha gene expression in primary breast cancer cell cultures and interactions between the different treatments. Methods and results: Patients included in the study (no.=12) had been newly diagnosed with breast cancer. Fresh human breast carcinoma tissue was cut into 0.3-mm slices. These slices were placed in six 35-mm dishes on 2-ml organ culture medium. Dishes received the following treatments: dish 1: ethanol; dish 2: T(3); dish 3: T(3)+TAM; dish 4: TAM; dish 5: E(2); dish 6: E(2)+TAM. TGF-alpha mRNA content was normalized to glyceraldehyde-3-phosphate dehydrogenase mRNA levels. All tissues included in this study were positive for estrogen receptor (ER) and thyroid hormone receptor expression. Treatment with T(3) for 48 h significantly increased TGF-alpha mRNA levels compared to controls (15-fold), and concomitant treatment with TAM reduced expression to 3.4-fold compared to controls. When only TAM was added to the culture medium, TGF-alpha mRNA expression increased 5.3-fold, significantly higher than with all other treatment modalities. Conclusion: We demonstrate that TGF-alpha mRNA expression is more efficiently upregulated by T(3) than E(2). Concomitant treatment with TAM had a mitigating effect on the T(3) effect, while E(2) induced TGF-alpha upregulation. Our findings show some similarities between primary culture and breast cancer cell lines, but also some important differences: a) induction of TGF-alpha, a mitogenic protein, by TAM; b) a differential effect of TAM that may depend on relative expression of ER alpha and beta; and c) supraphysiological doses of T3 may induce mitogenic signals in breast cancer tissue under conditions of low circulating E(2).. Endocrinol. Invest. 31: 1047-1051, 2008) (c) 2008, Editrice Kurtis

Relevância:

30.00% 30.00%

Publicador:

Resumo:

In previous studies, we determined that beta 1 integrins from human colon tumors have elevated levels of alpha 2-6 sialylation, a modification added by beta-galactosamide alpha-2,6-sialyltranferase I (ST6Gal-I). Intriguingly, the beta 1 integrin is thought to be a ligand for galectin-3 (gal-3), a tumor-associated lectin. The effects of gal-3 are complex; intracellular forms typically protect cells against apoptosis through carbohydrate-independent mechanisms, whereas secreted forms bind to cell surface oligosaccharides and induce apoptosis. In the current study, we tested whether alpha 2-6 sialylation of the beta 1 integrin modulates binding to extracellular gal-3. Herein we report that SW48 colonocytes lacking alpha 2-6 sialylation exhibit beta 1 integrin-dependent binding to gal-3-coated tissue culture plates; however, binding is attenuated upon forced expression of ST6Gal-I. Removal of alpha 2-6 sialic acids from ST6Gal-I expressors by neuraminidase treatment restores gal-3 binding. Additionally, using a blot overlay approach, we determined that gal-3 binds directly and preferentially to unsialylated, as compared with alpha 2-6-sialylated, beta 1 integrins. To understand the physiologic consequences of gal-3 binding, cells were treated with gal-3 and monitored for apoptosis. Galectin-3 was found to induce apoptosis in parental SW48 colonocytes ( unsialylated), whereas ST6Gal-I expressors were protected. Importantly, gal-3-induced apoptosis was inhibited by function blocking antibodies against the beta 1 subunit, suggesting that beta 1 integrins are critical transducers of gal-3-mediated effects on cell survival. Collectively, our results suggest that the coordinate up-regulation of gal-3 and ST6Gal-I, a feature that is characteristic of colon carcinoma, may confer tumor cells with a selective advantage by providing a mechanism for blockade of the pro-apoptotic effects of secreted gal-3.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Levels of recombinant human follicle stimulating hormone (r-hFSH) mRNA expressed under butyrate and zinc treatment were compared in two CHO-K1 derived cell lines. In King cells under the metallothionein promoter, butyrate induced the increase in both r-hFSH productivity (q(FSH)) and mRNA levels proportionally. In the presence of 1 mM butyrate and 40 mu M zinc, a 4-fold increase in q(FSH) and mRNA levels was achieved as compared to zinc (40) alone; this wasa approximately 6 times higher than in serum free medium. In Darren cells under the beta-actin promotor butyrate induced an increase in q(SFH) but not in mRNA levels.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

