969 resultados para Canopy gaps


Relevância:

10.00% 10.00%

Publicador:

Resumo:

Traditional field sampling approaches for ecological studies of restored habitat can only cover small areas in detail, con be time consuming, and are often invasive and destructive. Spatially extensive and non-invasive remotely sensed data can make field sampling more focused and efficient. The objective of this work was to investigate the feasibility and accuracy of hand-held and airborne remotely sensed data to estimate vegetation structural parameters for an indicator plant species in a restored wetland. High spatial resolution, digital, multispectral camera images were captured from an aircraft over Sweetwater Marsh (San Diego County, California) during each growing season between 1992-1996. Field data were collected concurrently, which included plant heights, proportional ground cover and canopy architecture type, and spectral radiometer measurements. Spartina foliosa (Pacific cordgrass) is the indicator species for the restoration monitoring. A conceptual model summarizing the controls on the spectral reflectance properties of Pacific cordgrass was established. Empirical models were developed relating the stem length, density, and canopy architecture of cordgrass to normalized-difference-vegetation-index values. The most promising results were obtained from empirical estimates of total ground cover using image data that had been stratified into high, middle, and low marsh zones. As part of on-going restoration monitoring activities, this model is being used to provide maps of estimated vegetation cover.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

We assembled a globally-derived data set for site-averaged foliar delta(15)N, the delta(15)N of whole surface mineral soil and corresponding site factors (mean annual rainfall and temperature, latitude, altitude and soil pH). The delta(15)N of whole soil was related to all of the site variables (including foliar delta(15)N) except altitude and, when regressed on latitude and rainfall, provided the best model of these data, accounting for 49% of the variation in whole soil delta(15)N. As single linear regressions, site-averaged foliar delta(15)N was more strongly related to rainfall than was whole soil delta(15)N. A smaller data set showed similar, negative correlations between whole soil delta(15)N, site-averaged foliar delta(15)N and soil moisture variations during a single growing season. The negative correlation between water availability (measured here by rainfall and temperature) and soil or plant delta(15)N fails at the landscape scale, where wet spots are delta(15)N-enriched relative to their drier surroundings. Here we present global and seasonal data, postulate a proximate mechanism for the overall relationship between water availability and ecosystem delta(15)N and, newly, a mechanism accounting for the highly delta(15)N-depleted values found in the foliage and soils of many wet/cold ecosystems. These hypotheses are complemented by documentation of the present gaps in knowledge, suggesting lines of research which will provide new insights into terrestrial N-cycling. Our conclusions are consistent with those of Austin and Vitousek (1998) that foliar (and soil) delta(15)N appear to be related to the residence time of whole ecosystem N.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

This paper summarizes the processes involved in designing a mathematical model of a growing pasture plant, Stylosanthes scabra Vog. cv. Fitzroy. The model is based on the mathematical formalism of Lindenmayer systems and yields realistic computer-generated images of progressive plant geometry through time. The processes involved in attaining growth data, retrieving useful growth rules, and constructing a virtual plant model are outlined. Progressive output morphological data proved useful for predicting total leaf area and allowed for easier quantification of plant canopy size in terms of biomass and total leaf area.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

The mean annual litterfall at two dry woodland sites in central Queensland was 1129 kg ha(-1) for an open E. populnea F. Muell. woodland (n = 2 years), and 2318 kg ha(-1) for a woodland dominated by E. cambageana Maiden (n = 1 year). Leaves formed the largest component of total litterfall, which varied seasonally with a spring-summer maximum. Annual litterfall at these sites conformed with a pattern of decreasing litter production with declining annual rainfall, consistent with a range of eucalypt-dominated communities.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

