Immunopathology of allergic contact dermatitis

Allergic contact dermatitis is the consequence of an immune reaction mediated by T cells against low molecular weight chemicals known as haptens. It is a common condition that occurs in all races and age groups and affects the quality of life of those who present it. The immunological mechanism of this disease has been reviewed in recent decades with significant advance in its understanding. The metabolism and pathway of the haptens as well as the activation and mechanism of action of the cells responsible for both the immune reaction and its completion are discussed in this article.

Three-dimensional model for multi-component reactive transport with variable density groundwater flow

PHWAT is a new model that couples a geochemical reaction model (PHREEQC-2) with a density-dependent groundwater flow and solute transport model (SEAWAT) using the split-operator approach. PHWAT was developed to simulate multi-component reactive transport in variable density groundwater flow. Fluid density in PHWAT depends not on only the concentration of a single species as in SEAWAT, but also the concentrations of other dissolved chemicals that can be subject to reactive processes. Simulation results of PHWAT and PHREEQC-2 were compared in their predictions of effluent concentration from a column experiment. Both models produced identical results, showing that PHWAT has correctly coupled the sub-packages. PHWAT was then applied to the simulation of a tank experiment in which seawater intrusion was accompanied by cation exchange. The density dependence of the intrusion and the snow-plough effect in the breakthrough curves were reflected in the model simulations, which were in good agreement with the measured breakthrough data. Comparison simulations that, in turn, excluded density effects and reactions allowed us to quantify the marked effect of ignoring these processes. Next, we explored numerical issues involved in the practical application of PHWAT using the example of a dense plume flowing into a tank containing fresh water. It was shown that PHWAT could model physically unstable flow and that numerical instabilities were suppressed. Physical instability developed in the model in accordance with the increase of the modified Rayleigh number for density-dependent flow, in agreement with previous research. (c) 2004 Elsevier Ltd. All rights reserved.

Human chromosomal fragile site FRA16B is an amplified AT-rich minisatellite repeat

Fragile sites are nonstaining gaps in chromosomes induced by specific tissue culture conditions. They vary both in population frequency and in the culture conditions required for induction. Folate-sensitive fragile sites are due to expansion of p(CCG)(n) trinucleotide repeats; however, the relationship between sequence composition and the chemistry of induction of fragile sites is unclear. To clarify this relationship, the distamycin A-sensitive fragile site FRA16B was isolated by positional cloning and found to be an expanded 33 bp AT-rich minisatellite repeat, p(ATATATTATATATTATATCTAATAATATAT(C)/(A)TA)(n) (consistent with DNA sequence binding preferences of chemicals that induce its cytogenetic expression). Therefore the mutation mechanism associated with trinucleotide repeats is also a property of minisatellite repeats (variable number tandem repeats).

Drugs in the acute porphyrias - Toxicogenetic diseases

The acute Porphyrias are examples of toxico-genetic diseases and diseases genetically acquired, which show an idiosyncratic reaction to certain chemicals and drugs. Porphyrics are at risk of developing an acute attack if exposed to various precipitating factors of which drugs are the most common factor. This paper presents lists of drugs complied into those hazardous for patients with acute porphyria and those thought to be safe.

Effects of process modification and heat pump drying on physical and sensory properties of Chinese style shredded beef

Chinese-style dried, shredded meat is traditionally prepared by sequential cooking, shredding, pre-drying, and final drying (roasting) of lean meat. In this study, shredded dried beef (a(w)<0.6) was prepared by omitting roasting but prolonging pre-drying. Sensory scores of the modified product were lower than those for the traditional product. When heat pump drying replaced traditional oven drying, drying time was shortened without significant difference in quality attributes. Desorption curves were established for shredded beef at several drying temperatures.

Assessment of Occupational Genotoxic Risk among Brazilian Hairdressers

Objectives: To evaluate the genotoxic risk to hairdressers exposed daily to chemical substances such as hair dyes, waving and straightening preparations and manicurists` products by the Comet assay test (single-cell gel electrophoresis). Methods: The Comet assay was performed on blood samples from 69 female hairdressers (36.4 +/- 10.7 years old) currently employed in 21 different beauty institutes in Sao Paulo, Brazil, and on 55 female control blood donors (32.6 +/- 10.0 years old) from the Sao Paulo University Clinical Hospital blood bank. All the control subjects had occupations other than hairdresser. Comet assays were performed by evaluating 100 blood lymphocytes per individual and graded by visual score according to comet tail length. Results: The hairdressers showed a higher frequency of DNA damage revealed by Comet Score (159.8 +/- 71) when compared to the control group (125.4 +/- 64.1), and the difference was statistically significant by the Student`s t-test (P = 0.005). Multiple regression analysis showed that in addition to the hairdressers` profession, tobacco use contributed to the higher frequency of cells with comets (P < 0.05). Conclusions: The observed DNA damage could be associated with the hairdressers` occupational environment, where different chemicals are chronically manipulated and inhaled. Considering that this profession in many countries, including Brazil, is not officially regulated, more attention should focus on these professionals not only by legislative bodies but also by multidisciplinary teams able to develop and implement risk prevention and control strategies for chemical, physical and biological agents to which hairdressers are exposed.

