The road leaflets of the Finnish Tourist Association

kuv., 12 x 20 cm

Landmarks on Finnishwomens road to Suffrage and Equal Citizenship

12 x 18 cm

Gelatin as an additive in bio-based barrier films

The main objective of the present study was to verify the approach on starch-gelatin blending for the paperboard coating formulations with enhanced barrier and mechanical properties. Based on that, another objective was to find out, how the approach will function with wood-based polysaccharides (CMC, EHEC and HPC) by analyzing their barrier properties and convertibility. The last objective was to find out, if pigments can be used in the composition of polysaccharide-protein blends without causing any negative effect on stated properties. The whole process chain of the barrier coating development was studied in the research. The methodology applied included pilot-scale coating and converting trials for the evaluation of mechanical properties of obtained coatings, namely their exposure to cracking with the loss of barrier properties. The results obtained indicated that the combination of starch with gelatin, in fact, improves the grease barrier properties and flexibility of starch-based coatings, thereby confirming the offered approach. The similar results were obtained for CMC, exhibited elevated barrier properties and surface coverage, proving that the approach also functions with wood-based polysaccharides. The introduction of equal amounts of talc gave various effects at different gelatin dosages on barrier properties of wood-based polysaccharides. Mainly, the elevation of grease barrier properties was observed. The convertibility of talc-filled coatings was not sufficient.

Fe y esperanza : women's road to leadership and ministry in the Lutheran church of El Salvador 1952-2009

The Lutheran Church of El Salvador made a decision, in 1986, to open the ministry to women. How was it possible in the midst of a Latin American macho culture and after having been influenced by the theologically conservative, North American mission work? This research examines the kinds of internal and external factors which led women to leadership and ministry, and the context in which this development occurred. The roles of women have been scrutinised during several time periods. During 1952-1974 the focus was on women as missionary wives and fundadoras (founding mothers). Women’s roles as laywomen grew in 1975-1985. After the outburst of the civil war in 1980, women advanced to lay leaders. The ministry was opened for women and the first deacon pastors were installed in 1986 and the first presbyter pastors were ordained in 1994. In 2009, more women than ever were working in different levels – from laywomen to leaders – in the Lutheran Church of El Salvador. The research shows that the reasons for the development and changes concerning women’s positions and roles lie in the impact of significant individuals, liberation theology, the feminist and women’s movement, civil war and the theology of life.

Possibility to add a barrier layer to a fibre tray package in the moulding stage

The main objective of the present study was to analyze the best approach on how to coat paperboard trays at the pressing stage. The coating gives the paperboard enhanced barrier and mechanical properties. The whole process chain of the barrier coating development was studied in the research. The methodology applied includes obtaining the optimum temperature at which good adhesion and bonding is formed between paperboard and skin film. Evaluation of mechanical properties after the coatings; such as cracking, curling and barrier properties was performed.

Dual light barrier method for six degrees of freedom tool center point calibration of an industrial robot

Tool center point calibration is a known problem in industrial robotics. The major focus of academic research is to enhance the accuracy and repeatability of next generation robots. However, operators of currently available robots are working within the limits of the robot´s repeatability and require calibration methods suitable for these basic applications. This study was conducted in association with Stresstech Oy, which provides solutions for manufacturing quality control. Their sensor, based on the Barkhausen noise effect, requires accurate positioning. The accuracy requirement admits a tool center point calibration problem if measurements are executed with an industrial robot. Multiple possibilities are available in the market for automatic tool center point calibration. Manufacturers provide customized calibrators to most robot types and tools. With the handmade sensors and multiple robot types that Stresstech uses, this would require great deal of labor. This thesis introduces a calibration method that is suitable for all robots which have two digital input ports free. It functions with the traditional method of using a light barrier to detect the tool in the robot coordinate system. However, this method utilizes two parallel light barriers to simultaneously measure and detect the center axis of the tool. Rotations about two axes are defined with the center axis. The last rotation about the Z-axis is calculated for tools that have different width of X- and Y-axes. The results indicate that this method is suitable for calibrating the geometric tool center point of a Barkhausen noise sensor. In the repeatability tests, a standard deviation inside robot repeatability was acquired. The Barkhausen noise signal was also evaluated after recalibration and the results indicate correct calibration. However, future studies should be conducted using a more accurate manipulator, since the method employs the robot itself as a measuring device.