The cytochrome P450-dependent covalent binding of radiolabel derived fi om phenytoin (DPH) and its phenol and catechol metabolites, 5-(4'-hydroxyphenyl)-5-phenylhydantoin (HPPH) and 5-(3',4'-dihydroxyphenyl)-5-phenylhydantoin (CAT), was examined in liver microsomes. Radiolabeled HPPH and CAT and unlabeled CAT were obtained from microsomal incubations and isolated by preparative HPLC. NADPH-dependent covalent binding was demonstrated in incubations of human liver microsomes with HPPH. When CAT was used as substrate, covalent adduct formation was independent of NADPH, was enhanced in the presence of systems generating reactive oxygen species, and was diminished under anaerobic conditions or in the presence of cytoprotective reducing agents. Fluorographic analysis showed that radiolabel derived from DPH and HPPH was selectively associated with proteins migrating with approximate relative molecular weights of 57-59 kDa and at the dye front (molecular weights < 23 kDa) on denaturing gels. Lower levels of radiolabel were distributed throughout the molecular weight range. In contrast, little selectivity was seen in covalent adducts formed from CAT. HPPH was shown to be a mechanism-based inactivator of P450, supporting the contention that a cytochrome P450 is one target of covalent binding. These results suggest that covalent binding of radiolabel derived from DPH in rat and human Liver microsomes occurs via initial P450-dependent catechol formation followed by spontaneous oxidation to quinone and semiquinone derivatives that ultimately react with microsomal protein. Targets for covalent binding may include P450s, though the catechol appears to be sufficiently stable to migrate out of the P450 active site to form adducts with other proteins. In conclusion, we have demonstrated that DPH can be bioactivated in human liver to metabolites capable of covalently binding to proteins. The relationship of adduct formation to DPH-induced hypersensitivity reactions remains to be clarified.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

We have previously shown that human leukaemia inhibitory factor (hLIF) inhibits perivascular cuff-induced neointimal formation in the rabbit carotid artery. Since nitric oxide (NO) is a known inhibitor of smooth muscle growth, NO synthase (NOS) activity in the presence of hLIF was examined in vivo and in vitro. In rabbit aortic smooth muscle cell (SMC) culture, significant NOS activity was observed at 50 pg/ml hLIF, with maximal activity at 5 ng/ml. In the presence of the NOS inhibitor L-NAME, hLIF-induced activation of NOS was greatly decreased, however it was still 63-fold higher than in control (p < 0.05). SMC-DNA synthesis was significantly reduced (-47%) following incubation with hLIF plus L-arginine, the substrate required for NO production (p < 0.05), with no effect observed in the absence of L-arginine. Silastic cuff placement over the right carotid artery of rabbits resulted in a neointima 19.3 +/- 5.4% of total wall cross-sectional area, which was increased in the presence of L-NAME (27.0 +/- 2.0%; p < 0.05) and reduced in the presence of L-arginine (11.3 +/- 2.0%; p < 0.05). The effect of L-arginine was ameliorated by co-administration of L-NAME (16.4 +/- 1.5%). However, administration of L-NAME with hLIF had no effect on the potent inhibition of neointimal formation by hLIF (3.2 +/- 2.5 vs. 2.1 +/- 5.4%, respectively). Similarly, with hLIF administration, NOS activity in the cuffed carotid increased to 269.0 +/- 14.0% of saline-treated controls and remained significantly higher with coadministration of L-NAME (188.5 +/- 14.7%). These results indicate that hLIF causes superinduction of NO by SMC, and that it is, either partially or wholly, through this mechanism that hLIF is a potent inhibitor of neointimal formation in vivo and of smooth muscle proliferation in vitro.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

