987 resultados para site investigation


Relevância:

20.00% 20.00%

Publicador:

Resumo:

Objective: To compare clinical evaluation, electrophysiological investigation and magnetic resonance findings in assessing the severity of idiopathic carpal tunnel syndrome. Patients and methods: Seventy-four patients with idiopathic carpal tunnel syndrome were prospectively recruited. Clinical evaluation included symptoms severity score and two-point discrimination, sensory and motor nerve conduction velocities were determined by electroneuromyography and imaging parameters were obtained after wrist magnetic resonance. The Wilcoxon test was used to define the differences between measurements of median nerve area. The Pearson and Spearman correlation tests were used to determine the relationships between all the measured parameters. Results: Cross-sectional area of median nerve was smaller at hamate level than at radio-ulnar joint and pisiform levels (p < 0.001). With exception of median nerve area at hamate level, there was a lower degree of correlation between MRI parameters and findings obtained by clinical assessments and electrophysiological measurements. The median nerve area at hamate level correlated negatively with duration of symptoms, two-point discrimination, symptoms severity score and positively with sensory nerve conduction velocity (P < 0.01). Conclusion: In patients with idiopathic carpal tunnel syndrome, median nerve area measured by wrist magnetic resonance at hamate level may be considered as a valuable indicator to grading the severity of disease. (c) 2007 Elsevier B.V. All rights reserved.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Previous studies have reported differences in presenting symptoms and angiographic characteristics between women and men undergoing evaluation for suspected coronary artery disease (CAD). We examined the relation between symptoms and extent of CAD in patients with type 2 diabetes mellitus and known CAD enrolled in the Bypass Angioplasty Revascularization Investigation 2 Diabetes (BARI 2D) trial. Of 1,775 patients (533 women, 30%, and 1,242 men, 70%), women were more likely than men to have angina (65% vs 56%, p < 0.001) or an atypical angina/anginal equivalent (71% vs 58%, p < 0.001). More women reported unstable angina (17% vs 13%, p = 0.047) or were in a higher Canadian Cardiology Society class compared to men (Canadian Cardiology Society classes II to IV 78% vs 68%, p = 0.002). Fewer women than men had no symptoms (14% vs 22%, p < 0.001). Women had a lower mean myocardial jeopardy index (42.5 +/- 24.3 vs 47.9 +/- 24.3, p < 0.001), smaller number of total significant lesions (2.3 +/- 17 1.7 vs 2.7 +/- 1.8, p < 0.001), and fewer jeopardized left ventricular regions (p < 0.001 for distribution) or long-term occlusions (29% vs 42%, p < 0.001). After adjustment for relevant covariates, the odds of having CAD symptoms were still higher in women than men (odds ratio for angina 1.31, 95% confidence interval 1.02 to 1.69; odds ratio for atypical angina 1.52, 95% confidence interval 1.17 to 1.96). In conclusion, in a high-risk group of patients with known CAD and diabetes mellitus, women were more symptomatic than men but had less obstructive CAD. These data suggest that factors other than epicardial CAD severity influence symptom presentation in women in this population. (C) 2011 Elsevier Inc. All rights reserved. (Am J Cardiol 2011;107:980-985)