The Montreal Process indicators are intended to provide a common framework for assessing and reviewing progress toward sustainable forest management. The potential of a combined geometrical-optical/spectral mixture analysis model was assessed for mapping the Montreal Process age class and successional age indicators at a regional scale using Landsat Thematic data. The project location is an area of eucalyptus forest in Emu Creek State Forest, Southeast Queensland, Australia. A quantitative model relating the spectral reflectance of a forest to the illumination geometry, slope, and aspect of the terrain surface and the size, shape, and density, and canopy size. Inversion of this model necessitated the use of spectral mixture analysis to recover subpixel information on the fractional extent of ground scene elements (such as sunlit canopy, shaded canopy, sunlit background, and shaded background). Results obtained fron a sensitivity analysis allowed improved allocation of resources to maximize the predictive accuracy of the model. It was found that modeled estimates of crown cover projection, canopy size, and tree densities had significant agreement with field and air photo-interpreted estimates. However, the accuracy of the successional stage classification was limited. The results obtained highlight the potential for future integration of high and moderate spatial resolution-imaging sensors for monitoring forest structure and condition. (C) Elsevier Science Inc., 2000.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

In this study the variations in surface reflectance properties and pigment concentrations of Antarctic moss over species, sites, microtopography and with water content were investigated. It was found that species had significantly different surface reflectance properties, particularly in the region of the red edge (approximately 700 nm), but this did not correlate strongly with pigment concentrations. Surface reflectance of moss also varied in the visible region and in the characteristics of the red edge over different sites. Reflectance parameters, such as the photochemical reflectance index (PRI) and cold hard band were useful discriminators of site, microtopographic position and water content. The PRI was correlated both with the concentrations of active xanthophyll-cycle pigments and the photosynthetic light use efficiency, F-v/F-m, measured using chlorophyll fluorescence. Water content of moss strongly influenced the amplitude and position of the red-edge as well as the PRI, and may be responsible for observed differences in reflectance properties for different species and sites. All moss showed sustained high levels of photoprotective xanthophyll pigments, especially at exposed sites, indicating moss is experiencing continual high levels of photochemical stress.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

The thermal ecology and structural habitat use of two closely related sympatric lizards, Carlia vivax (de Vis) and Lygisaurus foliorum de Vis, were examined in an open sclerophyll forest in subtropical Australia. Comparable mean body temperatures (T-b) and habitat temperatures (T-hab) at the point of capture were recorded for both species. However, sex- related differences in the thermal variables for C. vivax, with females displaying higher temperatures than males, resulted in some significant differences in T-b and T-hab between the species. Variation in T-b and T-hab within and between species was unrelated to time of capture. The difference in T-hab within C. vivax suggested that females were selecting warmer thermal environments than males. Both C. vivax and L. foliorum used most structural features of their habitat randomly as indicated by a similarity in canopy, shrub, ground, log and litter cover and litter depth between habitat surveys and random surveys. However, C. vivax displayed a preference for ground vegetation (height

Relevância:

10.00% 10.00%

Publicador:

Resumo:

To attend and obtain the systems and. internal controls mechanisms proposed by Sarbanes-Oxley certifications is actually a big challenge,for most of the multinational companies registered in SEC (US Securities and Exchange Commission). This work has the objective of contributing to the analysis of this methodology, not only to attend the law but to reduce cost and generate value through the strengthen of the internal control systems, turning them into animating value generation process mechanisms. So, the idea is to identify the main gaps in the theory through the literature revision and a case study in order to put a question to the main deficiencies, strong points or contributions through the evaluation of the noticed practices. Finally, we can say that a a result of the research and the analyses made in. this case, the vast majority of executives and other employees recognize the benefit that Sarbanes-Oxley Act has brought to the company searched. Also recognize that, although there is still necessity for systemic adequacy and infrastructure, it helps and reinforce reducing and controlling the risks. the system of internal controls in all areas of expertise. They approach and understand that there is the need for a change in the other employees` culture to be inserted in the day-today routine as internal controls, attention to Sarbanes-Oxley and Corporate Governance, making the control cost smaller when compared to the benefits generated.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Background There are few population-based data on long-term management of patients after coronary artery bypass graft (CABG), despite the high risk for future major vascular events among this group. We assessed the prevalence and correlates of pharmacotherapy for prevention of new cardiac events in a large population-based series. Methods A postal survey was conducted of 2500 randomly selected survivors from a state population of patients 6 to 20 years after first CABG. Results Response was 82% (n = 2061). Use of antiplatelet agents (80%) and statins (64%) declined as age increased. Other independent predictors of antiplatelet use included statin use (odds ratio [OR] 1.6, 95% CI 1.26-2.05) and recurrent angina (OR 1.6, CI 1.17-2.06). Current smokers were less likely to use aspirin (OR 0.59, CI 0.4-0.89). Statin use was associated with reported high cholesterol (OR 24.4, CI 8.4-32.4), management by a cardiologist (OR 2.3, CI 1.8-3.0), and the use of calcium channel-blockers. Patients reporting hypertension or heart failure, in addition to high cholesterol, were less likely to use statins. Angiotensin-converting enzyme inhibitors were the most commonly prescribed agents for management of hypertension (59%) and were more frequently used among patients with diabetes and those with symptoms of heart failure. Overall 42% of patients were on angiotensin-converting enzyme inhibitors and 36% on beta-blockers. Conclusions Gaps exist in the use of-recommended medications after CABG. Lower anti-platelet and statin use was associated with older age, freedom from angina, comorbid heart failure or hypertension, and not regularly visiting a cardiologist. Patients who continue to smoke might be less likely to adhere to prescribed medications.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Fragile sites appear visually as nonstaining gaps on chromosomes that are inducible by specific cell culture conditions. Expansion of CGG/ CCG repeats has been shown to be the molecular basis of all five folate-sensitive fragile sites characterized molecularly so far, i.e., FRAXA, FRAXE, FRAXF, FRA11B, and FRA16A. In the present study we have refined the localization of the FRA10A folate-sensitive fragile site by fluorescence in situ hybridization. Sequence analysis of a BAC clone spanning FRA10A identified a single, imperfect, but polymorphic CGG repeat that is part of a CpG island in the 5'UTR of a novel gene named FRA10ACl. The number of CGG repeats varied in the population from 8 to 13. Expansions exceeding 200 repeat units were methylated in all FRA10A fragile site carriers tested. The FRA10ACl gene consists of 19 exons and is transcribed in the centromeric direction from the FRA10A repeat. The major transcript of similar to 1450 nt is ubiquitously expressed and codes for a highly conserved protein, FRA10ACl, of unknown function. Several splice variants leading to alternative 3' ends were identified (particularly in testis). These give rise to FRA10ACl proteins with altered COOH-termini. Immunofluorescence analysis of full-length, recombinant EGFP-tagged FRA10ACl protein showed that it was present exclusively in the nucleoplasm. We show that the expression of FRA10A, in parallel to the other cloned folate-sensitive fragile sites, is caused by an expansion and subsequent methylation of an unstable CGG trinucleotide repeat. Taking advantage of three cSNPs within the FRA10ACl gene we demonstrate that one allele of the gene is not transcribed in a FRA10A carrier. Our data also suggest that in the heterozygous state FRA10A is likely a benign folate-sensitive fragile site. (C) 2004 Elsevier Inc. All rights reserved.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

The Strength of Weak Parties The aim of this article is to fill some gaps in research on the Brazilian electoral arena. The current literature, by neglecting the study of party organization, ends up overlooking fundamental questions for understanding how the electoral process works. This study addressed two questions: How do Brazilian parties work? What is the impact of party organization on a party`s decision to launch or withhold a candidate in a given election? We intend to show that the parties have more life than many studies on our political system tend to show. This partisan life helps understand one of the central aspects of the electoral arena, that is, how pre-election coordination occurs.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Fragile sites are nonstaining gaps in chromosomes induced by specific tissue culture conditions. They vary both in population frequency and in the culture conditions required for induction. Folate-sensitive fragile sites are due to expansion of p(CCG)(n) trinucleotide repeats; however, the relationship between sequence composition and the chemistry of induction of fragile sites is unclear. To clarify this relationship, the distamycin A-sensitive fragile site FRA16B was isolated by positional cloning and found to be an expanded 33 bp AT-rich minisatellite repeat, p(ATATATTATATATTATATCTAATAATATAT(C)/(A)TA)(n) (consistent with DNA sequence binding preferences of chemicals that induce its cytogenetic expression). Therefore the mutation mechanism associated with trinucleotide repeats is also a property of minisatellite repeats (variable number tandem repeats).