Composition of Diesel Particles Influences Acute Pulmonary Toxicity: An Experimental Study in MICE

Ambient particles have been consistently associated with adverse health effects, yielding mainly high cardiorespiratory morbidity and mortality. Diesel engines represent a major source of particles in the urban scenario. We aimed to modify the composition of diesel particles, by means of different extraction procedures, to relate changes in chemical profile to corresponding indicators of respiratory toxicity. Male BALB/c mice were nasally instilled with saline, or with diesel particles, treated or not, and assigned to five groups: saline ( SHAM), intact diesel particles (DEP), and diesel particles previously treated with methanol ( METH), hexane ( HEX), or nitric acid (NA). Elemental composition and organic compounds were analyzed. Twenty-four hours after nasal instillation, respiratory parameters were measured and lung tissue was collected for histological analysis. Static elastance was significantly increased in groups DEP and MET in relation to the other groups. HEX and NA were different from DEP but not significantly different from SHAM and METH groups. The difference between dynamic and static elastance was increased in DEP, METH, and NA treatments; HEX was not statistically different from SHAM. DEP and METH groups presented significantly increased upper airways resistance, while DEP, METH, and NA showed higher peripheral airways resistance values. All groups had a higher total resistance than SHAM. DEP, METH, and NA showed significant increased infiltration of polymorphonuclear cells. In conclusion, diesel particles treated with hexane ( HEX) resulted in a respiratory-system profile very similar to that in SHAM group, indicating that hexane treatment attenuates pulmonary inflammation elicited by diesel particles.

Comparative analysis of two immunohistochemical methods for antigen retrieval in the optical lobe of the honeybee Apis mellifera: Myosin-v assay

The present study compared two heating methods currently used for antigen retrieval (AR) immunostaining: the microwave oven and the steam cooker. Myosin-V, a molecular motor involved in vesicle transport, was used as a neuronal marker in honeybee Apis mellifera brains fixed in formalin. Overall, the steam cooker showed the most satisfactory AR results. At 100 degrees C, tissue morphology was maintained and revealed epitope recovery, while evaporation of the AR solution was markedly reduced; this is important for stabilizing the sodium citrate molarity of the AR buffer and reducing background effects. Standardization of heat-mediated AR of formalin-fixed and paraffin-embedded tissue sections results in more reliable immunostaining of the honeybee brain.

Determination of temperature variation during the individual steps of the production of hospital diets of modified consistency

Background & aim: Many disease outbreaks of food origin are caused by foods prepared in Food Service and Nutrition Units of hospitals, affecting hospitalized patients who, in most cases, are immunocompromised and therefore at a higher risk of severe worsening of their clinical status. The aim of this study was to determine the variations in temperature and the time-temperature factor of hospital diets. Methods: The time and temperature for the preparation of 4 diets of modified consistency were determined on 5 nonconsecutive days in a hospital Diet and Nutrition Unit at the end of preparation and during the maintenance period, portioning and distribution at 3 sites, i.e., the first, the middle and the last to receive the diets. Results and discussion: All foods reached an adequate temperature at the end of cooking, but temperature varied significantly from the maintenance period to the final distribution, characterizing critical periods for microorganism proliferation. During holding, temperatures that presented a risk were reached by 16.7% of the meats and 59% of the salads of the general diet, by 16.7% of the garnishes in the bland diet and by 20% of the meats and garnishes in the viscous diet. The same occurred at the end of distribution for 100% of the hot samples and of the salads and for 61% of the desserts. None of the preparations remained at risk temperature for a time exceeding that established by law. Conclusion: The exposure to inadequate temperature did not last long enough to pose risks to the patient.

Protease activity and the ultrastructure of broiler chicken PSE (pale, soft, exudative) meat

The biological cause of broiler PSE meat seems to be an excessive release of Ca(2+), promoted by a genetic mutation of ryanodine receptors located in the sarcoplasmic reticulum of skeletal muscle cells. Excessive Ca(2+), associated with protein denaturation in meat, enhances protease activity and influences the functional properties of PSE meat. Twenty-four-hour post-mortem Pectoralis major m. samples exhibited lower values for pH, water-holding capacity, and shear force than did control samples, in contrast to colour (L*) and cooking loss values. Protease activity, measured as myofibril fragmentation index, presented higher values in PSE meat than in control samples. Ultrastructural examination revealed shrinking and depolymerisation of myofilaments and Z-lines disorganisation within the sarcomere in PSE meat. Intense calpain activity was also observed, indicating that the process may initiate at the filaments, because of protein denaturation, and spread through Z-lines, resulting in the collapse of the sarcomere structure. (C) 2009 Elsevier Ltd. All rights reserved.

Testing for Market Power in Multiple-Input, Multiple-Output Industries: The Australian Grains and Oilseeds Industries

Recent empirical studies have found significant evidence of departures from competition in the input side of the Australian bread, breakfast cereal and margarine end-product markets. For example, Griffith (2000) found that firms in some parts of the processing and marketing sector exerted market power when purchasing grains and oilseeds from farmers. As noted at the time, this result accorded well with the views of previous regulatory authorities (p.358). In the mid-1990s, the Prices Surveillence Authority (PSA 1994) determined that the markets for products contained in the Breakfast Cereals and Cooking Oils and Fats indexes were "not effectively competitive" (p.14). The PSA consequently maintained price surveillence on the major firms in this product group. The Griffith result is also consistent with the large number of legal judgements against firms in this sector over the past decade for price fixing or other types of non-competitive behaviour. For example, bread manufacturer George Weston was fined twice during 2000 for non-competitive conduct and the ACCC has also recently pursued and won cases against retailer Safeway in grains and oilseeds product lines.