The transcriptional regulation of the {\it neu\/} gene: Examples of activation, repression, and cell-specific expression

The neu oncogene encodes a growth factor receptor-like protein, p185, with an intrinsic tyrosine kinase activity. A single point mutation, an A to T transversion resulting in an amino acid substitution from valine to glutamic acid, in the transmembrane domain of the rat neu gene was found to be responsible for the transforming and tumorigenic phenotype of the cells that carry it. In contrast, the human proto-neu oncogene is frequently amplified in tumors and cell lines derived from tumors and the human neu gene overexpression/amplification in breast and ovarian cancers is known to correlate with poor patient prognosis. Examples of the human neu gene overexpression in the absence of gene amplification have been observed, which may suggest the significant role of the transcriptional and/or post-transcriptional control of the neu gene in the oncogenic process. However, little is known about the transcriptional mechanisms which regulate the neu gene expression. In this study, three examples are presented to demonstrate the positive and negative control of the neu gene expression.^ First, by using band shift assays and methylation interference analyses, I have identified a specific protein-binding sequence, AAGATAAAACC ($-$466 to $-$456), that binds a specific trans-acting factor termed RVF (for EcoRV factor on the neu promoter). The RVF-binding site is required for maximum transcriptional activity of the rat neu promoter. This same sequence is also found in the corresponding regions of both human and mouse neu promoters. Furthermore, this sequence can enhance the CAT activity driven by a minimum promoter of the thymidine kinase gene in an orientation-independent manner, and thus it behaves as an enhancer. In addition, Southwestern (DNA-protein) blot analysis using the RVF-binding site as a probe points to a 60-kDa polypeptide as a potential candidate for RVF.^ Second, it has been reported that the E3 region of adenovirus 5 induces down-regulation of epidermal growth factor (EGF) receptor through endocytosis. I found that the human neu gene product, p185, (an EGF receptor-related protein) is also down-regulated by adenovirus 5, but via a different mechanism. I demonstrate that the adenovirus E1a gene is responsible for the repression of the human neu gene at the transcriptional level.^ Third, a differential expression of the neu gene has been found in two cell model systems: between the mouse fibroblast Swiss-Webster 3T3 (SW3T3) and its variant NR-6 cells; and between the mouse liver tumor cell line, Hep1-a, and the mouse pancreas tumor cell line, 266-6. Both NR-6 and 266-6 cell lines are not able to express the neu gene product, p185. I demonstrate that, in both cases, the transcriptional repression of the neu gene may account for the lack of the p185 expression in these two cell lines. ^

Comparison of health behaviors of Mexican American and non -Hispanic White females: Implications for health promotion programs

Hispanics form the second-largest minority group in the United States totaling 22 million people. Health data on this population are sparse and inconsistent. This study seeks to determine use of preventative services and risk factor behaviors of Mexican American and non-Hispanic White females residing in South Texas.^ Baseline data from female respondents in household surveys in six South Texas counties (Ramirez and McAlister, 1988; McAlister et al., 1992) were analyzed to test the following hypotheses: (1) Mexican American and Non-Hispanic White females exhibit different patterns of health behaviors; (2) Mexican American females will exhibit different health behaviors regardless of age; and (3) the differences between Mexican American women and non-Hispanic White females are due to education and acculturation factors.^ Over the past decade, the traditional behaviors of Mexican American females have begun to change due to education, acculturation, and their participation in the labor force. The results from this study identify some of the changes that will require immediate attention from health care providers. Results revealed that regardless of ethnicity, age, education, and language preference, non-Hispanic White females were significantly more likely to participate in preventive screening practices than were Mexican American females. Risk factor analysis revealed a different pattern with Mexican American females significantly more likely to be non-smokers, non-alcoholic drinkers, and to have good fat avoidance practices compared to non-Hispanic White females. However, compared to those who are less-educated or Spanish-speaking, Mexican American females with higher levels of education and preference for speaking English only showed positive and negative health behaviors that were more similar to the non-Hispanic White females. The positive health behaviors that come with acculturation, e.g., more participation in preventive care and more physical activity, are welcome changes. But this study has implications for global health development and reinforces a need for "primordial" prevention strategies to deter the unwanted concomitants of economic development and acculturation. Smoking and drinking behaviors among Mexican American females need to be kept at low levels to prevent increased morbidity and premature deaths in this population. ^

Characterization of an upstream negative regulatory region of the mouse {\it neu\/} promoter