Inflammatory response of the spinal cord to multiple episodes of blood-brain barrier disruption and toxic demyelination in Wistar rats

Multiple episodes of blood-brain barrier disruption were induced by sequential intraspinal injections of ethidium bromide. In addition to the barrier disruption, there was toxic demyelination and exposure of myelin components to the immune system. Twenty-seven 3-month-old Wistar rats received 2, 3 or 4 injections of 1 µl of either 0.1% ethidium bromide in normal saline (19 rats) or 0.9% saline (8 rats) at different levels of the spinal cord. The time intervals between the injections ranged from 28 to 42 days. Ten days after the last injection, all rats were perfused with 2.5% glutaraldehyde. The spinal sections were evaluated macroscopically and by light and transmission electron microscopy. All the lesions demonstrated a mononuclear phagocytic infiltrate apparently removing myelin. Lymphocytes were not conspicuous and were found in only 34% of the lesions. No perivascular cuffings were detected. In older lesions (38 days and older) they were found only within Virchow-Robin spaces. This result suggests that multiple blood-brain barrier disruptions with demyelination and exposure of myelin components to the immune system were not sufficient to induce an immune-mediated reaction in the central nervous system.

Potential for Greenhouse Gas Emission Reductions by Using Biomethane as a Road Transportation Fuel

The aim of this thesis is to study whether the use of biomethane as a transportation fuel is reasonable from climate change perspective. In order to identify potentials and challenges for the reduction of greenhouse gas (GHG) emissions, this dissertation focuses on GHG emission comparisons, on feasibility studies and on the effects of various calculation methodologies. The GHG emissions calculations are carried out by using life cycle assessment (LCA) methodologies. The aim of these LCA studies is to figure out the key parameters affecting the GHG emission saving potential of biomethane production and use and to give recommendations related to methodological choices. The feasibility studies are also carried out from the life cycle perspective by dividing the biomethane production chain for various operators along the life cycle of biomethane in order to recognize economic bottlenecks. Biomethane use in the transportation sector leads to GHG emission reductions compared to fossil transportation fuels in most cases. In addition, electricity and heat production from landfill gas, biogas or biomethane leads to GHG reductions as well. Electricity production for electric vehicles is also a potential route to direct biogas or biomethane energy to transportation sector. However, various factors along the life cycle of biomethane affect the GHG reduction potentials. Furthermore, the methodological selections have significant effects on the results. From economic perspective, there are factors related to different operators along the life cycle of biomethane, which are not encouraging biomethane use in the transportation sector. To minimize the greenhouse gas emissions from the life cycle of biomethane, waste feedstock should be preferred. In addition, energy consumption, methane leakages, digestate utilization and the current use of feedstock or biogas are also key factors. To increase the use of biomethane in the transportation sector, political steering is needed to improve the feasibility for the operators. From methodological perspective, it is important to recognize the aim of the life cycle assessment study. The life cycle assessment studies can be divided into two categories: 1.) To produce average GHG information of biomethane to evaluate the acceptability of biomethane use compared to fossil transportation fuels. 2.) To produce GHG information of biomethane related to actual decision-making situations. This helps to figure out the actual GHG emission changes in cases when feedstock, biogas or biomethane are already in other use. For example directing biogas from electricity production to transportation use does not necessarily lead to additional GHG emission reductions. The use of biomethane seems to have a lot of potential for the reduction of greenhouse gas emissions as a transportation fuel. However, there are various aspects related to production processes, to the current use of feedstock or biogas and to the feasibility that have to be taken into account.

Novel virtual environment and real-time simulation based methods for improving life-cycle efficiency of non-road mobile machinery

Virtual environments and real-time simulators (VERS) are becoming more and more important tools in research and development (R&D) process of non-road mobile machinery (NRMM). The virtual prototyping techniques enable faster and more cost-efficient development of machines compared to use of real life prototypes. High energy efficiency has become an important topic in the world of NRMM because of environmental and economic demands. The objective of this thesis is to develop VERS based methods for research and development of NRMM. A process using VERS for assessing effects of human operators on the life-cycle efficiency of NRMM was developed. Human in the loop simulations are ran using an underground mining loader to study the developed process. The simulations were ran in the virtual environment of the Laboratory of Intelligent Machines of Lappeenranta University of Technology. A physically adequate real-time simulation model of NRMM was shown to be reliable and cost effective in testing of hardware components by the means of hardware-in-the-loop (HIL) simulations. A control interface connecting integrated electro-hydraulic energy converter (IEHEC) with virtual simulation model of log crane was developed. IEHEC consists of a hydraulic pump-motor and an integrated electrical permanent magnet synchronous motorgenerator. The results show that state of the art real-time NRMM simulators are capable to solve factors related to energy consumption and productivity of the NRMM. A significant variation between the test drivers is found. The results show that VERS can be used for assessing human effects on the life-cycle efficiency of NRMM. HIL simulation responses compared to that achieved with conventional simulation method demonstrate the advances and drawbacks of various possible interfaces between the simulator and hardware part of the system under study. Novel ideas for arranging the interface are successfully tested and compared with the more traditional one. The proposed process for assessing the effects of operators on the life-cycle efficiency will be applied for wider group of operators in the future. Driving styles of the operators can be analysed statistically from sufficient large result data. The statistical analysis can find the most life-cycle efficient driving style for the specific environment and machinery. The proposed control interface for HIL simulation need to be further studied. The robustness and the adaptation of the interface in different situations must be verified. The future work will also include studying the suitability of the IEHEC for different working machines using the proposed HIL simulation method.