The ability of mesenchymal stem cells to generate functional neurons in culture is still a matter of controversy. In order to assess this issue, we performed a functional comparison between neuronal differentiation of human MSCs and fetal-derived neural stem cells (NSCs) based on morphological, immunocytochemical, and electrophysiological criteria. Furthermore, possible biochemical mechanisms involved in this process were presented. NF200 immunostaining was used to quantify the yield of differentiated cells after exposure to CAMP. The addition of a PKA inhibitor and Ca(2+) blockers to the differentiation medium significantly reduced the yield of differentiated cells. Activation of CREB was also observed on MSCs during maturation. Na(+)-, K(+)-, and Ca(2+)-voltage-dependent currents were recorded from MSCs-derived cells. In contrast, significantly larger Na(+) currents, firing activity, and spontaneous synaptic currents were recorded from NSCs. Our results indicate that the initial neuronal differentiation of MSCs is induced by CAMP and seems to be dependent upon Ca(2+) and the PKA pathway. However, compared to fetal neural stem cells, adult mesenchymal counterparts are limited in their neurogenic potential. Despite the similar yield of neuronal cells, NSCs achieved a more mature functional state. Description of the underlying mechanisms that govern MSCs` differentiation toward a stable neuronal phenotype and their limitations provides a unique opportunity to enhance our understanding of stem cell plasticity. (C) 2009 Elsevier Inc. All rights reserved.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Fleet enemas are hypertonic solutions with an osmotic action and a high concentration of phosphate. When retained in the human body they have a great toxic potential, causing severe hydro-electrolyte disorders in children, especially in newborns. We report the case of a previously healthy 8-day-old newborn who needed neonatal intensive care treatment after the inadvertent administration of an osmotically active hypertonic phosphate enema. Taking into account that phosphate removal by peritoneal dialysis (PD) strongly depends on total dialysate turnover, we chose continuous flow PD (CFPD) as the treatment option, with a successful outcome. Clinical experience with this dialytic modality is limited to a few case reports in pediatric and adult patients. To the best of our knowledge, we report here the first description of CFPD in the setting of acute phosphate nephropathy in the neonatal period. The modality of PD described here has potential as an alternative management option as it is a highly efficient, methodologically simple, and low-cost method without any need for sophisticated equipment. Physicians and parents should be aware of the adverse effects of a hypertonic phosphate enema and should never use these medications in infants and newborns.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Purpose: alpha-Melanocyte stimulating hormone protects kidneys against ischemia and sepsis induced acute kidney injury in rodents. We examined the efficacy of a-melanocyte stimulating hormone analogue AP214 to protect against acute kidney injury in higher vertebrates. Materials and Methods: We performed a prospective, blinded, randomized, placebo controlled study in 26 pigs. Laparoscopic technique was used for left nephrectomy and to induce complete warm ischemia in the right kidney for 120 minutes. AP214 (200 mu g/kg intravenously) was administered daily on the day of surgery and for 5 days thereafter. Kidney function was measured for 9 days. We measured changes in serum creatinine, estimated glomerular filtration rate, serum C-reactive protein and urine interleukin-18. Results: In the placebo control and AP214 groups mean peak serum creatinine was 10.2 vs 3.92 mg/dl and the estimated glomerular filtration rate nadir was 22.9 vs 62.6 ml per minute per kg (each p = 0.001). Functional nadir occurred at 72 vs 24 hours in the control vs AP214 groups. Estimated glomerular filtration rate outcome on postoperative day 9 was 118 vs 156 ml per minute per kg in the control vs AP214 groups (p = 0.04). Conclusions: We noted a robust renoprotective effect of AP214. A similar AP214 effect may be observed in humans. Future research includes mechanistic studies in pigs and a phase II human clinical trial of AP214 in kidney transplant and partial nephrectomy populations.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Strategies to minimize the immunogenicity and toxicity of murine anti-CD3 antibodies (e.g. OKT3) are of special interest for organ transplantation and for the treatment of autoimmune diseases. In the present work, we have developed two humanized anti-CD3 antibodies. These molecules were shown to bind to human CD3, though less efficiently, and display less mitogenic activity than CKT3. These results prompted us to investigate whether this reduced mitogenic potential was associated with the development of anti-inflammatory properties. Indeed, in peripheral blood mononuclear cells (PBMCs), the humanized antibody versions induced a predominantly anti-inflammatory cytokine profile, in contrast with the pro-inflammatory profile induced by OKT3. Neither OKT3 nor the humanized versions induced the expression of IL-4, IL-2 or TGF-beta. Both humanized antibodies induced significantly lower production of IFN-gamma and IL-5 and slightly higher production of IL-10 than OKT3. This immunomodulatory profile was most evident by the 80-fold higher ratio of IL-10/IFN-gamma production in PBMCs cultured in the presence of the humanized antibodies, compared to those stimulated with CKT3. Furthermore, these humanized anti-CD3 antibodies induced a late FOXP3 gene expression while OKT3 led to a more transient expression of FOXP3. Taken our results, we suggest that these humanized anti-CD3 antibodies may promote the development of T cells with immunoregulatory activity. (C) 2009 Elsevier B.V. All rights reserved.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Of the hundreds of new tuberculosis ( TB) vaccine candidates some have therapeutic value in addition to their prophylactic properties. This is the case for the DNA vaccine encoding heat-shock protein 65 (DNAhsp65) from Mycobacterium leprae. However, there are concerns about the use of DNA vaccines in certain populations such as newborns and pregnant women. Thus, the optimization of vaccination strategies that circumvent this limitation is a priority. This study evaluated the efficacy of a single dose subunit vaccine based on recombinant Hsp65 protein against infection with M. tuberculosis H37Rv. The Hsp65 protein in this study was either associated or not with immunostimulants, and was encapsulated in biodegradable PLGA microspheres. Our results demonstrate that the protein was entrapped in microspheres of adequate diameter to be engulfed by phagocytes. Mice vaccinated with a single dose of Hsp65-microspheres or Hsp65 + CpG-microspheres developed both humoral and cellular-specific immune responses. However, they did not protect mice against challenge with M. tuberculosis. By contrast, Hsp65+KLK-microspheres induced specific immune responses that reduced bacilli loads and minimized lung parenchyma damage. These data suggest that a subunit vaccine based on recombinant protein Hsp65 is feasible.