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Objective: To correlate the type of dental occlusion and the type of pharyngeal lymphoid tissue obstruction in children. Design: Cross-sectional study. Setting: Ambulatory ear, nose, and throat clinic of Faculdade de Medicina da Universidade de Sao Paulo. Patients: One hundred fourteen children aged 3 to 12 years presenting with mouth breathing and snoring due to tonsil and/or adenoid enlargement. Interventions: Oroscopy and nasal fiber pharyngoscopy complemented by lateral head radiography to diagnose the type of obstruction, and clinical examination to evaluate the dental occlusion. Main Outcome Measures: Tonsil and adenoid obstruction (classified from grades 1-4) and sagittal, transverse, and vertical evaluation of dental occlusion. Results: Obstructive enlargement of both tonsils and adenoids was detected in 64.9% of the sample; isolated enlargement of the adenoids, in 21.9%; isolated enlargement of the palatine tonsils, in 7.0%; and nonobstructive tonsils and adenoids, in 6.1%. All types of pharyngeal obstruction were related to a high prevalence of posterior crossbite (36.8%). Statistically significant association was found between sagittal dental occlusion and the site of lymphoid tissue obstruction (P = .02). A higher rate of class II relationship (43.2%) was detected in the group with combined adenoid and tonsil obstructive enlargement. Isolated tonsil obstruction showed a higher rate of class III relationship (37.5%). Conclusions: Different sites of obstruction of the upper airway due to enlarged lymphoid tissue are associated with different types of dental malocclusion. Findings are relevant to orthodontic and surgical decision making in these mouth-breathing patients.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Fragile sites are nonstaining gaps in chromosomes induced by specific tissue culture conditions. They vary both in population frequency and in the culture conditions required for induction. Folate-sensitive fragile sites are due to expansion of p(CCG)(n) trinucleotide repeats; however, the relationship between sequence composition and the chemistry of induction of fragile sites is unclear. To clarify this relationship, the distamycin A-sensitive fragile site FRA16B was isolated by positional cloning and found to be an expanded 33 bp AT-rich minisatellite repeat, p(ATATATTATATATTATATCTAATAATATAT(C)/(A)TA)(n) (consistent with DNA sequence binding preferences of chemicals that induce its cytogenetic expression). Therefore the mutation mechanism associated with trinucleotide repeats is also a property of minisatellite repeats (variable number tandem repeats).

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Chloramphenicol acetyl transferase (CAT) protein and mRNA levels in E. coli were determined following induction of a tac::cat construct by isopropyl-beta-thiogalactopyranoside (IPTG). High cat mRNA levels did not directly reflect CAT protein levels, in either shakeflask experiments or fermentations. Furthermore, concentrations of IPTG resulting in the highest levels of expression of cat mRNA, were different to those resulting in highest levels of CAT protein. The data suggest that high transcriptional activities lead to limitations at the translational level.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

This study investigated the effect of two anti-pronation taping techniques on vertical navicular height, an indicator of foot pronation, after its application and 20 min of exercise. The taping techniques were: the low dye (LD) and low dye with the addition of calcaneal slings and reverse sixes (LDCR). A repeated measures study was used. It found that LDCR was superior to LD and control immediately after application and exercise. LD was better than control immediately after application but not after exercise. These findings provide practical directions to clinicians regularly using anti-pronation taping techniques.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

This paper summarises the major findings from the Quake Impact Study (QIS), a four-phase longitudinal project that was conducted in the aftermath of the 1989 Newcastle (Australia) earthquake. A total of 3,484 subjects participated in at least one component of the QIS, comprising a stratified sample of 3,007 drawn from community electoral rolls and 477 from specially targeted supplementary samples (the injured, the displaced, the owners of damaged businesses, and the helpers). Subjects' initial earthquake experiences were rated in terms of weighted indices of exposure to threat and disruption. Psychological morbidity was measured at each phase using the General Health Questionnaire (GHQ-12) and the Impact of Event Scale (IES). Selected findings and key conclusions are presented for each of six areas of investigation: service utilisation during the first 6 months post-disaster; patterns of earthquake experience and short-term (6-month) psychosocial outcome; earthquake exposure and medium term (2-year) psychosocial outcome; vulnerability factors and medium-term psychosocial outcome: specific community groups at increased risk (e.g., the elderly and immigrants from non-English-speaking backgrounds); the effects of stress debriefing for helpers. Threshold morbidity (i.e., likely caseness) rates are also presented for a broad range of subgroups. In addition to presenting an overview of the QIS, this paper synthesises the major findings and discusses their implications for future disaster management and research from a mental health perspective.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The polycondensation of squaric acid with 1,2-(9-Ethylcarbazol-3-yl)ethene and N-ethyliminostilbene in polyphosphoric acid yielded insoluble polymers which included substituted phosphate groups on the phenyl rings. The presence of phosphorus in these polymers was identified using solid-state P-31 NMR and EDAX techniques. Furthermore the phosphate groups were not ionic, hence no charge-balancing anions were present; Both polymers did not electrically conduct but exhibited dielectric breakdown values of 0.1 and 0.06 MV cm(-1) respectively.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Background-The Bypass Angioplasty Revascularization Investigation 2 Diabetes (BARI 2D) trial in 2368 patients with stable ischemic heart disease assigned before randomization to percutaneous coronary intervention or coronary artery bypass grafting strata reported similar 5-year all-cause mortality rates with insulin sensitization versus insulin provision therapy and with a strategy of prompt initial coronary revascularization and intensive medical therapy or intensive medical therapy alone with revascularization reserved for clinical indication(s). In this report, we examine the predefined secondary end points of cardiac death and myocardial infarction (MI). Methods and Results-Outcome data were analyzed by intention to treat; the Kaplan-Meier method was used to assess 5-year event rates. Nominal P values are presented. During an average 5.3-year follow-up, there were 316 deaths (43% were attributed to cardiac causes) and 279 first MI events. Five-year cardiac mortality did not differ between revascularization plus intensive medical therapy (5.9%) and intensive medical therapy alone groups (5.7%; P = 0.38) or between insulin sensitization (5.7%) and insulin provision therapy (6%; P = 0.76). In the coronary artery bypass grafting stratum (n = 763), MI events were significantly less frequent in revascularization plus intensive medical therapy versus intensive medical therapy alone groups (10.0% versus 17.6%; P = 0.003), and the composite end points of all-cause death or MI (21.1% versus 29.2%; P = 0.010) and cardiac death or MI (P = 0.03) were also less frequent. Reduction in MI (P = 0.001) and cardiac death/MI (P = 0.002) was significant only in the insulin sensitization group. Conclusions-In many patients with type 2 diabetes mellitus and stable ischemic coronary disease in whom angina symptoms are controlled, similar to those enrolled in the percutaneous coronary intervention stratum, intensive medical therapy alone should be the first-line strategy. In patients with more extensive coronary disease, similar to those enrolled in the coronary artery bypass grafting stratum, prompt coronary artery bypass grafting, in the absence of contraindications, intensive medical therapy, and an insulin sensitization strategy appears to be a preferred therapeutic strategy to reduce the incidence of MI. Clinical Trial Registration-URL: http://www.clinicaltrials.gov. Unique identifier: NCT00006305. (Circulation. 2009;120:2529-2540.)