Cloning and characterization of the mouse neu gene revealed the presence of positive and negative cis-acting regulatory elements in the mouse neu promoter. An upstream region located between the SmaI and SphI sites of the promoter appeared to contribute significantly to negative regulation of the mouse neu gene, since deletion of this region led to a marked increase in transcriptional activity. To further characterize the mouse neu promoter I conducted a more exhaustive study on this cis-acting region which had not previously been studied in either human or rat neu promoters.^ The SmaI-SphI region was paced in front of the minimal thymidine kinase promoter where it inhibited transcription in both NIH3T3 and Hela cells. Physical association of nuclear proteins with this region was confirmed by electro-mobility shift assays. Four specific protein-DNA complexes were detected which involved interaction of proteins with various portions of the SmaI-SphI region. The most dominant protein complexes could be competed by SmaI-NruI and PstI-SphI subregions. Subsequent gel-shifts using SmaI-NruI and PstI-SphI as probes further confirmed the requirement of these two regions for the formation of the three fastest migrating complexes. Methylation interference and DNase I footprinting analyses were performed to determine the specific DNA sequences required for protein interaction. The two sequences identified were a 28 bp sequence, GAGCTTTCTTGGCTTAGTTCCAGACTCA, from the SmaI-NruI region (SN element) and a 23 bp sequence, AGGGACACCTTTGATCTGACCTTTA, from the PstI-SphI fragment (PS element). The PS and SN elements identified by footprinting were used as probes in gel-shift assays. Both oligonucleotides were capable of forming specific complexes with nuclear proteins. Sequence analysis of the SmaI-SphI region indicated that another sequence similar to PS element was located 330 bp upstream of the PS element. The identified SN and PS elements were subcloned into pMNSphICAT and transfected into NIH3T3 cells. Measurement of CAT activity indicated that both elements were sufficient to inhibit transcription from the mouse neu promoter. Both elements appeared to mediate binding in all cell types examined. Thus, I have identified two silencer elements from an upstream region of the mouse neu promoter which appear to regulate transcription in various cell lines. ^

Subjective well -being as predictor of mortality, heart disease, and obesity: Prospective evidence from the Alameda County Study

Based on the World Health Organization's (1965) definition of health, understanding of health requires understanding of positive psychological states. Subjective Well-being (SWB) is a major indicator of positive psychological states. Up to date, most studies of SWB have been focused on its distributions and determinants. However, study of its consequences, especially health consequences, is lacking. This dissertation research examined Subjective Well-being, as operationally defined by constructs drawn from the framework of Positive Psychology, and its sub-scores (Positive Feelings and Negative Feelings) as predictors of three major health outcomes—mortality, heart disease, and obesity. The research used prospective data from the Alameda County Study over 29 years (1965–1994), based on a stratified, randomized, representative sample of the general public in Alameda County, California (Baseline N = 6928). ^ Multivariate analyses (Survival analyses using sequential Cox Proportional Hazard models in the cases of mortality and heart disease, and sequential Logistic Regression analyses in the case of obesity) were performed as the main methods to evaluate the associations of the predictors and the health outcomes. The results revealed that SWB reduced risks of all-cause mortality, natural-cause mortality, and cardiovascular mortality. Positive feelings not only had an even stronger protective effect against all-cause, natural-cause and cardiovascular mortality, but also predicted decreased unnatural-cause mortality which includes deaths from suicide, homicide, accidents, mental disorders, drug dependency, as well as alcohol-related liver diseases. These effects were significant even after adjusted for age, gender, education, and various physical health measures, and, in the case of cardiovascular mortality, obesity and health practices (alcohol consumption, smoking, and physical activities). However, these two positive psychological indicators, SWB and positive feelings, did not predict obesity. And negative feelings had no significant effect on any of the health outcomes evaluated, i.e., all-cause mortality, natural- and unnatural-cause mortality, cardiovascular mortality, or obesity, after covariates were controlled. These findings were discussed (1) in comparison with relevant existing studies, (2) in terms of their implications in health research and promotion, (3) in terms of the independence of positive and negative feelings, and (4) from a Positive Psychology perspective and its significance in Public Health research and practice. ^

Element contents and isotope composition of sediments and basalts from DSDP Site 78-543