Relevância:

10.00% 10.00%

Publicador:

Resumo:

A simple framework was used to analyse the determinants of potential yield of sunflower (Helianthus annuus L.) in a subtropical environment. The aim was to investigate the stability of the determinants crop duration, canopy light interception, radiation use efficiency (RUE), and harvest index (HI) at 2 sowing times and with 3 genotypes differing in crop maturity and stature. Crop growth, phenology, light interception, yield, prevailing temperature, and radiation were recorded and measured throughout the crop cycle. Significant differences in grain yield were found between the 2 sowings, but not among genotypes within each sowing. Mean yields (0% moisture) were 6 . 02 and 2 . 17 t/ha for the first sowing, on 13 September (S1), and the second sowing, on 5 March (S2), respectively. Exceptionally high yields in S1 were due to high biomass assimilation associated with the high radiation environment, high light interception owing to a greater leaf area index, and high RUE (1 . 47-1 . 62 g/MJ) across genotypes. It is proposed that the high RUE was caused by high levels of available nitrogen maintained during crop growth by frequent applications of fertiliser and sewage effluent as irrigation. In addition to differences in the radiation environment, the assimilate partitioned to grain was reduced in S2 associated with a reduction in the duration of grain-filling. Harvest index was 0 . 40 in S1 and 0 . 25 in S2. It is hypothesised that low minimum temperatures experienced in S2 reduced assimilate production and partitioning, causing premature maturation.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Specific leaf nitrogen (SLN, g/m(2)) is known to affect radiation use efficiency (RUE, g/MJ) in different crops, However, this association and importance have not been well established over a range of different nitrogen regimes for held-grown sunflower (Helianthus annuus L.). An experiment was conducted to investigate different combinations and rates of applied nitrogen on SLN, RUE, and growth of sunflower, A fully irrigated crop was sown on an alluvial-prairie soil (Fluventic Haplustoll) and treated with five combinations of applied nitrogen, Greater nitrogen increased biomass, grain number, and yield, but did not affect harvest index energy-corrected for oil (0.4) or canopy extinction coefficient (0.88), Decreases in biomass accumulation under low nitrogen treatments were associated,vith reductions in leaf area index (LAI) and light interception, When SLN and RUE were examined together, both were less in the anthesis to physiological maturity period, but relatively stable between bud visible and anthesis, However, the effects of canopy SLN on RUE were confounded by high SLN in the top of the canopy and the crop maintaining SLN by reducing LAI, Measurements of leaf CO2 assimilation and theoretical analyses of RUE supported that RUE was related to SLN, The major effect of nitrogen on early growth of sunflower was mediated by leaf area and the distribution of SLN in the canopy rather than direct effects of canopy SLN on RUE alone. Greater responses of RUE to SLN are more evident later in growth, and may be related to the demand of nitrogen by the grain.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

The level of incident radiation and the proportion of radiation that is diffuse affects radiation use efficiency (RUE) in crops, However, the degree of this effect, and its importance to growth and yield of sunflower (Helianthus annuus L.) have not been established. A field experiment was conducted to investigate the effects of radiation environment on RUE, growth, and yield of sunflower. A fully irrigated crop was sown on an alluvial-prairie soil (Fluventic Haplustoll) and was exposed to three distinct radiation environments. In two treatments, the level of incident radiation was reduced by 14 and 20% by suspending tao different types of polyethylene plastic films well above the crop. In addition to the reductions in incident radiation, the proportion of radiation that was diffuse was increased by about 14% in these treatments. Lower incident radiation and increased proportion of diffuse radiation had no effect on total biomass, phenology, leaf area, and the canopy light extinction coefficient (k = 0.89). However, yield was reduced in shaded treatments due to smaller grain size and lower harvest index. Although crop RUE measured over the entire crop cycle (1.25 g/MJ) did not differ significantly among treatments, there was a trend where RUE compensated for less intercepted incident radiation. Theoretical derivations of the response of RUE to different levels of incident radiation supported this finding. Shaded sunflower crops have the ability to produce biomass similar to unshaded crops by increasing RUE, but have lower harvest indices.