Relevância:

20.00% 20.00%

Publicador:

Resumo:

DsbA is a protein-folding catalyst from the periplasm of Escherichia coli that interacts with newly translocated polypeptide substrate and catalyzes the formation of disulfide bonds in these secreted proteins. The precise nature of the interaction between DsbA and unfolded substrate is not known. Here, we give a detailed analysis of the DsbA crystal structure, now refined to 1.7 Angstrom, and present a proposal for its interaction with peptide. The crystal structure of DsbA implies flexibility between the thioredoxin and helical domains that may be an important feature for the disulfide transfer reaction. A hinge point for domain motion is identified-the typo IV beta-turn Phe 63-Met 64-Gly 65-Gly 66, which connects the two domains. Three unique features on the active site surface of the DsbA molecule-a groove, hydrophobic pocket, and hydrophobic patch-form an extensive uncharged surface surrounding the active-sits disulfide. Residues that contribute to these surface features are shown to be generally conserved in eight DsbA homologues. Furthermore, the residues immediately surrounding the active-site disulfide are uncharged in all nine DsbA proteins. A model for DsbA-peptide interaction has been derived from the structure of a human thioredoxin:peptide complex. This shows that peptide could interact with DsbA in a manner similar to that with thioredoxin. The active-site disulfide and all three surrounding uncharged surface features of DsbA could, in principle, participate in the binding or stabilization of peptide.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Purpose The purpose of this report was to demonstrate the normal complex insertional anatomy of the tibialis posterior tendon (TPT) in cadavers using magnetic resonance (MR) imaging with anatomic and histologic correlation. Material and methods Ten cadaveric ankles were used according to institutional guidelines. MR T1-weighted spin echo imaging was performed to demonstrate aspects of the complex anatomic distal insertions of the TPT in cadaveric specimens. Findings on MR imaging were correlated with those derived from anatomic and histologic study. Reults Generally, the TPT revealed a low signal in all MR images, except near the level of the medial malleolus, where the TPT suddenly changed direction and ""magic angle"" artifact could be observed. In five out of ten specimens (50%), a type I accessory navicular bone was found in the TPT. In all cases with a type I accessory navicular bone, the TPT had an altered signal in this area. Axial and coronal planes on MR imaging were the best in identifying the distal insertions of the TPT. A normal division of the TPT was observed just proximal to the insertion into the navicular bone in five specimens (100%) occurring at a maximum proximal distance from its attachment to the navicular bone of approximately 1.5 to 2 cm. In the other five specimens, in which a type I accessory navicular bone was present, the TPT directly inserted into the accessory bone and a slip less than 1.5 mm in thickness could be observed attaching to the medial aspect of the navicular bone (100%). Anatomic inspection confirmed the sites of the distal insertions of the components of the TPT. Conclusion MR imaging enabled detailed analysis of the complex distal insertions of the TPT as well as a better understanding of those features of its insertion that can simulate a lesion.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Background: Versutoxin (delta-ACTX-Hv1) is the major component of the venom of the Australian Blue Mountains funnel web spider, Hadronyche versuta. delta-ACTX-Hv1 produces potentially fatal neurotoxic symptoms in primates by slowing the inactivation of voltage-gated sodium channels; delta-ACTX-Hv1 is therefore a useful tool for studying sodium channel function. We have determined the three-dimensional structure of delta ACTX-Hv1 as the first step towards understanding the molecular basis of its interaction with these channels. Results: The solution structure of delta-ACTX-Hv1, determined using NMR spectroscopy, comprises a core beta region containing a triple-stranded antiparallel beta sheet, a thumb-like extension protruding from the beta region and a C-terminal 3(10) helix that is appended to the beta domain by virtue of a disulphide bond. The beta region contains a cystine knot motif similar to that seen in other neurotoxic polypeptides. The structure shows homology with mu-agatoxin-l, a spider toxin that also modifies the inactivation kinetics of vertebrate voltage-gated sodium channels. More surprisingly, delta-ACTX-Hv1 shows both sequence and structural homology with gurmarin, a plant polypeptide. This similarity leads us to suggest that the sweet-taste suppression elicited by gurmarin may result from an interaction with one of the downstream ion channels involved in sweet-taste transduction. Conclusions: delta-ACTX-Hv1 shows no structural homology with either sea anemone or alpha-scorpion toxins, both of which also modify the inactivation kinetics of voltage-gated sodium channels by interacting with channel recognition site 3. However, we have shown that delta-ACTX-Hv1 contains charged residues that are topologically related to those implicated in the binding of sea anemone and alpha-scorpion toxins to mammalian voltage-gated sodium channels, suggesting similarities in their mode of interaction with these channels.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