Ideologiakriittinen näkökulma road-elokuvaan

Kirjallisuusarvostelu

Effect of high hydrostatic pressure on the barrier properties of polyamide-6 films

Little is known about the barrier properties of polymer films during high pressure processing of prepackaged foods. In order to learn more about this, we examined the influence of high hydrostatic pressure on the permeation of raspberry ketone (dissolved in ethanol/water) through polyamide-6 films at temperatures between 20 and 60ºC. Permeation was lowered by increasing pressure at all temperatures. At 23°C, the increasing pressure sequence 0.1, 50, 100, 150, and 200 MPa correlated with the decreasing permeation coefficients P/(10(9) cm² s-1) of 6.2, 3.8, 3.0, 2.2, and 1.6. Analysis of the permeation kinetics indicated that this effect was due to a reduced diffusion coefficient. Pressure and temperature acted antagonistically to each other. The decrease in permeation at 200 MPa was compensated for by a temperature increase of 20ºC. After release of pressure, the former permeation coefficients were recovered, which suggests that this `pressure effect' is reversible. Taken together, our data revealed no detrimental effects of high hydrostatic pressure on the barrier properties of polymer films.

Beneficial effect of recombinant human growth hormone on the intestinal mucosa barrier of septic rats

The objective of the present study was to investigate the effects of recombinant human growth hormone (rhGH) on the intestinal mucosa barrier of septic rats and explore its possible mechanism. Female Sprague-Dawley rats were randomized into three groups: control, Escherichia coli-induced sepsis (S) and treatment (T) groups. Groups S and T were subdivided into subgroups 1d and 3d, respectively. Expression of liver insulin-like growth factor-1 (IGF-1) mRNA, Bcl-2 and Bax protein levels and the intestinal Bax/Bcl-2 ratio, and plasma GH and IGF-1 levels were determined. Histological examination of the intestine was performed and bacterial translocation was determined. rhGH significantly attenuated intestinal mucosal injuries and bacterial translocation in septic rats, markedly decreased Bax protein levels, inhibited the decrease of Bcl-2 protein expression and maintained the Bax/Bcl-2 ratio in the intestine. rhGH given after sepsis significantly improved levels of plasma GH (T1d: 1.28 ± 0.24; T3d: 2.14 ± 0.48 µg/L vs S1d: 0.74 ± 0.12; S3d: 0.60 ± 0.18 µg/L; P < 0.05) and IGF-1 (T1d: 168.94 ± 65.67; T3d: 201.56 ± 64.98 µg/L vs S1d: 116.72 ± 13.96; S3d: 107.50 ± 23.53 µg/L; P < 0.05) and expression of liver IGF-1 mRNA (T1d: 0.98 ± 0.20; T3d: 1.76 ± 0.17 vs S1d: 0.38 ± 0.09; S3d: 0.46 ± 0.10; P < 0.05). These findings indicate that treatment with rhGH had beneficial effects on the maintenance of the integrity of the intestinal mucosa barrier in septic rats.

Tumor necrosis factor alpha increases epithelial barrier permeability by disrupting tight junctions in Caco-2 cells

The objectives of this study were to determine the effect of tumor necrosis factor alpha (TNF-α) on intestinal epithelial cell permeability and the expression of tight junction proteins. Caco-2 cells were plated onto Transwell® microporous filters and treated with TNF-α (10 or 100 ng/mL) for 0, 4, 8, 16, or 24 h. The transepithelial electrical resistance and the mucosal-to-serosal flux rates of the established paracellular marker Lucifer yellow were measured in filter-grown monolayers of Caco-2 intestinal cells. The localization and expression of the tight junction protein occludin were detected by immunofluorescence and Western blot analysis, respectively. SYBR-Green-based real-time PCR was used to measure the expression of occludin mRNA. TNF-α treatment produced concentration- and time-dependent decreases in Caco-2 transepithelial resistance and increases in transepithelial permeability to the paracellular marker Lucifer yellow. Western blot results indicated that TNF-α decreased the expression of phosphorylated occludin in detergent-insoluble fractions but did not affect the expression of non-phosphorylated occludin protein. Real-time RT-PCR data showed that TNF-α did not affect the expression of occludin mRNA. Taken together, our data demonstrate that TNF-α increases Caco-2 monolayer permeability, decreases occludin protein expression and disturbs intercellular junctions.

Filaggrin silencing by shRNA directly impairs the skin barrier function of normal human epidermal keratinocytes and then induces an immune response

The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.