Twenty-four piston core sediment samples and 13 sediments and 3 basalts from DSDP Leg 78 Site 543 were analyzed for Sr, Nd and Pb isotopic compositions. The results show sediment with highly radiogenic Pb (206Pb/204Pb up to 19.8) and rather radiogenic Sr and unradiogenic Nd has been deposited in the region since the Cretaceous. The source of this sediment is probably the Archean Guiana Highland, which is drained by the Orinoco River. Pb and Sr isotopic compositions and sediment thickness decrease and 143Nd/144Nd increases northward due to a decrease in turbiditic component. This decrease is partly due to the damming action of basement ridges. Rare earth concentrations in the sediments are somewhat low, due to the abundance of detrital and biogenic components in the sediment and rapid sedimentation rates. Both positive and negative Ce anomalies occur in the surface sediments, but only positive Ce anomalies occur in the Site 543 sediments. It is unlikely that sediment subducted to the source region of Lesser Antilles arc magmas could be the cause of negative Ce anomalies in those magmas. Isotopic compositions of Site 543 basalts show some effect of contamination by seawater-basalt reaction products and sediments. Beyond this, however, they are typical of "normal" depleted MORB.

Automated Tools for Layer Recognition (BMPix) and Counting (PEAK)

We present tools for rapid and quantitative detection of sediment lamination. The BMPix tool extracts color and gray-scale curves from images at pixel resolution. The PEAK tool uses the gray-scale curve and performs, for the first time, fully automated counting of laminae based on three methods. The maximum count algorithm counts every bright peak of a couplet of two laminae (annual resolution) in a smoothed curve. The zero-crossing algorithm counts every positive and negative halfway-passage of the curve through a wide moving average, separating the record into bright and dark intervals (seasonal resolution). The same is true for the frequency truncation method, which uses Fourier transformation to decompose the curve into its frequency components before counting positive and negative passages. We applied the new methods successfully to tree rings, to well-dated and already manually counted marine varves from Saanich Inlet, and to marine laminae from the Antarctic continental margin. In combination with AMS14C dating, we found convincing evidence that laminations in Weddell Sea sites represent varves, deposited continuously over several millennia during the last glacial maximum. The new tools offer several advantages over previous methods. The counting procedures are based on a moving average generated from gray-scale curves instead of manual counting. Hence, results are highly objective and rely on reproducible mathematical criteria. Also, the PEAK tool measures the thickness of each year or season. Since all information required is displayed graphically, interactive optimization of the counting algorithms can be achieved quickly and conveniently.

COSIMA calibration for the detection and characterization of the cometary solid organic matter

On the orbiter of the Rosetta spacecraft, the Cometary Secondary Ion Mass Analyser (COSIMA) will provide new in situ insights about the chemical composition of cometary grains all along 67P/Churyumov–Gerasimenko (67P/CG) journey until the end of December 2015 nominally. The aim of this paper is to present the pre-calibration which has already been performed as well as the different methods which have been developed in order to facilitate the interpretation of the COSIMA mass spectra and more especially of their organic content. The first step was to establish a mass spectra library in positive and negative ion mode of targeted molecules and to determine the specific features of each compound and chemical family analyzed. As the exact nature of the refractory cometary organic matter is nowadays unknown, this library is obviously not exhaustive. Therefore this library has also been the starting point for the research of indicators, which enable to highlight the presence of compounds containing specific atom or structure. These indicators correspond to the intensity ratio of specific peaks in the mass spectrum. They have allowed us to identify sample containing nitrogen atom, aliphatic chains or those containing polyaromatic hydrocarbons. From these indicators, a preliminary calibration line, from which the N/C ratio could be derived, has also been established. The research of specific mass difference could also be helpful to identify peaks related to quasi-molecular ions in an unknown mass spectrum. The Bayesian Positive Source Separation (BPSS) technique will also be very helpful for data analysis. This work is the starting point for the analysis of the cometary refractory organic matter. Nevertheless, calibration work will continue in order to reach the best possible interpretation of the COSIMA observations.

Colimitation of the unicellular photosynthetic diazotroph Crocosphaera watsonii by phosphorus, light, and carbon dioxide