BACKGROUND: Restoration of nerve continuity and effective maintenance of coaptation are considered fundamental principles of end-to-end peripheral nerve repair. OBJECTIVE: To evaluate the influence of the number of stitches on axonal regeneration and collagen production after neurorrhaphy. METHODS: Thirty male Wistar rats were equally divided into 3 groups and were all operated on with the right sciatic nerve exposed. In 2 groups, the nerve was sectioned and repaired by means of 3 (group B) or 6 (group C) epineurium sutures with 100 monofilament nylon. One group (group A) was used as a control. Each animal from groups B and C underwent electrophysiological evaluation with motor action potential recordings before nerve section and again at an 8-week interval after neurorrhaphy. Nerve biopsy specimens were used for histomorphometric assessment of axonal regeneration and quantification of collagen at the repair site. RESULTS: Animals from group C had significantly lower motor action potential conduction velocities compared with control animals (P = .02), and no significant difference was seen between groups B and C. Parameters obtained from morphometric evaluation were not significantly different between these 2 groups. Type I collagen and III collagen in the epineurium were significantly higher in group C than in either the control group (P = .001 and P = .003) or group B (P = .01 and P = .02). No differences were identified for collagen I and III in the endoneurium. CONCLUSION: Using 6 sutures for nerve repair is associated with worse electrophysiological outcomes and higher amounts of type I and III collagen in the epineurium compared with control. Neurorraphy with 6 stitches is also related to a significant increase in epineurium collagen I and III compared with 3-stitch neurorraphy.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Femoral and acetabular loosening call be attributed different factors, but the Causes and mechanism of early failure are still obscure, The objective of this Study was to investigate the relationship between gene polymorphisms and early implant failure. Fifty-eight patients older than 50 years was recruited for analysis of MMP-1 promoter polymorphisms in early osseointegrated implant failure. The results showed in control group a frequency of 20.97% of 2G allele and 67.74% the genotype 1G/1G whereas, in the test group, a frequency of 83.33% of 2G allele and 66.66% the genotype 2G/2G. These results indicate that the polymorphism ill the promoter of the MMP-1 gene could be it risk factor for early implant failure of total hip arthroplasty.