We describe interactive effects of total phosphorus (total P = 0.1-4.0 µmol/L; added as H2NaPO4), irradiance (40 and 150 µmol quanta/m**2/s), and the partial pressure of carbon dioxide (P-CO2; 19 and 81 Pa, i.e., 190 and 800 ppm) on growth and CO2- and dinitrogen (N-2)-fixation rates of the unicellular N-2-fixing cyanobacterium Crocosphaera watsonii (WH0003) isolated from the Pacific Ocean near Hawaii. In semicontinuous cultures of C. watsonii, elevated P-CO2 positively affected growth and CO2- and N-2-fixation rates under high light. Under low light, elevated P-CO2 positively affected growth rates at all concentrations of P, but CO2- and N-2-fixation rates were affected by elevated P-CO2 only when P was low. In both high-light and low-light cultures, the total P requirements for growth and CO2- and N-2-fixation declined as P-CO2 increased. The minimum concentration (C-min) of total P and half-saturation constant (K-1/2) for growth and CO2- and N-2-fixation rates with respect to total P were reduced by 0.05 µmol/L as a function of elevated P-CO2. We speculate that low P requirements under high P-CO2 resulted from a lower energy demand associated with carbon-concentrating mechanisms in comparison with low-P-CO2 cultures. There was also a 0.10 µmol/L increase in C-min and K-1/2 for growth and N-2 fixation with respect to total P as a function of increasing light regardless of P-CO2 concentration. We speculate that cellular P concentrations are responsible for this shift through biodilution of cellular P and possibly cellular P uptake systems as a function of increasing light. Changing concentrations of P, CO2, and light have both positive and negative interactive effects on growth and CO2-, and N-2-fixation rates of unicellular oxygenic diazotrophs like C. watsonii.

Juvenile–adult tree associations in a continental Mediterranean ecosystem: no evidence for sustained and general facilitation at increased aridity

Question: How do tree species identity, microhabitat and water availability affect inter- and intra-specific interactions between juvenile and adult woody plants? Location: Continental Mediterranean forests in Alto Tajo Natural Park, Guadalajara, Spain. Methods: A total of 2066 juveniles and adults of four co-occurring tree species were mapped in 17 plots. The frequency of juveniles at different microhabitats and water availability levels was analysed using log-linear models. We used nearest-neighbour contingency table analysis of spatial segregation and J-functions to describe the spatial patterns. Results: We found a complex spatial pattern that varied according to species identity and microhabitat. Recruitment was more frequent in gaps for Quercus ilex, while the other three species recruited preferentially under shrubs or trees depending on the water availability level. Juveniles were not spatially associated to conspecific adults, experiencing segregation from them inmany cases. Spatial associations, both positive and negative, were more common at higher water availability levels. Conclusions: Our results do not agree with expectations from the stressgradient hypothesis, suggesting that positive interactions do not increase in importance with increasing aridity in the study ecosystem. Regeneration patterns are species-specific and depend on microhabitat characteristics and dispersal strategies. In general, juveniles do not look for conspecific adult protection. This work contributes to the understanding of species co-existence, proving the importance of considering a multispecies approach at several plots to overcome limitations of simple pair-wise comparisons in a limited number of sites.

Seismic modelling and ava analysis of hidrocarbon traps

In this study, forward seismic modelling of four geological models with Hydrocarbon (HC) traps were performed by ray tracing method to produce synthetic seismogram of each model. The idea is to identify the Hydrocarbon Indicators (HCI‟s) such as bright spot, flat spot, dim spot and Bottom Simulating Reflector (BSR) in the synthethic seismogram. The modelling was performed in DISCO/FOCUS 5.0 seismic data processing programme. Strong positive and negative reflection amplitudes and some artifact reflection horizons were observed on produced seismograms due to rapid changes in subsurface velocity and geometry respectively Additionally, Amplitude-versus-angle (AVA) curves of each HCIs was calculated by the Crewes Zoeppritz Explorer programme. AVA curves show that how the reflection coefficients change with the density and the P and S wave velocities of each layer such as oil, gas, gas hydrate or water saturated sediments. Due to AVA curves, an increase in reflection amplitude with incident angle of seismic waves corresponds to an indicator of a hydrocarbon reservoir

Use and abuse of audivisual media in the college classroom. Slides show and web pages

The multimedia development that has taken place within the university classrooms in recent years has caused a revolution at psychological level within the collectivity of students and teachers inside and outside the classrooms. The slide show applications have become a key supporting element for university professors, who, in many cases, rely blindly in the use of them for teaching. Additionally, ill-conceived slides, poorly structured and with a vast amount of multimedia content, can be the basis of a faulty communication between teacher and student, which is overwhelmed by the appearance and presentation, neglecting their content. The same applies to web pages. This paper focuses on the study and analysis of the impact caused in the process of teaching and learning by the slide show presentations and web pages, and its positive and negative influence on the student’s learning process, paying particular attention to the consequences on the level of attention within the classroom, and on the study outside the classroom. The study is performed by means of a qualitative analysis of student surveys conducted during the last 8 school Civil Engineering School at the Polytechnic University of Madrid. It presents some of the weaknesses of multimedia material, including the difficulties for students to study them, because of the many distractions they face and the need for incentives web pages offer, or the insignificant content and shallowness of the studies due to wrongly formulated presentations.

Fracture strength of drilled wafers: study of the stress concentration factor and determination of the weibull distribution of the fracture stress

In the photovoltaic field, the back contact solar cells technology has appeared as an alternative to the traditional silicon modules. This new type of cells places both positive and negative contacts on the back side of the cells maximizing the exposed surface to the light and making easier the interconnection of the cells in the module. The Emitter Wrap-Through solar cell structure presents thousands of tiny holes to wrap the emitter from the front surface to the rear surface. These holes are made in a first step over the silicon wafers by means of a laser drilling process. This step is quite harmful from a mechanical point of view since holes act as stress concentrators leading to a reduction in the strength of these wafers. This paper presents the results of the strength characterization of drilled wafers. The study is carried out testing the samples with the ring on ring device. Finite Element models are developed to simulate the tests. The stress concentration factor of the drilled wafers under this load conditions is determined from the FE analysis. Moreover, the material strength is characterized fitting the fracture stress of the samples to a three-parameter Weibull cumulative distribution function. The parameters obtained are compared with the ones obtained in the analysis of a set of samples without holes to validate the method employed for the study of the strength of silicon drilled wafers.

Justice, emotions and satisfaction in complaint behavior in services

This study proposes a marketing approach to service recovery (SR) models in order to help to explain what factors affect cumulative satisfaction, loyalty and word-of-mouth following complaint behavior. The model has its base on the definition of perceived justice and its influence on satisfaction with service recovery (SSR) and on emotions (positive and negative). Trust acts as a central construct in the model, receiving influence from the affective and cognitive aspect and mediating the relationship between SSR and cumulative satisfaction and between positive/negative emotions and loyalty. The sample for this study consists of 303 Spanish B2C-EC users who made a complaint after an electronic transaction. Results from the analysis show the influence of perceived justice ?mainly interactional justice and procedural justice? on SSR, and the relevance of positive emotions as a key factor in SSR processes, in contrast to the major role which negative emotions have traditionally played in these models. Furthermore, trust mediates the relation between SSR and cumulative satisfaction, and is the factor which has a higher influence on loyalty, whilst cumulative satisfaction becomes the more relevant factor affecting WOM.

Justice and emotions in service recovery: a complaint in B2C e-commerce

This study proposes a marketing approach to service recovery (SR) models to explain what factors affect cumulative satisfaction, loyalty and word-of-mouth (WOM) following complaint behaviour. The model has its base on the definition of perceived justice and its influence on satisfaction with service recovery (SSR) and on emotions (positive and negative). Trust acts as a central construct in the model, receiving influence from the affective and cognitive aspect. The sample for this study consists of 303 Spanish business-to-consumer e-commerce (B2C-EC) users who made a complaint after an electronic transaction. Results from the analysis show the influence of perceived justice ? mainly interactional justice and procedural justice ? on SSR and the relevance of positive emotions as a key factor in SSR processes, in contrast to the major role that negative emotions have traditionally played in these models.

CD19 and CD22 expression reciprocally regulates tyrosine phosphorylation of Vav protein during B lymphocyte signaling

B cell development and humoral immune responses are controlled by signaling thresholds established through the B lymphocyte antigen receptor (BCR) complex. BCR signaling thresholds are differentially regulated by the CD22 and CD19 cell surface receptors in vivo. B cells from CD22-deficient mice exhibit characteristics of chronic stimulation and are hyper-responsive to BCR crosslinking with augmented intracellular Ca2+ responses. By contrast, B cells from CD19-deficient mice are hypo-responsive to transmembrane signals. To identify signaling molecules involved in the positive and negative regulation of signaling thresholds, the signal transduction pathways activated after BCR crosslinking were examined in CD22- and CD19-deficient B cells. These comparisons revealed that tyrosine phosphorylation of Vav protein was uniquely augmented after BCR or CD19 crosslinking in CD22-deficient B cells, yet was modest and transient after BCR crosslinking in CD19-deficient B cells. Ligation of CD19 and CD22 in vivo is likely to positively and negatively regulate BCR signaling, respectively, because CD19 crosslinking was more efficient than BCR crosslinking at inducing Vav phosphorylation. However, simultaneous crosslinking of CD19 with the BCR resulted in a substantial decrease in Vav phosphorylation when CD22 was expressed. Thus, the differential regulation of Vav tyrosine phosphorylation by CD19 and CD22 may provide a molecular mechanism for adjusting BCR signaling thresholds.